CN103555727A - Living molecular detection method for precocious puberty individual of Eriocheir sinensis - Google Patents

Abstract

The invention discloses a living molecular detection method for precocious puberty individual of Eriocheir sinensis. Full-length cDNA sequence of EsEcR gene is cloned from Eriocheir sinensis tissue by the use of primer groups provided by the invention. Based on the gene sequence, the invention provides a living molecular detection method for precocious puberty individual of Eriocheir sinensis. The invention not only provides a living molecular detection method for precocious puberty individual of Eriocheir sinensis, but also provides an important testing method for early detection of Eriocheir sinensis precocious puberty individual.

Description

The individual living body molecule detection method of a kind of mitten crab sexual prematurity

Technical field

The invention belongs to genetically engineered field, particularly a kind of mitten crab EsEcR gene clone method and the living body molecule detection method of EsEcR gene as basic mitten crab sexual prematurity individuality of take.

Background technology

Mitten crab (Eriocheir sinensis) belongs to Arthropoda, Crustachia, Decapoda, Reptantia, short-tail family, Grapsidae, bending of leg subfamily, Eriocheir, be commonly called as river crab, be distributed widely in China southeast coastal degree of saltiness water or freshwater its delicious meat, unique flavor, river crab is the fresh water crab of Chinese cultured output maximum.As a kind of crustacean, the growth of river crab embodies by the form of casting off a skin.Casting off a skin and slough off old exoskeleton and grow new ectoskeletal process, is the most significant physiological characteristic of crustacean.River crab sexual maturity has restraining effect to shelling, also just not regrowth, shelling number of times has directly determined the specification of river crab individuality, the economic worth of large specification river crab is far above small river crab, but at present in culture of Chinese mitten crab is produced, ubiquity the Precocious Maturation of Chinese Mitten-handed Crab Eriocheir Sinensis phenomenon of 20%-30%, precocious river crab individuality is very little, sexual gland maturation no longer shells, also i.e. not regrowth, and commodity value is extremely low.Sex gland mature degree can intuitively be reacted by trafficability characteristic gland maturity index (gonadosomatic index, GSI), and obtain sexual gland index must, by the dissection sexual gland of weighing, cannot detect by live body.

Ecdysone receptor (ecdysteroid receptor, ECR) is one of animal nuclear receptor (nuclear receptor) superfamily member, mainly in invertebrates, finds.RXR has important biological function, with retinoic acid receptor X (RXR, retinoid x receptor) effect forms heterodimer, thereby moulting hormone enters the expression that regulates and controls with it a series of relevant genes of casting off a skin in downstream in cell in conjunction with the form that is formed with function, finally triggers the reaction of casting off a skin of animal.RXR-ECR heterodimer is the requisite key nodes of the molecular signaling pathway of casting off a skin such as crustaceans.

At present, there are a few seed shrimp crab class EcR genes to be cloned, comprise: Marsupenaeus japonicas, Fenneropenaeus chinensis, Crangon crangon etc., and the EcR gene of mitten crab (called after here: EsEcR) have not been reported.

Summary of the invention

The object of the invention is to provide in order to overcome the deficiencies in the prior art a kind of mitten crab sexual prematurity individual living body molecule detection method.

We utilize RACE (rapid-amplification of cDNA ends) clone technology to clone the EcR full length gene cDNA of mitten crab, the expression amount of finding EcR gene in sexual prematurity individuality by quantitative PCR analysis is significantly lower than normal individual, the 27%(p < 0.001 that only has normal individual expression amount), this result can be applicable to the living body molecule detection of Precocious Maturation of Chinese Mitten-handed Crab Eriocheir Sinensis individuality.

The present invention realizes by following technique means:

An EsEcR gene, its nucleotide sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2.

A primer sets for the above-described mitten crab EsEcR of pcr amplification gene, is comprised of following primer:

3 ' forward outer primer 3aEsEcR-F1: sequence is as shown in SEQ ID NO.3;

3 ' forward inner primer 3aEsEcR-F2: sequence is as shown in SEQ ID NO.4;

5 ' reverse outer primer 5aEsEcR-R1: sequence is as shown in SEQ ID NO.5;

5 ' reverse inner primer 5aEsEcR-R2: sequence is as shown in SEQ ID NO.6.

The increase method of above-described mitten crab EsEcR gene, is characterized in that, comprises the steps:

Step 1: the total RNA that obtains Tissue of Eriocheir Sinensis;

Step 2: screen an EcR DNA homolog sequence from GenBank mitten crab nucleic acid database, as intermediate sequence, using this sequence as template, the Auele Specific Primer group of 3 ' and 5 ' end fragment of design amplification EsECR gene;

Step 3: the total RNA reverse transcription product of step 1 gained of take is template, respectively with the primer pair template shown in the primer shown in SEQ NO.3 and 4 and SEQ NO.5 and SEQ ID NO.6 3 ' end and 5 ' end carry out nido two-wheeled pcr amplification, obtain 3 of mitten crab EsEcR gene ' with 5 ' end fragment;

Step 4: by 3 of the gene of mitten crab EsEcR described in intermediate sequence described in step 2, step 3 ' and 5 ' end fragment splicing, obtain the mitten crab EsEcR gene after amplification.

The method of above-described amplification mitten crab EsEcR gene, wherein 3 ' end and 5 ' end carry out 3 ' of nido two-wheeled pcr amplification to hold the condition of first round pcr amplification are 94 ℃, 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 20 circulations; 72 ℃, 10min; 4 ℃ of preservations.

The method of above-described amplification mitten crab EsEcR gene, wherein 3 ' end and 5 ' is held and is carried out 3 ' of nido two-wheeled pcr amplification to hold the second condition of taking turns pcr amplification be 94 ℃, 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 30 circulations; 72 ℃, 10min.

The method of above-described amplification mitten crab EsEcR gene, wherein 3 ' end and 5 ' end carry out 5 ' of nido two-wheeled pcr amplification to hold the condition of first round pcr amplification are 94 ℃, 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 20 circulations; 72 ℃, 10min; 4 ℃ of preservations.

The method of above-described amplification mitten crab EsEcR gene, wherein 3 ' end and 5 ' is held and is carried out 5 ' of nido two-wheeled pcr amplification to hold the second condition of taking turns pcr amplification be 94 ℃, 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 25 circulations; 72 ℃, 10min.

Institute's calling sequence is carried out to blastx on-line analysis with NCBI website, with the highest front 100 sequences of EsEcR sequence identity (Sequences producing significant alignments) homologous protein (e<1 * 10 that are all EcR ^-144), wherein front 16 sequences come from respectively 9 kinds of different shrimp crab classes: Uca pugilator (calling damp crab together), Scylla paramamosain(Scylla paramamosain), Homarus americanus(America Hai Ao shrimp), Callinectes sapidus(blue crab), Portunus trituberculatus(Portunus trituberculatus Miers), Crangon crangon(brown shrimp), Gecarcinus lateralis(land carb) Marsupenaeus japonicus(Marsupenaeus japonicus) and the common beach crab of Carcinus maenas() EcR(comprise different variable spliced bodies), test of significance reaches greatly (e=0), can determine that institute's calling sequence is mitten crab EcR gene.The aminoacid sequence that mitten crab EsEcR gene is inferred has typical EcR nuclear receptor sequence signature, comprises N end DNA binding domains (DNA binding domain, DBD), and C holds ligand binding domains (ligand binding domain, LBD).

By to mitten crab EsEcR, comprise that aminoacid sequence and other species EcR aminoacid sequence that two kinds of variable spliced body EsEcR-L and EsEcR-S are coded utilize Clustalx1.81 software to carry out sequence alignment analysis and use MEGA3.1 software building NJ phylogenetic tree (as Fig. 1), from phylogenetic tree, crustaceans EcR cluster is in a large branch.

The EsEcR gene order that is cloned into of take is basis, and the present invention also provides a kind of and detected and take the specific primer group that EsEcR gene is basic mitten crab sexual prematurity individuality for PCR, and it is comprised of following primer:

Forward primer preco-EsEcR-F: sequence is as shown in SEQ ID NO.7;

Reverse primer preco-EsEcR-R: sequence is as shown in SEQ ID NO.8.

The EsEcR gene order being cloned into of take is basis, and the present invention also provides the living body molecule detection method of a kind of EsEcR of take gene as basic mitten crab sexual prematurity individuality, comprises the steps:

Step 1: obtain total RNA the reverse transcription of Juvenile Crab Eriocheir sinensis muscle tissue;

Step 2: the total reverse transcription product of step 1 gained of take is template, the specific primer group as above of take is primer, obtains relative expression's level of EsEcR gene by quantitative pcr amplification;

Step 3: it is normal individual that the sex gland mature index of take is less than 1% Eriocheir sinensis individuality, when detecting individual EsEcR gene expression dose lower than normal individual 50%, is defined as mitten crab sexual prematurity individual.

The present invention utilizes the method for reverse transcriptase polymerase chain reaction (RT-PCR), nested polymerase chain reaction (nested-PCR), 3 ' end cDNA rapid amplifying (3 ' RACE) and 5 ' end cDNA rapid amplifying (5 ' RACE), mitten crab EsEcR gene is studied, from mitten crab, be cloned into first EsEcR full length gene cDNA sequence, and the sequence signature of its coded EsEcR, homology and evolutionary degree are analyzed, determine that it is EsEcR gene.、

The EsEcR gene obtaining of take is basis, with quantifying PCR method, studied the difference of sexual prematurity individuality and normal individual EsEcR gene expression dose, find that the expression amount of EcR gene in sexual prematurity individuality is significantly lower than normal individual, the 27%(p < 0.001 that only has normal individual expression amount), take this result a kind of living body molecule detection method of Precocious Maturation of Chinese Mitten-handed Crab Eriocheir Sinensis individuality that has been Foundation.

Accompanying drawing explanation

Fig. 1 is the NJ systematic evolution tree of different types of animal EcR nuclear receptor;

Fig. 2 is the difference of mitten crab sexual prematurity individuality and normal individual EsEcR gene expression dose.

Embodiment

Below in conjunction with embodiment, further set forth the present invention.

The reagent such as in the present invention, mitten crab is provided by Taihu Lake, Wuxi fisherman, and reagent all can be buied by market, RNA purifying are purchased from U.S. Promega company etc., and 3 ' RACE and 5 ' RACE test kit are purchased from precious biological (Dalian) company limited (Takara).

The method of amplification mitten crab EsEcR gene, comprises the steps:

(1) total RNA extracts:

Get 100mg Tissue of Eriocheir Sinensis and in mortar, add liquid nitrogen grinding, by Trizol method, extract total RNA, Trizol reagent adopts Invitrogen company, and extracting method is according to working instructions.

(2) clone of mitten crab EsEcR full length gene cDNA sequence:

From GenBank mitten crab nucleic acid database, screen the EcR DNA homolog sequence (GenBank accession number:JR736395.1) of a 217bp, using this sequence as intermediate sequence, 3 ' end of design amplification EsEcR gene and the Auele Specific Primer group of 5 ' end fragment, for 3 ' end and 5 ' hold rapid amplifying:

(a) EsEcR gene cDNA 3 ' end rapid amplifying (3 ' RACE):

According to EsEcR Gene Partial sequence, design specificity 3 ' forward outer primer 3aEsEcR-F1 and 3 ' forward inner primer 3aEsEcR-F2, wherein, 3 ' RACE Outer the Primer providing in 3 ' forward outer primer 3aEsEcR-F1 and 3 ' RACE test kit forms primer pair and carries out first round pcr amplification, amplified production is carried out to second with 3 ' forward inner primer 3aEsEcR-F2 and 3 ' RACE Inner Primer and take turns pcr amplification, obtain 3 ' end fragment of mitten crab EsEcR gene;

3aEsEcR-F1：5′TTCTTTGATATTGCACCACATTTTAG3′（SEQ ID NO.3）

3aEsEcR-F2：5′GTAACTACGGTGCCGACTCCTAC3′（SEQ ID NO.4）

3′RACE Outer Primer：5′TACCGTCGTTCCACTAGTGATTT3′(SEQ ID NO.9)

3′RACE Inner Primer：5′CGCGGATCCTCCACTAGTGATTTCACTATAGG3′(SEQID NO.10)

(b) reverse transcription:

According to the working instructions in 3 ' RACE test kit, carry out, obtain 3 ' reverse transcription liquid, reaction system is as follows:

Reaction conditions is: 42 ℃, and 60min; 70 ℃, 15min;-20 ℃, preserve.

First round PCR:

Amplification reaction system is as follows:

First round PCR reaction conditions is: 94 ℃, and 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 20 circulations; 72 ℃, 10min; 4 ℃ of preservations.

Second takes turns PCR:

Amplification reaction system is as follows:

Second takes turns PCR reaction conditions is: 94 ℃, and 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 30 circulations; 72 ℃, 10min.

By second, take turns PCR product and detect with 1.5% agarose gel electrophoresis, cut glue and reclaim clear bright single band.Glue reclaims purifying and uses U.S.'s Axygen company product (AxyPrep DNA Gel Extracion Kit), and operation steps is undertaken by product description.The PCR product of purifying is connected with Beijing pEASY-T1 of Quan Shijin biotech company carrier, and Transformed E .coli TOP10 bacterial strain, carries out blue hickie screening, after picking mono-clonal hickie amplification cultivation, send the order-checking of order-checking company.

(c) EsEcR gene cDNA 5 ' end rapid amplifying (5 ' RACE):

According to EsEcR Gene Partial sequence, design specificity 5 ' reverse outer primer 5aEsEcR-R1 and 5 ' is inner primer 5aEsEcR-R2 oppositely, wherein, 5 ' RACE the OuterPrimer providing in 5 ' reverse outer primer 5aEsEcR-R1 and 5 ' RACE test kit forms primer pair and carries out first round pcr amplification, amplified production is carried out to second with 5 ' reverse inner primer 5aEsEcR-R2 and 5 ' RACE Inner Primer and take turns pcr amplification, obtain 5 ' end fragment of mitten crab EsEcR gene.Positive and negative primer sequence is as follows:

5aEsEcR-R1：5′TTCTTCAGGTCGCCGTAGGAGTC3′(SEQ ID NO.5)

5aEsEcR-R2：5′TCATCTCGCCCCTAAAATGTGGT3′(SEQ ID NO.6)

5′RACE Outer Primer：5′CATGGCTACATGCTGACAGCCTA3′(SEQ ID NO.11)

5′RACE Inner Primer：5′CGCGGATCCACAGCCTACTGATGATCAGTCGATG3′(SEQ ID NO.12)

(d) reverse transcription:

According to 5 ' RACE test kit process specifications, carry out, first use Alkaline Phosphatase (CIAP) to carry out dephosphorization acid-respons to 5 ' phosphate group exposed in Total RNA, then use Tobacco Acid Pyrophosphatase (TAP) to remove 5 ' cap sequence of mRNA, retain a phosphate group, connect again 5 ' RACE Adaptor, carry out reverse transcription reaction again, obtain 5 ' reverse transcription liquid, reverse transcription reaction system is as follows:

Reverse transcription reaction condition is: 30 ℃ of 10min; 42 ℃ of 1hr; 70 ℃ of 15min.Reverse transcription product-20 ℃ preservation.

First round PCR

Amplification reaction system is as follows:

First round PCR reaction conditions is: 94 ℃, and 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 20 circulations; 72 ℃, 10min; 4 ℃ of preservations.

Second takes turns PCR:

Amplification reaction system is as follows:

Second takes turns PCR reaction conditions is: 94 ℃, and 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 25 circulations; 72 ℃, 10min.

By second, take turns PCR product and detect with 1.5% agarose gel electrophoresis, cut glue and reclaim purifying, use U.S.'s Axygen company product (AxyPrep DNA Gel Extracion Kit), operation steps is undertaken by product description.The PCR product Yu Quan formula pEASY-T1 of the King Company carrier of purifying connects, and Transformed E .coli TOP10 bacterial strain, carries out blue hickie screening, after picking mono-clonal hickie amplification cultivation, send the order-checking of order-checking company.

3 ' sequence of mitten crab EsEcR gene, intermediate segment and 5 ' sequence are carried out to the splicing of cDNA total length.Wherein 5 ' sequence obtains two sequences that vary in size, and finds it is the splicing variants intron (splice variant intron) that two sequences differ a 477bp after comparison.After splicing, obtain 2 EsEcR full length cDNA sequences, be respectively the EsEcR-L of 2522bp and the EsEcR-S(of 2045bp and see SEQ ID NO.1 and SEQ ID NO.2).

Normal young crab sexual gland index (GSI) is lower than 1%, and sexual prematurity children crab sexual gland index is higher than 10%, even reach more than 20%, select each 7 of normal young crab and sexual prematurity children crabs, dissect and measure sexual gland index, extract muscle tissue RNA reverse transcription, by qPCR method, carry out the detection of EsEcR expression amount, detecting instrument adopts Bio-Rad CFX96System, according to EsEcR cDNA full length sequence design primer pair sequence, be: preco-EsEcR-F:5 ' CTCCCGGGTGCCATATTACC3 ' (SEQ ID NO.7) and preco-EsEcR-R:5 ' TGCTACACGGCACATTCACT3 ' (SEQ ID NO.8), with river crab beta actin gene, make internal reference, beta actin gene primer is: Esbetaactin-F:5 ' GCATCCACGAGACCACTTACA3 ' (SEQ ID NO.13) and Esbetaactin-R:5 ' CTCCTGCTTGCTGATCCACATC3 ' (SEQ ID NO.14), reaction system adopts SYBERGREEN PCR kit for fluorescence quantitative (TAKARA company), using method is undertaken by test kit specification sheets, response procedures is as follows: 95 ℃, 15s, 60 ℃ of 20s, 72 ℃ of 20s, 40 circulations, 3 repetitions are done in each reaction, finally according to the comparing calculation of EcR gene and beta actin gene expression amount, go out the relative expression quantity of EcR gene.Result shows that the expression amount of EcR gene in sexual prematurity individuality, significantly lower than normal individual, only has 27% of normal individual expression amount, (p < 0.001).Accompanying drawing 2 is relative expression quantities of 7 precocious individualities and 7 normal individual EcR genes, and precocious individual EcR gene relative expression quantity is generally lower than 0.01, and normal individual is all higher than 0.03.Because the sexual prematurity children crab detecting is here all that precocious feature is very significantly individual, consider the different steps that sexual prematurity occurs, the present invention with detect individual EcR gene relative expression quantity lower than normal individual 50% time to be defined as mitten crab sexual prematurity individual.

Mitten crab EsEcR full length gene cDNA sequence signature is in Table 1.

Table 1 mitten crab EsEcR full length gene cDNA sequence signature

The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the premise without departing from the principles of the invention; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.

Sequence table

<110> China Aquatic Science Research Academy Fresh Water Fishery Research Center

The individual living body molecule detection method of <120> mitten crab sexual prematurity

<130> 2013

<160> 14

<170> PatentIn version 3.3

<210> 1

<211> 2522

<212> DNA

<213> Eriocheir sinensis

<400> 1

gtgtgcggta tacagcggtg cgacaggctc tccgtgtacc cccggccggc gccccgcggt 60

gtattggcgc gtccacccct ctgagttcag tactgcttca tggaggagga cctaattttt 120

gatgtgcaga aaggagttgt ctatgtgttg ttcgccaatc tgccgaggat cgttggatat 180

aagtgagatt tgagtcagtt ttaccttagt gttggctggc tcggactgga ccaccgcccc 240

gtccgaatac ctccgccgcg gtccctggca ccgatctggg atttggatat cggtgttgag 300

tcgtcggcaa tacggtgaag ctcagtgttt tgttggtgta gaaggtacac agtgacgtat 360

ttgacgacga aaacccggct caaagtcagt gtgtgtgagg attgcaagag agaacgtact 420

ttggtcggtg ttcgattccc tccctcgccc gactcggcac caacggggac tggcaccggc 480

gtcgactccg ccttctacca ccgacgacag agtgtgatgg tgtgggcgtg acgatggacc 540

tccctcgcga ctccccacac cggggccgcg ggtttatggg cggtcggtca cctacacccc 600

attcttcgct gatccactcc ctcgtctccc ccaagatgga ccattccccc accagtcctc 660

cctatgtcgc cagttcccct ttgctgggcg agtctccctc gggcattcct cgttcccctg 720

tctcccccct gggcgtcttg gtcaagagtg agccccctgt gtccccatcg ggcccctcgg 780

agtaccaagt gaggcccaaa aagccgcgtt ccgacgggga gagggccgag tgggcctcct 840

cccccggcgc catgagcatc gactccctct ctccgccgcc ccagggctcc aatggcgtcg 900

ggggctccct gggacacccc tccagcggca tgtctccgat gtcctcctcc agctacgacc 960

ccagctctcc ctacctctcc agatcagggc gagatgacat gtcgccgccc tcatcgctga 1020

gtaactacgg tgccgactcc tacggcgacc tgaagaagaa gaaaggcccc atcccgcgcc 1080

agcaggagga gttatgtctg gtgtgcggcg acagggcatc gggctaccac tacaacgccc 1140

tcacctgtga aggatgcaaa ggtttcttcc ggagatccat cacgaagaat gccgtgtacc 1200

agtgtaaata tggcaacaac tgtgagatgg atatgtacat gcggcgcaag tgtcaagagt 1260

gtcgcctcaa aaagtgtctc aacgtgggca tgcggccaga atgtgttgtg cccgagtctc 1320

agtgccaggt gaagagagaa cagaaaaagg cacgagacaa ggacaaaagg gattacccga 1380

gcctagggtc ccctatagcc gaggacaagg ctggccccat tagtccagtg agtaaagatt 1440

gtaaatccaa aggtccatca actgcgtgtg ctatgcagtt caaaaatctt gttgacagct 1500

ctagcaacgt tcagtctcct atgtcagcca tgcagcggac aaccaccaag ccactcacgc 1560

gggagcagga ggagctgatc aatactctag tctactacca agaagagttt gaacagccaa 1620

ctgaagcgga tataaagaag atcagattta acttcgatgg tgaagataca agtgacatga 1680

gattcaggca cataaccgag atgacgatcc tcacagttca gctcatagtg gaattctcca 1740

agcaactacc aggtttcgcc acacttcaac gagaagacca gattaccctg ctcaaggctt 1800

gttcatcaga ggtaatgatg cttcgagcag cccggcgtta tgattccaag acagattgca 1860

ttgtgtttgg aaacagcttc ccctacacac aagcctccta tgcactagct ggcttgggag 1920

attcagcaga ggtactcttc cgtttctgcc gtagcctttg taaaatgaag gtggacaacg 1980

cagagtatgc actactagct gccatagcta ttttctcaga gaggccaaac cttaaagaac 2040

tcaaaaaggt ggaaaaactt caggaaatct accttgaagc attgaagtct tatgtagaga 2100

atcgacgact gcctcggtct cacatggtgt ttgcgaagtt gcttaatatc ctcacagagt 2160

tgcggaccct tggaaatatt aactcagaga tgtgcttctc cctcacattc aagaacaaaa 2220

gactcccacc cttcctggct gagatctggg atgtttctgg atactgagcc tcagccacct 2280

cccgggtgcc atattaccga ggtaaaatgt tggcgcaaga aggttgtgag ccctctgggg 2340

gtggtggatg gactctacac tatgtacctg caggctgtga gtgagagact gttgatgctg 2400

tggcagcagc ttcacactgc cacccagggc ccactttcag ccacttgacg tgtctatggt 2460

tcaggccacc agtgaatgtg ccgtgtagca ctccactatt aaaatttaaa gaaaaaaaaa 2520

aa 2522

<210> 2

<211> 2045

<212> DNA

<213> Eriocheir sinensis

<400> 2

gtgtgcggta tacagcggtg cgacaggctc tccgtgtacc cccggccggc gccccgcggt 60

gtattggcgc gtccacccct ctgagttcag tactgcttca tggaggagga cctaattttt 120

gatgtgcaga aaggagttgt ctatgtgttg ttcgccaatc tgccgaggat cgttggatat 180

aagtgagatt tgagtcagtt ttaccttagt gttggctggc tcggactgga ccaccgcccc 240

gtccgaatac ctccgccgcg gtccctggca ccgatctggg atttggatat cggtgttgag 300

tcgtcggcaa tacggtgaag ctcagtgttt tgttggtgta gaaggtacac agtgacgtat 360

ttgacgacga aaacccggct caaagtcagt gtgtgtgagg attgcaagag agaacgtact 420

ttggtcggtg ttcgattccc tccctcgccc gactcggcac caacggggac tggcaccggc 480

gtcgactccg ccttctacca ccgacgacag ggcgagatga catgtcgccg ccctcatcgc 540

tgagtaacta cggtgccgac tcctacggcg acctgaagaa gaagaaaggc cccatcccgc 600

gccagcagga ggagttatgt ctggtgtgcg gcgacagggc atcgggctac cactacaacg 660

ccctcacctg tgaaggatgc aaaggtttct tccggagatc catcacgaag aatgccgtgt 720

accagtgtaa atatggcaac aactgtgaga tggatatgta catgcggcgc aagtgtcaag 780

agtgtcgcct caaaaagtgt ctcaacgtgg gcatgcggcc agaatgtgtt gtgcccgagt 840

ctcagtgcca ggtgaagaga gaacagaaaa aggcacgaga caaggacaaa agggattacc 900

cgagcctagg gtcccctata gccgaggaca aggctggccc cattagtcca gtgagtaaag 960

attgtaaatc caaaggtcca tcaactgcgt gtgctatgca gttcaaaaat cttgttgaca 1020

gctctagcaa cgttcagtct cctatgtcag ccatgcagcg gacaaccacc aagccactca 1080

cgcgggagca ggaggagctg atcaatactc tagtctacta ccaagaagag tttgaacagc 1140

caactgaagc ggatataaag aagatcagat ttaacttcga tggtgaagat acaagtgaca 1200

tgagattcag gcacataacc gagatgacga tcctcacagt tcagctcata gtggaattct 1260

ccaagcaact accaggtttc gccacacttc aacgagaaga ccagattacc ctgctcaagg 1320

cttgttcatc agaggtaatg atgcttcgag cagcccggcg ttatgattcc aagacagatt 1380

gcattgtgtt tggaaacagc ttcccctaca cacaagcctc ctatgcacta gctggcttgg 1440

gagattcagc agaggtactc ttccgtttct gccgtagcct ttgtaaaatg aaggtggaca 1500

acgcagagta tgcactacta gctgccatag ctattttctc agagaggcca aaccttaaag 1560

aactcaaaaa ggtggaaaaa cttcaggaaa tctaccttga agcattgaag tcttatgtag 1620

agaatcgacg actgcctcgg tctcacatgg tgtttgcgaa gttgcttaat atcctcacag 1680

agttgcggac ccttggaaat attaactcag agatgtgctt ctccctcaca ttcaagaaca 1740

aaagactccc acccttcctg gctgagatct gggatgtttc tggatactga gcctcagcca 1800

cctcccgggt gccatattac cgaggtaaaa tgttggcgca agaaggttgt gagccctctg 1860

ggggtggtgg atggactcta cactatgtac ctgcaggctg tgagtgagag actgttgatg 1920

ctgtggcagc agcttcacac tgccacccag ggcccacttt cagccacttg acgtgtctat 1980

ggttcaggcc accagtgaat gtgccgtgta gcactccact attaaaattt aaagaaaaaa 2040

aaaaa 2045

<210> 3

<211> 26

<212> DNA

<213> artificial sequence

<400> 3

ttctttgata ttgcaccaca ttttag 26

<210> 4

<211> 23

<212> DNA

<213> artificial sequence

<400> 4

gtaactacgg tgccgactcc tac 23

<210> 5

<211> 23

<212> DNA

<213> artificial sequence

<400> 5

ttcttcaggt cgccgtagga gtc 23

<210> 6

<211> 23

<212> DNA

<213> artificial sequence

<400> 6

tcatctcgcc cctaaaatgt ggt 23

<210> 7

<211> 20

<212> DNA

<213> artificial sequence

<400> 7

ctcccgggtg ccatattacc 20

<210> 8

<211> 20

<212> DNA

<213> artificial sequence

<400> 8

tgctacacgg cacattcact 20

<210> 9

<211> 23

<212> DNA

<213> 3′ RACE Outer Primer

<400> 9

taccgtcgtt ccactagtga ttt 23

<210> 10

<211> 32

<212> DNA

<213> 3′ RACE Inner Primer

<400> 10

cgcggatcct ccactagtga tttcactata gg 32

<210> 11

<211> 23

<212> DNA

<213> 5′RACE Outer Primer

<400> 11

catggctaca tgctgacagc cta 23

<210> 12

<211> 34

<212> DNA

<213> 5′RACE Inner Primer

<400> 12

cgcggatcca cagcctactg atgatcagtc gatg 34

<210> 13

<211> 21

<212> DNA

<213> Esbetaactin-F

<400> 13

gcatccacga gaccacttac a 21

<210> 14

<211> 22

<212> DNA

<213> Esbetaactin-R

<400> 14

ctcctgcttg ctgatccaca tc 22

Claims (9)

1. a mitten crab EsEcR gene, is characterized in that, its nucleotide sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2.

2. for a primer sets for pcr amplification mitten crab EsEcR as claimed in claim 1 gene, it is characterized in that, by following primer, formed:

3 ' forward outer primer 3aEsEcR-F1: sequence is as shown in SEQ ID NO.3;

3 ' forward inner primer 3aEsEcR-F2: sequence is as shown in SEQ ID NO.4;

5 ' reverse outer primer 5aEsEcR-R1: sequence is as shown in SEQ ID NO.5;

5 ' reverse inner primer 5aEsEcR-R2: sequence is as shown in SEQ ID NO.6.

3. a method for amplification mitten crab EsEcR gene as claimed in claim 1, is characterized in that, comprises the steps:

Step 1: the total RNA that obtains Tissue of Eriocheir Sinensis;

Step 2: screen an EcR DNA homolog sequence from GenBank mitten crab nucleic acid database, as intermediate sequence, using this sequence as template, the Auele Specific Primer group of 3 ' and 5 ' end fragment of design amplification EsECR gene;

Step 3: the total RNA reverse transcription product of step 1 gained of take is template, respectively with the primer pair template shown in the primer shown in SEQ NO.3 and 4 and SEQ NO.5 and SEQ ID NO.6 3 ' end and 5 ' end carry out nido two-wheeled pcr amplification, obtain 3 of mitten crab EsEcR gene ' with 5 ' end fragment;

Step 4: by 3 of the gene of mitten crab EsEcR described in intermediate sequence described in step 2, step 3 ' and 5 ' end fragment splicing, obtain the mitten crab EsEcR gene after amplification.

4. the method for amplification mitten crab EsEcR gene according to claim 3, is characterized in that, the condition that 3 ' end and 5 ' end carry out 3 ' end first round pcr amplification of nido two-wheeled pcr amplification is 94 ℃, 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 20 circulations; 72 ℃, 10 min; 4 ℃ of preservations.

5. the method for amplification according to claim 3 mitten crab EsEcR gene, is characterized in that, 3 ' end and 5 ' is held and carried out 3 ' of nido two-wheeled pcr amplification to hold the second condition of taking turns pcr amplification be 94 ℃, 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 30 circulations; 72 ℃, 10 min.

6. the method for amplification mitten crab EsEcR gene according to claim 3, is characterized in that, the condition that 3 ' end and 5 ' end carry out 5 ' end first round pcr amplification of nido two-wheeled pcr amplification is 94 ℃, 3 min; 94 ℃ of 3 0s, 55 ℃ of 30s, 72 ℃ of 2min, 20 circulations; 72 ℃, 10 min; 4 ℃ of preservations.

7. the method for amplification according to claim 3 mitten crab EsEcR gene, is characterized in that, 3 ' end and 5 ' is held and carried out 5 ' of nido two-wheeled pcr amplification to hold the second condition of taking turns pcr amplification be 94 ℃, 3min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 2min, 25 circulations; 72 ℃, 10 min.

8. for PCR, detect and take the specific primer group that EsEcR gene is basic mitten crab sexual prematurity individuality, it is characterized in that, it is comprised of following primer:

Forward primer preco-EsEcR-F: sequence is as shown in SEQ ID NO.7;

Reverse primer preco-EsEcR-R: sequence is as shown in SEQ ID NO.8.

9. the living body molecule detection method that the EsEcR gene of take is basic mitten crab sexual prematurity individuality, is characterized in that, comprises the steps:

Step 1: obtain total RNA the reverse transcription of Juvenile Crab Eriocheir sinensis muscle tissue;

Step 2: the total reverse transcription product of step 1 gained of take is template, the specific primer group as claimed in claim 8 of take is primer, obtains relative expression's level of EsEcR gene by quantitative pcr amplification;

Step 3: it is normal individual that the sex gland mature index of take is less than 1% Eriocheir sinensis individuality, when detecting individual EsEcR gene expression dose lower than normal individual 50%, is defined as mitten crab sexual prematurity individual.

Images