CN102994509A - Eriocheir sinensis EsSXL gene, amplification primer group thereof and amplification method - Google Patents
Eriocheir sinensis EsSXL gene, amplification primer group thereof and amplification method Download PDFInfo
- Publication number
- CN102994509A CN102994509A CN 201210422535 CN201210422535A CN102994509A CN 102994509 A CN102994509 A CN 102994509A CN 201210422535 CN201210422535 CN 201210422535 CN 201210422535 A CN201210422535 A CN 201210422535A CN 102994509 A CN102994509 A CN 102994509A
- Authority
- CN
- China
- Prior art keywords
- essxl
- gene
- primer
- sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an Eriocheir sinensis EsSXL gene, an amplification primer group thereof and an amplification method. A full-length cDNA (complementary Deoxyribose Nucleic Acid) sequence of the EsSXL gene is cloned from an Eriocheir sinensis testis tissue by using the primer group provided by the invention, and the EsSXL gene comprises two variable spliceosomes EsSXL1 and EsSXL2, and lays an important foundation for the research of the important function of the function of the Eriocheir sinensis EsSXL gene in a sex differentiation process of the Eriocheir sinensis EsSXL gene.
Description
Technical field
The present invention relates to the gene clone field, particularly mitten crab
EsSXLGene comprises two kinds of variable spliced bodies
EsSXL1With
EsSXL2, its amplimer group and amplification method.
Background technology
Mitten crab (
Eriocheirsinensis) belong to Arthropoda, Crustachia, Decapoda, Reptantia, short-tail family, Grapsidae, the bending of leg subfamily, Eriocheir is commonly called as river crab.River crab is the fresh water crab of Chinese cultured output maximum, is distributed widely in the degree of saltiness water or freshwater of China's southeastern coast, and its delicious meat, unique flavor, nutritious, deeply be subjected to liking of broad masses.China is since early 1980s is realized the juvenile crab batch production, and industrial scale enlarges year by year, and the crabs production total amount reached 51.84 ten thousand tons in 2008, and the direct economy output value surpasses more than 30,000,000,000 yuan.Crustacean sex regulatory mechanism at present and unclear, river crab female higher than male economic worth, the sexual differentiation and the sex determination problem that solve river crab not only have important theory significance, also are the needs of industrial practice simultaneously.
The sex lethal gene (Sex lethal,
SXL) be the key gene in the insect sex determination regulation and control ladder,
SXLIt is more clearly that the function of gene is studied in fruit bat at present.
SXLRegulation and control to each ladder of sex determination belong to post-transcriptional control, are by the alternative splicing to hnRNA, produce different ripe mRNA and realize.With regard to fruit bat,
SXLGene has expression in the male and female individuality, but only has the form of function in female individuals, and in the male
SXLThe mRNA precursor is when splicing, and the 3rd exon keeps, and a terminator is arranged in the 3rd exon, thereby
SXLCause premature termination in the mRNA translation process, can not give expression to complete activated SXL.
By the homology comparison, we find the unique dead gene of existence in the crustaceans in the Genbank database
SXLHomologous gene or est sequence, for example:
Lepeophtheirus salmonisSXLHomologous gene (accession number:BT121101.1 and BT077985.1), Macrobrachium nipponensis (
Macrobrachium nipponense)
SXLHomology est sequences (accession number:FL588338.1 and JK526786.1) etc., we have cloned in mitten crab first here
SXLGene (called after:
EsSXL), and find
EsSXLTwo kinds of variable spliced bodies (splice variant) are arranged:
EsSXL1With
EsSXL2, these results establish important foundation for the economic crustacean Sex Determination Mechanism of further studying take mitten crab as representative.
Summary of the invention
The purpose of this invention is to provide mitten crab
EsSXLGene comprises two kinds of variable spliced bodies
EsSXL1With
EsSXL2, its amplimer group and amplification method.
The invention provides mitten crab
EsSXLGene comprises two kinds of variable spliced bodies
EsSXL1With
EsSXL2, its nucleotide sequence is respectively shown in SEQ ID NO.1 and SEQ ID NO.2.
The present invention also provides and has been used for the amplification mitten crab
EsSXLGene comprises two kinds of variable spliced bodies
EsSXL1With
EsSXL2Primer sets,
EsSXL1With
EsSXL2Share one group of amplimer, it is comprised of following primer:
Primer sets:
The nucleotide sequence of 3 ' forward outer primer 3aEsSXL-F1 is shown in SEQ ID NO.3;
The nucleotide sequence of 3 ' forward inner primer 3aEsSXL-F2 is shown in SEQ ID NO.4;
The nucleotide sequence of 5 ' oppositely outer primer 5aEsSXL-R1 is shown in SEQ ID NO.5;
The nucleotide sequence of 5 ' oppositely outer primer 5aEsSXL-R2 is shown in SEQ ID NO.6.
The present invention also provides a kind of amplification mitten crab
EsSXLGene comprises two kinds of variable spliced bodies
EsSXL1With
EsSXL2Method, comprise the steps:
Step 1: the total RNA that obtains mitten crab spermary tissue;
Step 2: from GenBank mitten crab nucleic acid database, screen a 511bp's
SXLDna homolog sequence (GenBank accession number:JR771373.1), increases according to this intermediate sequence design as intermediate sequence with this partial sequence
EsSXLThe Auele Specific Primer group of 3 of gene ' end and 5 ' end fragment:
The nucleotide sequence of 3 ' forward outer primer 3aEsSXL-F1 is shown in SEQ ID NO.3;
The nucleotide sequence of 3 ' forward inner primer 3aEsSXL-F2 is shown in SEQ ID NO.4;
The nucleotide sequence of 5 ' oppositely outer primer 5aEsSXL-R1 is shown in SEQ ID NO.5;
The nucleotide sequence of 5 ' oppositely outer primer 5aEsSXL-R2 is shown in SEQ ID NO.6;
Step 3: take the total RNA of step 1 gained as template, take described primer sets as primer, by the pcr amplification mitten crab
EsSXL3 of gene ' end and 5 ' end fragment; Described primer sets is comprised of following primer:
Step 4: with described
EsSXLGene intermediate sequence, described
EsSXL3 of gene ' end and the splicing of 5 ' end fragment, and get final product.
As preferably, the described amplification of step 3 is shell type two-wheeled PCR.
To the NCBI website blastx on-line analysis of institute's calling sequence, with
EsSXLThe highest front 100 homologous proteins that sequence all is SXL or SXL of sequence identity (Sequences producing significant alignments), test of significance reaches greatly (e＜1x10
-49), what wherein rank among the best comprises crustaceans:
Daphnia pulex(e＜1xe
-80),
Lepeophtheirus salmonis(e＜1xe
-57) SXL and the SXL of insects species.The EsSXL aminoacid sequence comprises the RRM structural domain of 2 series connection, has the characteristic feature of SXL albumen, and comprehensively these information can determine that institute's calling sequence is mitten crab
SXLGene.
Mitten crab
EsSXLGene comprises two kinds of variable spliced bodies
EsSXL1With
EsSXL2Coded aminoacid sequence and other species SXL aminoacid sequence utilize Clustalx 1.81 softwares to carry out the sequence alignment analysis and use MEGA3.1 software building NJ phylogenetic tree (such as Fig. 1), by phylogenetic tree as seen, 3 kinds of crustaceans SXL clusters are in a large branch, again with the SXL cluster of other species.
The present invention is organized as material with the mitten crab spermary, has separated mitten crab
EsSXLFull length gene cDNA sequence comprises two kinds of variable spliced bodies
EsSXL1With
EsSXL2((5 ' RACE) method is to mitten crab for 3 ' RACE) and 5 ' end cDNA rapid amplifying to utilize reverse transcriptase polymerase chain reaction (RT-PCR), nested polymerase chain reaction (nested-PCR), 3 ' end cDNA rapid amplifying
EsSXLGene is studied, and has been cloned into from mitten crab spermary tissue first
EsSXLFull length gene cDNA sequence comprises two kinds of variable spliced bodies
EsSXL1With
EsSXL2, and coded to it
EsSXLSequence signature, homology, evolutionary degree analyze, these results establish important foundation for the economic crustacean Sex Determination Mechanism of understanding take mitten crab as representative.
Description of drawings
Fig. 1 is the NJ systematic evolution tree of different types of animal SXL albumen;
Fig. 2 is 2 variable spliced bodies of 5 ' terminal sequence
EsSXL1With
EsSXL2PCR checking;
Fig. 3 is
EsSXLThe express spectra of gene in different tissues.
Embodiment
Below in conjunction with embodiment, further set forth the present invention.
Mitten crab is provided by Xuyi Jiangsu culture of Chinese mitten crab field among the present invention, and reagent all can be buied by market, and the reagent such as RNA purifying are available from U.S. Promega company etc., and 3 ' RACE and 5 ' RACE test kit are available from precious biological (Dalian) company limited (Takara).
Total RNA extracts: gets 100mg mitten crab spermary and is organized in and adds liquid nitrogen in the mortar and grind, extract total RNA with the Trizol method, and Trizol reagent employing Invitrogen company, extracting method is according to working instructions.
The clone of full length cDNA sequence:
Screen the SXL dna homolog sequence (GenBank accession number:JR771373.1) of a 511bp from GenBank mitten crab nucleic acid database, as intermediate sequence, design is increased with this partial sequence
EsSXLThe Auele Specific Primer group of 3 of gene ' end and 5 ' end fragment is used for 3 ' end and 5 ' end rapid amplifying:
The nucleotide sequence of 3 ' forward outer primer 3aEsSXL-F1 is shown in SEQ ID NO.3;
The nucleotide sequence of 3 ' forward inner primer 3aEsSXL-F2 is shown in SEQ ID NO.4;
The nucleotide sequence of 5 ' oppositely outer primer 5aEsSXL-R1 is shown in SEQ ID NO.5;
The nucleotide sequence of 5 ' oppositely outer primer 5aEsSXL-R2 is shown in SEQ ID NO.6.
EsSXLGene cDNA 3 ' end rapid amplifying (3 ' RACE):
According to
EsSXLThe gene intermediate sequence, design specificity 3 ' forward outer primer 3aEsSXL-F1 and 3 ' forward inner primer 3aEsSXL-F2, wherein, 3 ' RACE Outer the Primer that provides in 3 ' forward outer primer 3aEsSXL-F1 and the 3 ' RACE test kit forms primer to carrying out first round pcr amplification, amplified production is carried out second with 3 ' forward inner primer 3aEsSXL-F2 and 3 ' RACE Inner Primer take turns pcr amplification, obtain mitten crab
EsSXL3 ' end fragment of gene;
3′ RACE Outer Primer：5′ TACCGTCGTTCCACTAGTGATTT 3′
3′ RACE Inner Primer：5′ CGCGGATCCTCCACTAGTGATTTCACTATAGG 3′
Reverse transcription:
Carry out according to the working instructions in 3 ' RACE test kit, obtain 3 ' reverse transcription liquid, reaction system is as follows:
| |
1 μg |
| 3′ RACE Adaptor (5 μM) | 1 μL |
| 5×M- |
2 μL |
| dNTP Mixture (10 mM each) | 1 μL |
| RNase Inhibitor (40 U/μL) | 0.25 μL |
| Reverse Transcriptase M-MLV (RNase H-) (200 U/μL) | 0.25 μL |
| RNase Free dH 2O | up to 10 μL |
Reaction conditions is: 42 ℃, and 60 min; 70 ℃, 15 min;-20 ℃, preserve.
First round PCR:
Amplification reaction system is as follows:
| 3 ' reverse transcription liquid | 0.6 |
| 1×cDNA Dilution Buffer II | 2.4μL |
| 3aEsSXL-F1 (10 μM) | 0.6μL |
| 3′ RACE Outer Primer (10 μM) | 0.6μL |
| 10×LA PCR Buffer II (Mg 2+ Free) | 1.2μL |
| MgCl 2 (25 mM) | 0.9μL |
| TaKaRa LA Taq (5 U/μL) | 0.1μL |
| dH 2O | up to 15μL |
First round PCR reaction conditions is: 94 ℃, and 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 20 circulations; 72 ℃, 10 min; 4 ℃ of preservations.
Second takes turns PCR:
Amplification reaction system is as follows:
| First round PCR product | 1μL |
| dNTP Mixture (2.5 mM each) | 8μL |
| 10×LA PCR Buffer II (Mg 2+ Free) | 5μL |
| MgCl 2 (25 mM) | 5μL |
| TaKaRa LA Taq (5 U/μL) | 0.5μL |
| 3aEsSXL-F2 (10 μM) | 2μL |
| 3′ RACE Inner Primer (10 μM) | 2μL |
| dH 2O | up to 50μL |
Second takes turns the PCR reaction conditions is: 94 ℃, and 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 30 circulations; 72 ℃, 10 min.
Take turns the PCR product with second and detect with 1.5% agarose gel electrophoresis, cut glue and reclaim clear bright single band.Glue reclaims purifying and uses U.S.'s Axygen company product (AxyPrep DNA Gel Extracion Kit), and operation steps is undertaken by product description.The PCR product of purifying is connected with Beijing full Shi Jin pEASY-T1 of biotech company carrier, transforms
E.coliThe TOP10 bacterial strain carries out blue hickie screening, after the picking mono-clonal hickie amplification cultivation, send the order-checking of order-checking company.
EsSXLGene cDNA 5 ' end rapid amplifying (5 ' RACE):
According to
EsSXLThe gene intermediate sequence, design specificity 5 ' reverse outer primer 5aEsSXL-R1 and 5 ' is inner primer 5aEsSXL-R2 oppositely, wherein, 5 ' RACE Outer the Primer that provides in 5 ' oppositely outer primer 5aEsSXL-R1 and the 5 ' RACE test kit forms primer to carrying out first round pcr amplification, amplified production is carried out second with 5 ' oppositely inner primer 5aEsSXL-R2 and 5 ' RACE Inner Primer take turns pcr amplification, obtain mitten crab
EsSXL5 ' end fragment of gene.Positive and negative primer sequence is as follows:
5aEsSXL-R1：5' GCTATTGTAGTTTCCACGCCCTC 3'
5aEsSXL-R2：5' AAACCTGACAAAGCCAACACCTC 3'
5' RACE Outer Primer：5' CATGGCTACATGCTGACAGCCTA 3'
5' RACE Inner Primer：5' CGCGGATCCACAGCCTACTGATGATCAGTCGATG 3'
Reverse transcription:
Carry out according to 5'RACE test kit process specifications, at first use Alkaline Phosphatase (CIAP) that 5' phosphate group exposed among the Total RNA is carried out the dephosphorization acid-respons, then use Tobacco Acid Pyrophosphatase (TAP) to remove the 5' cap sequence of mRNA, keep a phosphate group, connect again 5'RACE Adaptor, carry out reverse transcription reaction again, obtain 5' reverse transcription liquid, the reverse transcription reaction system is as follows:
| Ligated RNA | 6 μL |
| Random 9 mers (50 μM) | 0.5 μL |
| 5×M- |
2 μL |
| dNTP (10 mM each) | 1 μL |
| RNase Inhibitor (40 U/μL) | 0.25 μL |
| Reverse Transcriptase M-MLV (RNase H-) (200 U/μl) | 0.25 μL |
The reverse transcription reaction condition is: 30 ℃ of 10min; 42 ℃ of 1hr; 70 ℃ of 15min.Reverse transcription product-20 ℃ preservation.
First round PCR:
Amplification reaction system is as follows:
| 5' reverse transcription liquid | 0.6 |
| 1×cDNA Dilution Buffer II | 2.4μL |
| 5aEsSXL-R1 (10 μM) | 0.6μL |
| 5′ RACE Outer Primer (10 μM) | 0.6μL |
| 10×LA PCR Buffer II (Mg 2+ Free) | 1.2μlL |
| MgCl 2 (25 mM) | 0.9μL |
| TaKaRa LA Taq (5 U/μL | 0.1μL |
| dH 2O | up to 15μL |
Reaction conditions is: 94 ℃, and 3 min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 20 circulations; 72 ℃, 10 min; 4 ℃ of preservations.
Second takes turns PCR:
Amplification reaction system is as follows:
| 1st PCR product | 1μL |
| dNTP Mixture (2.5 mM each) | 8μL |
| 10×LA PCR Buffer II (Mg 2+ Free) | 5μL |
| MgCl 2 (25 mM) | 5μL |
| TaKaRa LA Taq (5 U/μL | 0.5μL |
| 5aEsSXL-R2 (10 μM) | 2μL |
| 5′ RACE Inner Primer (10 μM) | 2μL |
| dH 2O | up to 50μL |
Reaction conditions is: 94 ℃, and 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 25 circulations; 72 ℃, 10 min.
Take turns the PCR product with second and detect with 1.5% agarose gel electrophoresis, cut glue and reclaim clear bright single band.Glue reclaims purifying and uses U.S.'s Axygen company product (AxyPrep DNA Gel Extracion Kit), and operation steps is undertaken by product description.The PCR product of purifying is connected with the full pEASY-T1 of formula King Company carrier, transforms
E.coliThe TOP10 bacterial strain carries out blue hickie screening, after the picking mono-clonal hickie amplification cultivation, send the order-checking of order-checking company.
With mitten crab
EsSXLThe 3' terminal sequence of gene, intermediate segment and 5' terminal sequence carry out the splicing of cDNA total length.Wherein the 5' sequence obtains two sequences that vary in size, after comparison, find be two sequences differ a 77bp splicing variants intron (splice variant intron) (Fig. 2)
EsSXL1,
EsSXL2
Carry out with the qPCR method
EsSXLGene express spectra in different tissues detects, and detecting instrument adopts Bio-Rad CFX96 System, according to
EsSXLCDNA full length sequence design primer to sequence is: EsSXL-F:5 ' AGTCGACCACAAGTTCTGCG 3 ' and EsSXL-R:5 ' TACTCCACGAAGCCAAACCC 3 ', reaction system adopts SYBERGREEN PCR kit for fluorescence quantitative (TAKARA company), using method is undertaken by the test kit specification sheets, response procedures is as follows: 95 ℃, and 15s, 60 ℃ of 20s, 72 ℃ of 20s, 3 repetitions are done in 40 circulations, each reaction, and the result shows
EsSXLGene is high expression level in spermary and hepatic tissue, almost can't detect expression (Fig. 3) and express in the optic stalk tissue.
Table 1 mitten crab EsSXL full length gene cDNA sequence signature
| Mitten crab (E.sinensis) | Mitten crab (E.sinensis) | |
| EsSXL1 | EsSXL2 | |
| Sequence total length (Full length) | 2450bp | 2527bp |
| 5' non-translational region (5'UTR) | 87bp | 87bp |
| Open reading frame (ORF) | 957bp | 738bp |
| 3' non-translational region (3'UTR) | 1406bp | 1702bp |
| Tailing signal (Poly A signal) | AATAAA | AATAAA |
| The protein (peptide) of coding | 318aa | 245 |
The above only is preferred implementation of the present invention; should be pointed out that for those skilled in the art, under the prerequisite that does not break away from the principle of the invention; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.
Sequence table
＜110〉China Aquatic Science Research Academy Fresh Water Fishery Research Center
＜120〉a kind of mitten crab EsSXL gene, its amplimer group and amplification method
<130>
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 2450
<212> DNA
<213> Eriocheir sinensis
<400> 1
gtgtggccac gcgcgtctcc cggcactctc cgcaacacct cgatgtttgg gtttatttag 60
gtttagattg aaaattagaa atctacaatg agttttgagt cgaccacaag ttctgcgctc 120
cccgaggggg agacccgcac caacctcatc ataaattacc tcccacagac tctaacggac 180
caagagtttt acaagatatt tgttgttgtt ggacctatta aaaactgccg cattatgaag 240
gacatgaagc agactggcta ctcgttcggg tttggcttcg tggagtacca gaagccagag 300
gacgcagcca aggccatcct acagttgaac aatctgcctg tgcagcacaa acgtatcaaa 360
gtgtcctatg ctcggccccc gggagaagac atcaaggaaa caaacctcta catacagaat 420
attcctagat catacacatt agatcagctt gaagagttat tttctgtata tggtcaaatc 480
gttcagaaga acctactaaa ggacaaagtg actggacttc caagaggtgt tggctttgtc 540
aggtttgata aaaagtcaca agctgaggca gcaataagtg gtatgaatgg tgttgttcct 600
gaggggggta cggagccatt ggtggtgaag gtagcggagg aacatggcaa aatgaaggca 660
gcctattatg ctggatatca tgcaggaatt aataatttga gaggcggagc aactgggcga 720
gggcgtggaa actacaatag ccgtggaggc agcggtggtg gcggtggagg ctaccagagc 780
cgtggcaact ataacaatat ggagcagaat cgtcagtacc accagggcgg caagatggcc 840
gcagaccgaa ctgccaatcg ctataacccc atcggcagtg gtggtggtta tggtgctgga 900
agcggtggtg caggctactc cggccatccc actggccagt cctcatttta tagcttctcc 960
actccatcgt tcagtggagg aaactacaca tcgttctcca acatgaacca tacctctagc 1020
agtgatggtt atggtcggta ctgaggcctg cctgtgtgga tgatttgagt gacaaaataa 1080
aaacaagata cttgcaggag ttttaaaaat atataatgag caatctattc cagtgggtgt 1140
tttgtagata atttaatgga aaatacagag ctaataacct gttacagtgg ttaaaccaaa 1200
taattatctt tttttctttg tttacaatga tagtatattc tagcaaaaca ttgtttgata 1260
taacattttt cctcatgaat agttgcatta tatcgaaacc ttccaagcga gggcactgac 1320
agctgaagtg ttagtcaaga tgtttgttca tcctatggaa tattcaggct ttaatgtcat 1380
ttgagaaatt gtgcaatgca ttttgaatgc ttagccgtct ggtgtagttg tctcttaaaa 1440
gtttttaaaa atttctttat ggcactctgg attttcagct ctgttttctt ataaaaaaac 1500
cggaaatatt ttgttaatga agttgcagtt tattcattac aattgaaata tacaattatt 1560
tctataaact gttgtcactc agattttttt ttatttttta tgtttattat gtgcttttaa 1620
atagcacagc tgggactcgg tttgcatcat aagatttccc ccacatttag tatacttatt 1680
tttctttttg ttactacata tattaatcaa cgtattttgg aagtgtgtgt ttttcattaa 1740
gtattttatt atactatgaa tttttcctgc agcagacaag tgatgttgct gtagctagat 1800
aatgtcattt atcatggtta ttatactgta gtcttattca tatatcctgt aattacataa 1860
ttgatggttt catatatctt tttccatatg tgttctttga tgcttggaaa atggtttaat 1920
atttttaggt aaaaataagg ttttgcttta agtttttcat aaaaatgttg acctcatggt 1980
tttgtttatg atgttctgtc attggtcggt actcagcata cctgaacata acgtatgatt 2040
atttcttttt tttccatgaa tctaaacaaa tgttttgtac agtgaaacat tatttttgct 2100
cacactgtaa taagttacgt gacagatata tttaataaag tgaaactatc aatgtattta 2160
cattattttg cattttatat atgtgctctt ggtaaaacag acattcacca ttgtttcaag 2220
tgtaaaattt agagaaagaa atcatgttct gctgggttcc caatcatgta gatggccctg 2280
gagaaaaccc agtggtccta agcctgcttg gcaatttcat ctggccaatc aggcttcttc 2340
cctattccag cttcatatct tttactggca ctgtcttgta tgtgcataag gtggttatcc 2400
cactggtcta caatctctgg taataaacta tgcagtaaaa aaaaaaaaaa 2450
<210> 2
<211> 2527
<212> DNA
<213> Eriocheir sinensis
<400> 2
gtgtggccac gcgcgtctcc cggcactctc cgcaacacct cgatgtttgg gtttatttag 60
gtttagattg aaaattagaa atctacaatg agttttgagt cgaccacaag ttctgcgctc 120
cccgaggggg agacccgcac caacctcatc ataaattacc tcccacagac tctaacggac 180
caagagtttt acaagatatt tgttgttgtt ggacctatta aaaactgccg cattatgaag 240
gacatgaagc agactggcta ctcgttcggg tttggcttcg tggagtacca gaagccagag 300
gacgcagcca aggccatcct acagttgaac aatctgcctg tgcagcacaa acgtatcaaa 360
gtgtcctatg ctcggccccc gggagaagac atcaaggaaa caaacctcta catacagaat 420
attcctagat catacacatt agatcagctt gaagagttat tttctgtata tggtcaaatc 480
gttcagaaga acctactaaa ggacaaagtg actggacttc caagaggtgt tggctttgtc 540
aggtttgata aaaagtcaca agctgaggca gcaataagtg gtatgaatgg tgttgttcct 600
gaggggggta cggagccatt ggtggtgaag gtagcggagg aacatggcaa aatgaaggca 660
gcctattatg ctggatatca tgcaggaatt aataatttga gaggcggagc aactgggcga 720
gggcgtggaa actacaatag ccgtggaggc agcggtggtg gcggtggagg ctaccagagc 780
cgtggcaact ataacaatat ggagtatcat cacaggtggt actgagccga ggagtggaag 840
gtgatgccag cgccacccgc cctcatcctc ctcgcaagca gcagaatcgt cagtaccacc 900
agggcggcaa gatggccgca gaccgaactg ccaatcgcta taaccccatc ggcagtggtg 960
gtggttatgg tgctggaagc ggtggtgcag gctactccgg ccatcccact ggccagtcct 1020
cattttatag cttctccact ccatcgttca gtggaggaaa ctacacatcg ttctccaaca 1080
tgaaccatac ctctagcagt gatggttatg gtcggtactg aggcctgcct gtgtggatga 1140
tttgagtgac aaaataaaaa caagatactt gcaggagttt taaaaatata taatgagcaa 1200
tctattccag tgggtgtttt gtagataatt taatggaaaa tacagagcta ataacctgtt 1260
acagtggtta aaccaaataa ttatcttttt ttctttgttt acaatgatag tatattctag 1320
caaaacattg tttgatataa catttttcct catgaatagt tgcattatat cgaaaccttc 1380
caagcgaggg cactgacagc tgaagtgtta gtcaagatgt ttgttcatcc tatggaatat 1440
tcaggcttta atgtcatttg agaaattgtg caatgcattt tgaatgctta gccgtctggt 1500
gtagttgtct cttaaaagtt tttaaaaatt tctttatggc actctggatt ttcagctctg 1560
ttttcttata aaaaaaccgg aaatattttg ttaatgaagt tgcagtttat tcattacaat 1620
tgaaatatac aattatttct ataaactgtt gtcactcaga ttttttttta ttttttatgt 1680
ttattatgtg cttttaaata gcacagctgg gactcggttt gcatcataag atttccccca 1740
catttagtat acttattttt ctttttgtta ctacatatat taatcaacgt attttggaag 1800
tgtgtgtttt tcattaagta ttttattata ctatgaattt ttcctgcagc agacaagtga 1860
tgttgctgta gctagataat gtcatttatc atggttatta tactgtagtc ttattcatat 1920
atcctgtaat tacataattg atggtttcat atatcttttt ccatatgtgt tctttgatgc 1980
ttggaaaatg gtttaatatt tttaggtaaa aataaggttt tgctttaagt ttttcataaa 2040
aatgttgacc tcatggtttt gtttatgatg ttctgtcatt ggtcggtact cagcatacct 2100
gaacataacg tatgattatt tctttttttt ccatgaatct aaacaaatgt tttgtacagt 2160
gaaacattat ttttgctcac actgtaataa gttacgtgac agatatattt aataaagtga 2220
aactatcaat gtatttacat tattttgcat tttatatatg tgctcttggt aaaacagaca 2280
ttcaccattg tttcaagtgt aaaatttaga gaaagaaatc atgttctgct gggttcccaa 2340
tcatgtagat ggccctggag aaaacccagt ggtcctaagc ctgcttggca atttcatctg 2400
gccaatcagg cttcttccct attccagctt catatctttt actggcactg tcttgtatgt 2460
gcataaggtg gttatcccac tggtctacaa tctctggtaa taaactatgc agtaaaaaaa 2520
aaaaaaa 2527
<210> 3
<211> 23
<212> DNA
＜213〉synthetic
<400> 3
cagaagaacc tactaaagga caa 23
<210> 4
<211> 23
<212> DNA
＜213〉synthetic
<400> 4
ataagtggta tgaatggtgt tgt 23
<210> 5
<211> 23
<212> DNA
＜213〉synthetic
<400> 5
gctattgtag tttccacgcc ctc 23
<210> 6
<211> 23
<212> DNA
＜213〉synthetic
<400> 6
aaacctgaca aagccaacac ctc 23
Claims (4)
1. mitten crab
EsSXLGene is characterized in that: its nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2.
2. one group is used for increasing mitten crab as claimed in claim 1
EsSXLThe primer sets of gene is characterized in that being comprised of following primer:
The nucleotide sequence of 3 ' forward outer primer 3aEsSXL-F1 is shown in SEQ ID NO.3;
The nucleotide sequence of 3 ' forward inner primer 3aEsSXL-F2 is shown in SEQ ID NO.4;
The nucleotide sequence of 5 ' oppositely outer primer 5aEsSXL-R1 is shown in SEQ ID NO.5;
The nucleotide sequence of 5 ' oppositely outer primer 5aEsSXL-R2 is shown in SEQ ID NO.6.
One kind the amplification mitten crab as claimed in claim 1
EsSXLThe method of gene is characterized in that comprising the steps:
Step 1: the total RNA that obtains mitten crab spermary tissue;
Step 2: from GenBank mitten crab nucleic acid database, screen
SXLDna homolog sequence (GenBank accession number:JR771373.1), as intermediate sequence, design as claimed in claim 2 primer sets according to this intermediate sequence with this partial sequence:
Step 3: take the total RNA of step 1 gained as template, take the described primer sets of step 2 as primer, by the pcr amplification mitten crab
EsSXL3 of gene ' end and 5 ' end fragment;
Step 4: with described
EsSXLGene intermediate sequence, described
EsSXL3 of gene ' end and the splicing of 5 ' end fragment, and get final product.
4. method as claimed in claim 3 is characterized in that the described amplification of step 3 is shell type two-wheeled PCR.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210422535 CN102994509A (en) | 2012-10-29 | 2012-10-29 | Eriocheir sinensis EsSXL gene, amplification primer group thereof and amplification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210422535 CN102994509A (en) | 2012-10-29 | 2012-10-29 | Eriocheir sinensis EsSXL gene, amplification primer group thereof and amplification method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102994509A true CN102994509A (en) | 2013-03-27 |
Family
ID=47923619
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210422535 Pending CN102994509A (en) | 2012-10-29 | 2012-10-29 | Eriocheir sinensis EsSXL gene, amplification primer group thereof and amplification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102994509A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104404033A (en) * | 2014-12-09 | 2015-03-11 | 江苏省农业科学院 | Method for improving complete transcript cloning efficiency of protein coding gene |
| CN109694906A (en) * | 2018-11-28 | 2019-04-30 | 宁波大学 | A kind of specific molecular marker for identifying Eriocheir sinensis gender |
| CN112481308A (en) * | 2019-09-11 | 2021-03-12 | 中国科学院分子植物科学卓越创新中心 | Novel sex determining gene HAKAI, its regulation and control action and application |
| CN113862272A (en) * | 2021-11-08 | 2021-12-31 | 上海海洋大学 | dsRNA (double-stranded ribonucleic acid) for silencing Dsx gene of eriocheir sinensis and application thereof |
-
2012
- 2012-10-29 CN CN 201210422535 patent/CN102994509A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104404033A (en) * | 2014-12-09 | 2015-03-11 | 江苏省农业科学院 | Method for improving complete transcript cloning efficiency of protein coding gene |
| CN109694906A (en) * | 2018-11-28 | 2019-04-30 | 宁波大学 | A kind of specific molecular marker for identifying Eriocheir sinensis gender |
| CN109694906B (en) * | 2018-11-28 | 2022-03-29 | 宁波大学 | Specific molecular marker for identifying sex of eriocheir sinensis |
| CN112481308A (en) * | 2019-09-11 | 2021-03-12 | 中国科学院分子植物科学卓越创新中心 | Novel sex determining gene HAKAI, its regulation and control action and application |
| CN112481308B (en) * | 2019-09-11 | 2023-04-25 | 中国科学院分子植物科学卓越创新中心 | Novel sex-determining gene HAKAI, its regulation and control effect and application |
| CN113862272A (en) * | 2021-11-08 | 2021-12-31 | 上海海洋大学 | dsRNA (double-stranded ribonucleic acid) for silencing Dsx gene of eriocheir sinensis and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112048572B (en) | LAMP technology-based shrimp health system visual rapid detection kit | |
| Samuelian et al. | Detection and monitoring of Greeneria uvicola and Colletotrichum acutatum development on grapevines by real-time PCR | |
| CN111500763A (en) | SNP molecular marker related to palmitoleic acid content in oil tea seed oil and application thereof | |
| CN102994509A (en) | Eriocheir sinensis EsSXL gene, amplification primer group thereof and amplification method | |
| Shao et al. | milR4 and milR16 mediated fruiting body development in the medicinal fungus Cordyceps militaris | |
| CN103361346A (en) | Method for cloning and analyzing populus diversifolia micro RNAs (ribonucleic acids) precursor | |
| Coetzee et al. | Phylogenetic analyses of DNA sequences reveal species partitions amongst isolates of Armillaria from Africa | |
| KR101615433B1 (en) | SNP marker for identifying the antlered form Ganoderma lucidum, and identifying method using the same | |
| CN112176080A (en) | Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma | |
| CN103397037A (en) | Macrobrachium nipponense MnIAG gene, and amplimer group and amplification method thereof | |
| CN110331223B (en) | Molecular marker, primer pair, kit and method for identifying different cane shoots types | |
| CN106868147B (en) | Molecular detection primer for sigatoka bacteria and rapid detection method thereof | |
| CN108676735B (en) | Fusarium pseudograminearum strain FC136-2A containing giant virus FpgMBV1 | |
| AU2020100222A4 (en) | Method of introducing double-stranded dna into the body of kerria chinensis | |
| CN102433323B (en) | Extraction method of high-quality genome DNA from endosperm of single rice grains | |
| CN113025724B (en) | Dual PCR primer, method and kit for identifying small pissodes punctatus | |
| CN112921104B (en) | Variable shear marker for assisting in selecting weight of sheep tail fat, detection primer and application thereof | |
| CN103555727B (en) | Living molecular detection method for precocious puberty individual of Eriocheir sinensis | |
| Fan et al. | A new species of Tremella ss (Tremellaceae, Basidiomycota) from southeastern China | |
| CN108728568B (en) | Specific molecular marker of ganoderma lucidum 80-108 strain and obtaining method and application thereof | |
| CN102776284B (en) | The diagnostic primers of Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker and discrimination method thereof | |
| CN106868134B (en) | Real-time quantitative PCR detection method for spores/gametes of ulva aquatica, ulva scleoides and hemerocallis fulva in sea cucumber culture water | |
| CN102994510A (en) | MnRXR gene of macrobrachium nipponensis, and amplification primer group and amplification method thereof | |
| CN110607377A (en) | Primer, probe and method for identifying Antarctic canine fish based on 16S rRNA gene | |
| CN110628958A (en) | Primer pair and kit for PCR detection of Eriocheir sinensis cocoon bee virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130327 |