CN103555727B - Living molecular detection method for precocious puberty individual of Eriocheir sinensis - Google Patents

Abstract

The invention discloses a living molecular detection method for precocious puberty individual of Eriocheir sinensis. Full-length cDNA sequence of EsEcR gene is cloned from Eriocheir sinensis tissue by the use of primer groups provided by the invention. Based on the gene sequence, the invention provides a living molecular detection method for precocious puberty individual of Eriocheir sinensis. The invention not only provides a living molecular detection method for precocious puberty individual of Eriocheir sinensis, but also provides an important testing method for early detection of Eriocheir sinensis precocious puberty individual.

Description

The individual living body molecule detection method of a kind of mitten crab sexual prematurity

Technical field

The invention belongs to genetically engineered field, particularly the living body molecule detection method of a kind of mitten crab EsEcR gene clone method and the mitten crab sexual prematurity individuality based on EsEcR gene.

Background technology

Mitten crab (Eriocheir sinensis) belongs to Arthropoda, Crustachia, Decapoda, Reptantia, short-tail race, Grapsidae, bending of leg subfamily, Eriocheir, be commonly called as river crab, be distributed widely in the coastal salt-fresh water in China southeast or freshwater, its delicious meat, unique flavor, river crab is the maximum fresh water crab of Chinese cultured output.As a kind of crustacean, the growth of river crab is embodied by form of casting off a skin.Casting off a skin and namely slough off old exoskeleton and grow new ectoskeletal process, is the most significant physiological characteristic of crustacean.River crab sexual maturity has restraining effect to shelling, also just not regrowth, shelling number of times directly determines the specification of river crab individuality, the economic worth of large gauge river crab is far above small river crab, but at present in culture of Chinese mitten crab is produced, ubiquity the Precocious Maturation of Chinese Mitten-handed Crab Eriocheir Sinensis phenomenon of 20%-30%, precocious river crab individuality is very little, sexual gland maturation no longer shells, also i.e. not regrowth, and commodity value is extremely low.Sex gland mature degree intuitively can be reacted by sex gland mature index (gonadosomaticindex, GSI), and obtain genital gland indices must to be weighed sexual gland by dissection, cannot In vivo detection.

Ecdysone receptor (ecdysteroid receptor, ECR) is one of animal nuclear receptor (nuclear receptor) superfamily member, mainly finds in invertebrates.RXR has important biological function, with retinoic acid receptor X (RXR, retinoid x receptor) effect formation heterodimer, moulting hormone enters in cell the form thus the expression of a series of relevant gene of casting off a skin in regulation and control downstream that combine with it and be formed with function, the final reaction of casting off a skin triggering animal.RXR-ECR heterodimer is that crustaceans etc. is casted off a skin the requisite key node of molecular signaling pathway.

At present, several Shrimp waste EcR gene is had to be cloned, comprise: Marsupenaeus japonicas, Fenneropenaeuschinensis, Crangon crangon etc., and the EcR gene of mitten crab (called after here: EsEcR) have not been reported.

Summary of the invention

The object of the invention is to provide a kind of mitten crab sexual prematurity individual living body molecule detection method to overcome the deficiencies in the prior art.

We utilize RACE (rapid-amplification of cDNA ends) clone technology to clone the EcR full length gene cDNA of mitten crab, find that the expression amount of EcR gene in sexual prematurity individuality is significantly lower than normal individual by quantitative PCR analysis, only have the 27%(p < 0.001 of normal individual expression amount), the living body molecule that this result can be applicable to Precocious Maturation of Chinese Mitten-handed Crab Eriocheir Sinensis individuality detects.

The present invention is realized by following technique means:

A kind of mitten crab EsEcR gene, its nucleotide sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2.

For a primer sets for pcr amplification above-described mitten crab EsEcR gene, be made up of following primer:

3 ' forward outer primer 3aEsEcR-F1: sequence is as shown in SEQ ID NO.3;

3 ' forward inner primer 3aEsEcR-F2: sequence is as shown in SEQ ID NO.4;

5 ' reverse outer primer 5aEsEcR-R1: sequence is as shown in SEQ ID NO.5;

5 ' reverse inner primer 5aEsEcR-R2: sequence is as shown in SEQ ID NO.6.

Increase the method for above-described mitten crab EsEcR gene, it is characterized in that, comprise the steps:

Step 1: the total serum IgE obtaining Tissue of Eriocheir Sinensis;

Step 2: screen an EcR DNA homolog sequence from GenBank mitten crab nucleic acid database, as intermediate sequence, using this sequence as template, 3 ' and 5 ' Auele Specific Primer group of end fragment of design amplification EsECR gene;

Step 3: with step 1 gained total serum IgE reverse transcription product for template, hold with 3 ' of the primer pair template shown in the primer shown in SEQ NO.3 and 4 and SEQ NO.5 and SEQ ID NO.6 end and 5 ' respectively and carry out nido two-wheeled pcr amplification, obtain 3 ' and 5 ' end fragment of mitten crab EsEcR gene;

Step 4: by 3 ' and 5 ' end fragment splicing of the gene of mitten crab EsEcR described in intermediate sequence described in step 2, step 3, obtain the mitten crab EsEcR gene after amplification.

The method of above-described amplification mitten crab EsEcR gene, wherein 3 ' end and 5 ' end carry out the condition of 3 ' end first round pcr amplification of nido two-wheeled pcr amplification is 94 DEG C, 3min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 2min, 20 circulations; 72 DEG C, 10min; 4 DEG C of preservations.

The method of above-described amplification mitten crab EsEcR gene, the condition that the 3 ' end second that wherein 3 ' end and 5 ' end carry out nido two-wheeled pcr amplification takes turns pcr amplification is 94 DEG C, 3min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 2min, 30 circulations; 72 DEG C, 10min.

The method of above-described amplification mitten crab EsEcR gene, wherein 3 ' end and 5 ' end carry out the condition of 5 ' end first round pcr amplification of nido two-wheeled pcr amplification is 94 DEG C, 3min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 2min, 20 circulations; 72 DEG C, 10min; 4 DEG C of preservations.

The method of above-described amplification mitten crab EsEcR gene, the condition that the 5 ' end second that wherein 3 ' end and 5 ' end carry out nido two-wheeled pcr amplification takes turns pcr amplification is 94 DEG C, 3min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 2min, 25 circulations; 72 DEG C, 10min.

Carry out blastx on-line analysis to gained sequence NCBI website, front 100 sequences the highest with EsEcR sequence identity (Sequencesproducing significant alignments) are all homologous protein (e<1 × 10 of EcR ^-144), wherein front 16 sequences come from 9 kinds of different Shrimp waste respectively: Uca pugilator (calling damp crab together), Scylla paramamosain(Scylla paramamosain), Homarus americanus(America Hai Ao shrimp), Callinectes sapidus(blue crab), Portunus trituberculatus(Portunus trituberculatus Miers), Crangon crangon(brown shrimp), Gecarcinus lateralis(land carb) Marsupenaeus japonicus(Marsupenaeus japonicus) and the common beach crab of Carcinus maenas() EcR(comprise different variable sheer bodies), test of significance reaches greatly (e=0), can determine that gained sequence is mitten crab EcR gene.The aminoacid sequence that mitten crab EsEcR gene is inferred has typical EcR nuclear receptor sequence signature, and comprise N and hold DNA binding domains (DNA bindingdomain, DBD), C holds ligand binding domains (ligand binding domain, LBD).

By to mitten crab EsEcR, comprise aminoacid sequence coded by two kinds of variable sheer body EsEcR-L and EsEcR-S and other species EcR aminoacid sequence utilizes Clustalx1.81 software carry out sequence alignment analysis and use MEGA3.1 software building NJ phylogenetic tree (as Fig. 1), from phylogenetic tree, crustaceans EcR cluster is in a large branch.

Based on the EsEcR gene order be cloned into, present invention also offers a kind of specific primer group detecting the mitten crab sexual prematurity individuality based on EsEcR gene for PCR, it is made up of following primer:

Forward primer preco-EsEcR-F: sequence is as shown in SEQ ID NO.7;

Reverse primer preco-EsEcR-R: sequence is as shown in SEQ ID NO.8.

Based on the EsEcR gene order be cloned into, present invention also offers a kind of living body molecule detection method of the mitten crab sexual prematurity individuality based on EsEcR gene, comprise the steps:

Step 1: obtain the total serum IgE of Juvenile Crab Eriocheir sinensis muscle tissue and reverse transcription;

Step 2: with the total reverse transcription product of step 1 gained for template, with specific primer group as above for primer, obtains the relative expression levels of EsEcR gene by quantitative pcr amplification;

Step 3: being less than the Eriocheir sinensis individuality of 1% for normal individual with sex gland mature index, when detecting individual EsEcR gene expression dose lower than normal individual 50%, being defined as mitten crab sexual prematurity individual.

The present invention utilizes reverse transcriptase polymerase chain reaction (RT-PCR), nested polymerase chain reaction (nested-PCR), 3 ' holds cDNA rapid amplifying (3 ' RACE) and 5 ' to hold the method for cDNA rapid amplifying (5 ' RACE), mitten crab EsEcR gene is studied, EsEcR full length gene cDNA sequence has been cloned into first from mitten crab, and the sequence signature of the EsEcR coded by it, homology and evolutionary degree are analyzed, determine that it is EsEcR gene.、

Based on the EsEcR gene obtained, the difference of sexual prematurity individuality and normal individual EsEcR gene expression dose is have studied with quantifying PCR method, find that the expression amount of EcR gene in sexual prematurity individuality is significantly lower than normal individual, only have the 27%(p < 0.001 of normal individual expression amount), based on this result, establish a kind of living body molecule detection method of Precocious Maturation of Chinese Mitten-handed Crab Eriocheir Sinensis individuality.

Accompanying drawing explanation

Fig. 1 is the NJ systematic evolution tree of different types of animal EcR nuclear receptor;

Fig. 2 is the difference of mitten crab sexual prematurity individuality and normal individual EsEcR gene expression dose.

Embodiment

Below in conjunction with embodiment, set forth the present invention further.

The reagent purchased from American Promega companies etc. such as in the present invention, mitten crab is provided by Taihu Lake, Wuxi fisherman, and reagent all can be buied by market, RNA purifying, 3 ' RACE and 5 ' RACE test kit is purchased from precious biological (Dalian) company limited (Takara).

The method of amplification mitten crab EsEcR gene, comprises the steps:

(1) Total RNAs extraction:

Get 100mg Tissue of Eriocheir Sinensis and add liquid nitrogen grinding in mortar, extract total serum IgE by Trizol method, Trizol reagent adopts Invitrogen company, and extracting method is according to working instructions.

(2) clone of mitten crab EsEcR full length gene cDNA sequence:

The EcR DNA homolog sequence (GenBankaccession number:JR736395.1) of a 217bp is screened from GenBank mitten crab nucleic acid database, using this sequence as intermediate sequence, 3 ' end of design amplification EsEcR gene and the Auele Specific Primer group of 5 ' end fragment, for 3 ' end and 5 ' end rapid amplifying:

(a) EsEcR gene cDNA 3 ' end rapid amplifying (3 ' RACE):

According to EsEcR Gene Partial sequence, design specificity 3 ' forward outer primer 3aEsEcR-F1 and 3 ' forward inner primer 3aEsEcR-F2, wherein, 3 ' RACE the OuterPrimer provided in 3 ' forward outer primer 3aEsEcR-F1 and 3 ' RACE test kit forms primer pair and carries out first round pcr amplification, with 3 ' forward inner primer 3aEsEcR-F2 and 3 ' RACE Inner Primer, second is carried out to amplified production and takes turns pcr amplification, obtain 3 ' end fragment of mitten crab EsEcR gene;

3aEsEcR-F1：5′TTCTTTGATATTGCACCACATTTTAG3′（SEQ ID NO.3）

3aEsEcR-F2：5′GTAACTACGGTGCCGACTCCTAC3′（SEQ ID NO.4）

3′RACE Outer Primer：5′TACCGTCGTTCCACTAGTGATTT3′(SEQ ID NO.9)

3′RACE Inner Primer：5′CGCGGATCCTCCACTAGTGATTTCACTATAGG3′(SEQID NO.10)

(b) reverse transcription:

Carry out according to the working instructions in 3 ' RACE test kit, obtain 3 ' reverse transcription liquid, reaction system is as follows:

Reaction conditions is: 42 DEG C, 60min; 70 DEG C, 15min;-20 DEG C, preserve.

First round PCR:

Amplification reaction system is as follows:

First round PCR reaction conditions is: 94 DEG C, 3min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 2min, 20 circulations; 72 DEG C, 10min; 4 DEG C of preservations.

Second takes turns PCR:

Amplification reaction system is as follows:

Second takes turns PCR reaction conditions is: 94 DEG C, 3min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 2min, 30 circulations; 72 DEG C, 10min.

Take turns PCR primer 1.5% agarose gel electrophoresis to detect second, cut glue and reclaim clear bright single band.Glue reclaims purifying and uses U.S. Axygen Products (AxyPrep DNA Gel Extracion Kit), and operation steps is undertaken by product description.The PCR primer of purifying is connected with Beijing Quan Shijin biotech company pEASY-T1 carrier, and Transformed E .coliTOP10 bacterial strain, carries out blue hickie screening, after picking mono-clonal hickie amplification cultivation, send order-checking company to check order.

(c) EsEcR gene cDNA 5 ' end rapid amplifying (5 ' RACE):

According to EsEcR Gene Partial sequence, design specificity 5 ' is outer primer 5aEsEcR-R1 and 5 ' oppositely inner primer 5aEsEcR-R2 oppositely, wherein, 5 ' RACE the OuterPrimer provided in 5 ' reverse outer primer 5aEsEcR-R1 and 5 ' RACE test kit forms primer pair and carries out first round pcr amplification, with 5 ' reverse inner primer 5aEsEcR-R2 and 5 ' RACE Inner Primer, second is carried out to amplified production and takes turns pcr amplification, obtain 5 ' end fragment of mitten crab EsEcR gene.Positive and negative primer sequence is as follows:

5aEsEcR-R1：5′TTCTTCAGGTCGCCGTAGGAGTC3′(SEQ ID NO.5)

5aEsEcR-R2：5′TCATCTCGCCCCTAAAATGTGGT3′(SEQ ID NO.6)

5′RACE Outer Primer：5′CATGGCTACATGCTGACAGCCTA3′(SEQ ID NO.11)

5′RACE Inner Primer：5′CGCGGATCCACAGCCTACTGATGATCAGTCGATG3′(SEQ ID NO.12)

(d) reverse transcription:

Carry out according to 5 ' RACE test kit process specifications, first Alkaline Phosphatase (CIAP) is used to carry out dephosphorization acid-respons to 5 ' phosphate group exposed in Total RNA, then Tobacco Acid Pyrophosphatase (TAP) is used to remove the 5 ' cap sequence of mRNA, retain a phosphate group, connect 5 ' RACE Adaptor again, carry out reverse transcription reaction again, obtain 5 ' reverse transcription liquid, reverse transcription reaction system is as follows:

Reverse transcription reaction condition is: 30 DEG C of 10min; 42 DEG C of 1hr; 70 DEG C of 15min.Reverse transcription product-20 DEG C preservation.

First round PCR

Amplification reaction system is as follows:

First round PCR reaction conditions is: 94 DEG C, 3min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 2min, 20 circulations; 72 DEG C, 10min; 4 DEG C of preservations.

Second takes turns PCR:

Amplification reaction system is as follows:

Second takes turns PCR reaction conditions is: 94 DEG C, 3min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 2min, 25 circulations; 72 DEG C, 10min.

Take turns PCR primer 1.5% agarose gel electrophoresis to detect second, cut glue and reclaim purifying, use U.S. Axygen Products (AxyPrep DNA Gel Extracion Kit), operation steps is undertaken by product description.The PCR primer of purifying is connected with Quan Shi King Company pEASY-T1 carrier, and Transformed E .coli TOP10 bacterial strain carries out blue hickie screening, after picking mono-clonal hickie amplification cultivation, send order-checking company to check order.

3 ' sequence of mitten crab EsEcR gene, intermediate segment and 5 ' sequence are carried out the splicing of cDNA total length.Wherein 5 ' sequence obtains two sequences varied in size, and finds it is the splicing variants intron (splice variant intron) that two sequences differ a 477bp after comparison.Obtain 2 EsEcR full length cDNA sequences after splicing, the EsEcR-S(being respectively EsEcR-L and 2045bp of 2522bp is shown in SEQ ID NO.1 and SEQ ID NO.2).

Normal young crab genital gland indices (GSI) is lower than 1%, and sexual prematurity children crab genital gland indices is higher than 10%, even reach more than 20%, select normal young crab and sexual prematurity children each 7 of crab, dissect and measure genital gland indices, extract muscle tissue RNA and reverse transcription, the detection of EsEcR expression amount is carried out by qPCR method, detecting instrument adopts Bio-Rad CFX96System, according to EsEcR cDNA full length sequence design primer pair sequence be: preco-EsEcR-F:5 ' CTCCCGGGTGCCATATTACC3 ' (SEQ ID NO.7) and preco-EsEcR-R:5 ' TGCTACACGGCACATTCACT3 ' (SEQ ID NO.8), internal reference is made with river crab beta actin gene, beta actin gene primer is: Esbetaactin-F:5 ' GCATCCACGAGACCACTTACA3 ' (SEQ ID NO.13) and Esbetaactin-R:5 ' CTCCTGCTTGCTGATCCACATC3 ' (SEQ ID NO.14), reaction system adopts SYBERGREEN PCR kit for fluorescence quantitative (TAKARA company), using method is undertaken by test kit specification sheets, response procedures is as follows: 95 DEG C, 15s, 60 DEG C of 20s, 72 DEG C of 20s, 40 circulations, 3 repetitions are done in each reaction, the relative expression quantity of EcR gene is finally gone out according to the comparing calculation of EcR gene and beta actin gene expression amount.In result display sexual prematurity individuality, the expression amount of EcR gene is significantly lower than normal individual, only has 27% of normal individual expression amount, (p < 0.001).Accompanying drawing 2 is relative expression quantities of 7 precocious individualities and 7 normal individual EcR genes, and precocious individual EcR gene relative expression quantity is generally lower than 0.01, and normal individual is all higher than 0.03.Due to detect here sexual prematurity children crab be all that precocious feature is obviously individual, consider the different steps that sexual prematurity occurs, the present invention with detect individual EcR gene relative expression quantity lower than normal individual 50% time be defined as mitten crab sexual prematurity individuality.

Mitten crab EsEcR full length gene cDNA sequence feature is in table 1.

Table 1 mitten crab EsEcR full length gene cDNA sequence feature

The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the premise without departing from the principles of the invention; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.

Sequence table

<110> China Aquatic Science Research Academy Fresh Water Fishery Research Center

The individual living body molecule detection method of <120> mitten crab sexual prematurity

<130> 2013

<160> 14

<170> PatentIn version 3.3

<210> 1

<211> 2522

<212> DNA

<213> Eriocheir sinensis

<400> 1

gtgtgcggta tacagcggtg cgacaggctc tccgtgtacc cccggccggc gccccgcggt 60

gtattggcgc gtccacccct ctgagttcag tactgcttca tggaggagga cctaattttt 120

gatgtgcaga aaggagttgt ctatgtgttg ttcgccaatc tgccgaggat cgttggatat 180

aagtgagatt tgagtcagtt ttaccttagt gttggctggc tcggactgga ccaccgcccc 240

gtccgaatac ctccgccgcg gtccctggca ccgatctggg atttggatat cggtgttgag 300

tcgtcggcaa tacggtgaag ctcagtgttt tgttggtgta gaaggtacac agtgacgtat 360

ttgacgacga aaacccggct caaagtcagt gtgtgtgagg attgcaagag agaacgtact 420

ttggtcggtg ttcgattccc tccctcgccc gactcggcac caacggggac tggcaccggc 480

gtcgactccg ccttctacca ccgacgacag agtgtgatgg tgtgggcgtg acgatggacc 540

tccctcgcga ctccccacac cggggccgcg ggtttatggg cggtcggtca cctacacccc 600

attcttcgct gatccactcc ctcgtctccc ccaagatgga ccattccccc accagtcctc 660

cctatgtcgc cagttcccct ttgctgggcg agtctccctc gggcattcct cgttcccctg 720

tctcccccct gggcgtcttg gtcaagagtg agccccctgt gtccccatcg ggcccctcgg 780

agtaccaagt gaggcccaaa aagccgcgtt ccgacgggga gagggccgag tgggcctcct 840

cccccggcgc catgagcatc gactccctct ctccgccgcc ccagggctcc aatggcgtcg 900

ggggctccct gggacacccc tccagcggca tgtctccgat gtcctcctcc agctacgacc 960

ccagctctcc ctacctctcc agatcagggc gagatgacat gtcgccgccc tcatcgctga 1020

gtaactacgg tgccgactcc tacggcgacc tgaagaagaa gaaaggcccc atcccgcgcc 1080

agcaggagga gttatgtctg gtgtgcggcg acagggcatc gggctaccac tacaacgccc 1140

tcacctgtga aggatgcaaa ggtttcttcc ggagatccat cacgaagaat gccgtgtacc 1200

agtgtaaata tggcaacaac tgtgagatgg atatgtacat gcggcgcaag tgtcaagagt 1260

gtcgcctcaa aaagtgtctc aacgtgggca tgcggccaga atgtgttgtg cccgagtctc 1320

agtgccaggt gaagagagaa cagaaaaagg cacgagacaa ggacaaaagg gattacccga 1380

gcctagggtc ccctatagcc gaggacaagg ctggccccat tagtccagtg agtaaagatt 1440

gtaaatccaa aggtccatca actgcgtgtg ctatgcagtt caaaaatctt gttgacagct 1500

ctagcaacgt tcagtctcct atgtcagcca tgcagcggac aaccaccaag ccactcacgc 1560

gggagcagga ggagctgatc aatactctag tctactacca agaagagttt gaacagccaa 1620

ctgaagcgga tataaagaag atcagattta acttcgatgg tgaagataca agtgacatga 1680

gattcaggca cataaccgag atgacgatcc tcacagttca gctcatagtg gaattctcca 1740

agcaactacc aggtttcgcc acacttcaac gagaagacca gattaccctg ctcaaggctt 1800

gttcatcaga ggtaatgatg cttcgagcag cccggcgtta tgattccaag acagattgca 1860

ttgtgtttgg aaacagcttc ccctacacac aagcctccta tgcactagct ggcttgggag 1920

attcagcaga ggtactcttc cgtttctgcc gtagcctttg taaaatgaag gtggacaacg 1980

cagagtatgc actactagct gccatagcta ttttctcaga gaggccaaac cttaaagaac 2040

tcaaaaaggt ggaaaaactt caggaaatct accttgaagc attgaagtct tatgtagaga 2100

atcgacgact gcctcggtct cacatggtgt ttgcgaagtt gcttaatatc ctcacagagt 2160

tgcggaccct tggaaatatt aactcagaga tgtgcttctc cctcacattc aagaacaaaa 2220

gactcccacc cttcctggct gagatctggg atgtttctgg atactgagcc tcagccacct 2280

cccgggtgcc atattaccga ggtaaaatgt tggcgcaaga aggttgtgag ccctctgggg 2340

gtggtggatg gactctacac tatgtacctg caggctgtga gtgagagact gttgatgctg 2400

tggcagcagc ttcacactgc cacccagggc ccactttcag ccacttgacg tgtctatggt 2460

tcaggccacc agtgaatgtg ccgtgtagca ctccactatt aaaatttaaa gaaaaaaaaa 2520

aa 2522

<210> 2

<211> 2045

<212> DNA

<213> Eriocheir sinensis

<400> 2

gtgtgcggta tacagcggtg cgacaggctc tccgtgtacc cccggccggc gccccgcggt 60

gtattggcgc gtccacccct ctgagttcag tactgcttca tggaggagga cctaattttt 120

gatgtgcaga aaggagttgt ctatgtgttg ttcgccaatc tgccgaggat cgttggatat 180

aagtgagatt tgagtcagtt ttaccttagt gttggctggc tcggactgga ccaccgcccc 240

gtccgaatac ctccgccgcg gtccctggca ccgatctggg atttggatat cggtgttgag 300

tcgtcggcaa tacggtgaag ctcagtgttt tgttggtgta gaaggtacac agtgacgtat 360

ttgacgacga aaacccggct caaagtcagt gtgtgtgagg attgcaagag agaacgtact 420

ttggtcggtg ttcgattccc tccctcgccc gactcggcac caacggggac tggcaccggc 480

gtcgactccg ccttctacca ccgacgacag ggcgagatga catgtcgccg ccctcatcgc 540

tgagtaacta cggtgccgac tcctacggcg acctgaagaa gaagaaaggc cccatcccgc 600

gccagcagga ggagttatgt ctggtgtgcg gcgacagggc atcgggctac cactacaacg 660

ccctcacctg tgaaggatgc aaaggtttct tccggagatc catcacgaag aatgccgtgt 720

accagtgtaa atatggcaac aactgtgaga tggatatgta catgcggcgc aagtgtcaag 780

agtgtcgcct caaaaagtgt ctcaacgtgg gcatgcggcc agaatgtgtt gtgcccgagt 840

ctcagtgcca ggtgaagaga gaacagaaaa aggcacgaga caaggacaaa agggattacc 900

cgagcctagg gtcccctata gccgaggaca aggctggccc cattagtcca gtgagtaaag 960

attgtaaatc caaaggtcca tcaactgcgt gtgctatgca gttcaaaaat cttgttgaca 1020

gctctagcaa cgttcagtct cctatgtcag ccatgcagcg gacaaccacc aagccactca 1080

cgcgggagca ggaggagctg atcaatactc tagtctacta ccaagaagag tttgaacagc 1140

caactgaagc ggatataaag aagatcagat ttaacttcga tggtgaagat acaagtgaca 1200

tgagattcag gcacataacc gagatgacga tcctcacagt tcagctcata gtggaattct 1260

ccaagcaact accaggtttc gccacacttc aacgagaaga ccagattacc ctgctcaagg 1320

cttgttcatc agaggtaatg atgcttcgag cagcccggcg ttatgattcc aagacagatt 1380

gcattgtgtt tggaaacagc ttcccctaca cacaagcctc ctatgcacta gctggcttgg 1440

gagattcagc agaggtactc ttccgtttct gccgtagcct ttgtaaaatg aaggtggaca 1500

acgcagagta tgcactacta gctgccatag ctattttctc agagaggcca aaccttaaag 1560

aactcaaaaa ggtggaaaaa cttcaggaaa tctaccttga agcattgaag tcttatgtag 1620

agaatcgacg actgcctcgg tctcacatgg tgtttgcgaa gttgcttaat atcctcacag 1680

agttgcggac ccttggaaat attaactcag agatgtgctt ctccctcaca ttcaagaaca 1740

aaagactccc acccttcctg gctgagatct gggatgtttc tggatactga gcctcagcca 1800

cctcccgggt gccatattac cgaggtaaaa tgttggcgca agaaggttgt gagccctctg 1860

ggggtggtgg atggactcta cactatgtac ctgcaggctg tgagtgagag actgttgatg 1920

ctgtggcagc agcttcacac tgccacccag ggcccacttt cagccacttg acgtgtctat 1980

ggttcaggcc accagtgaat gtgccgtgta gcactccact attaaaattt aaagaaaaaa 2040

aaaaa 2045

<210> 3

<211> 26

<212> DNA

<213> artificial sequence

<400> 3

ttctttgata ttgcaccaca ttttag 26

<210> 4

<211> 23

<212> DNA

<213> artificial sequence

<400> 4

gtaactacgg tgccgactcc tac 23

<210> 5

<211> 23

<212> DNA

<213> artificial sequence

<400> 5

ttcttcaggt cgccgtagga gtc 23

<210> 6

<211> 23

<212> DNA

<213> artificial sequence

<400> 6

tcatctcgcc cctaaaatgt ggt 23

<210> 7

<211> 20

<212> DNA

<213> artificial sequence

<400> 7

ctcccgggtg ccatattacc 20

<210> 8

<211> 20

<212> DNA

<213> artificial sequence

<400> 8

tgctacacgg cacattcact 20

<210> 9

<211> 23

<212> DNA

<213> 3′ RACE Outer Primer

<400> 9

taccgtcgtt ccactagtga ttt 23

<210> 10

<211> 32

<212> DNA

<213> 3′ RACE Inner Primer

<400> 10

cgcggatcct ccactagtga tttcactata gg 32

<210> 11

<211> 23

<212> DNA

<213> 5′RACE Outer Primer

<400> 11

catggctaca tgctgacagc cta 23

<210> 12

<211> 34

<212> DNA

<213> 5′RACE Inner Primer

<400> 12

cgcggatcca cagcctactg atgatcagtc gatg 34

<210> 13

<211> 21

<212> DNA

<213> Esbetaactin-F

<400> 13

gcatccacga gaccacttac a 21

<210> 14

<211> 22

<212> DNA

<213> Esbetaactin-R

<400> 14

ctcctgcttg ctgatccaca tc 22

 

Claims (1)

1. a living body molecule detection method for the mitten crab sexual prematurity individuality based on EsEcR gene, is characterized in that, comprise the steps:

Step 1: obtain the total serum IgE of Juvenile Crab Eriocheir sinensis muscle tissue and reverse transcription;

Step 2: with the total reverse transcription product of step 1 gained for template, with specific primer group for primer, obtains the relative expression levels of EsEcR gene by quantitative pcr amplification;

Step 3: being less than the Eriocheir sinensis individuality of 1% for normal individual with sex gland mature index, when detecting individual EsEcR gene expression dose lower than normal individual 50%, being defined as mitten crab sexual prematurity individual;

Above-described specific primer group is forward primer preco-EsEcR-F: sequence is as shown in SEQ ID NO.7; Reverse primer preco-EsEcR-R: sequence is as shown in SEQ ID NO.8.