CN102321737A - Method and primers for detecting mutation of CCR5-delta 32 gene - Google Patents

Abstract

The invention provides a method for detecting the mutation of CCR5-delta 32 gene and primers for implementing the method, and particularly relates to a method for judging the mutation type of the CCR5-delta 32 gene by using the number of strips obtained through electrophoretic separation of a product obtained through polymerase chain reaction (PCR) amplification by designing a group of primers and taking genomic DNA of a sample as a template. The method is characterized by comprising the following steps of: 1) designing and preparing a group of primers for detecting the mutation of CCR5 gene, wherein the primers comprise three specific PCR primers which are designed for the mutation of the CCR5-delta 32 gene, and the specific PCR primers have nucleotide sequences shown as SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3; and 2) judging a genotype of the CCR5-delta 32 of the sample by observing the number of strips obtained by electrophoresing a PCR amplification product.

Description

A kind of method and primer that detects 32 transgenations of CCR5-Δ

Technical field

The invention belongs to biology field, relate to medical diagnosis and biotechnology, concrete is through designing a group-specific primers, setting up a kind of method of band number judgement CCR5-Δ 32 gene mutation types of the PC of utilization R amplified production.

Background technology

The special CD4+T cell of virus is the important component part to the HIV immunne response, also is the primary target spot of HIV-1 course of infection.But only there is the CD4 molecule can not mediate the intrusion of HIV-1, also needs one or more accessory receptors simultaneously.Chemokine is one type of small molecules cytokine with chemotactic activity, and the cell aggregation that its function is that cell surface is had strides the film g protein coupled receptor is participated in intravital immunologic balance effect together.Confirmed that Chemokine Receptors CXCR4 and CCR5 were the accessory receptors (coreceptor) that HIV-1 infects in 1996.Nearly all HIV-1 virus strain all is CCR5 or the CXCR4 acceptor that utilizes wherein, or utilizes two kinds of accessory receptors to invade cell simultaneously.Research shows, the N-terminal of CCR5 and CXCR4 and second extracellular region for they with HIV-1gp120 combine play a part crucial.

CCR5 is the acceptor of β chemokine (RANTES, MIP-1 α and MIP-β) in the cell; Have modulating T cell and monocyte/huge and have a liking for the migration of clone, propagation and immune function, mainly be expressed on the cytolemma of T lymphocyte stationary phase, monocyte, immature BMDC etc. of memory.Its molecular weight is 40.6kDa, is made up of 352 amino-acid residues, can be divided on the structure: the outer N-terminal of born of the same parents, and 3 born of the same parents' outer shrouds (EL1-3), ring (IL1-3) in 3 born of the same parents is striden C-terminal in film α spiral and the born of the same parents for 7.

The deterioration that a plurality of two mutants that in the CCR5 gene, exist can effectively be resisted the virus infection of HIV and delay the state of an illness.At present the coding region of this gene and promoter region domain discovery multiple significant sudden change; Especially with the most extensive to the research of gene coding region two mutants CCR5-Δ 32; CCR5-Δ 32 is meant the sudden change of 32 base deletions of CCR5 gene; At CCR5 allelotrope coding region the 185th amino acids codon 32 base deletions (be positioned at CCR5 gene 3317～3348) have taken place later on promptly; Cause the single open reading frame dislocation, lacked the outer tricyclic structure of the born of the same parents relevant, thereby made CCR5 albumen normally wear film expression on cytolemma with G protein signal path; And then HIV-1gp120 can not effectively be combined with CCR5-Δ 32, make HIV-1 virus can not get into host cell.Census of population and experimental studies results show that the individuality of CCR5-Δ 32 disappearances has normal immunologic function and inflammatory reaction, and the infection of HIV-1 is shown significant defensive ability/resistance ability.

32 HSCTs of CCR5-Δ are gene therapy new departures that treatment HIV infects: the relevant CCR5 of the utilization sudden change that we delivered in 2005 is treated in the paper of HIV infection and AIDS; This new gene therapy there is following description: ",, reach the purpose of rebuilding its immunizing power through transplanting the CCR5-Δ 32 genotype marrow that HIV is had certain resistance with regard to the AIDS patient; in treatment; can it be regarded as aplastic anemia or the leukaemic treats.Because the allosome HSCT exists two big weakness, the i.e. scarcity of the rejection of organ transplantation and CCR5-Δ 32 genotype derived from bone marrow.Therefore, with regard to HIV the infected,, can benefit from HIV the infected in a wider context through himself hemopoietic stem cell is carried out the external mutagenesis of CCR5.”[1]

The clinical study of German scholar in 2010 has partly confirmed CCR5-Δ 32 foreign gene type bone marrow transplantations vital role [2-3] in the HIV treatment of infection.Though the curative effect of CCR5-Δ 32 genotype simplified marrow transplantings especially this new therapy to late period AIDS curative effect also need the checking of more pathology and longer time; But the case that " blood " magazine is reported still shows the milestone formula meaning that in the HIV treatment of infection, is had based on CCR5-Δ 32 genotypic stem cell transplantation therapies.

Utilize cellular replacement therapy HIV to infect, at first need confirm stem cell CCR5 genotype, whether 32 transgenations of CCR5-Δ take place.From technical standpoint, through detect expanding fragment length detect the CCR5 gene whether take place 32 nucleotide deletions with respect to the dna direct order-checking to come simple many.At present, restriction fragment length polymorphism (RFLP) technology is to detect the conventional means of expanding fragment length.Restriction fragment length polymorphism (RFLP) technology is to utilize restriction enzyme can discern the distinguished sequence of dna molecular; And cut dna molecular at the particular sequence place; Promptly produce the characteristic of restriction fragment, for the biont of different population, there is difference in their dna sequence dna.If this difference just occurs in the restriction enzyme site of restriction endonuclease, and make the restriction endonuclease recognition sequence become can not recognition sequence or this difference to make be not that the dna sequence dna of restriction endonuclease recognition site has become the restriction endonuclease recognition site originally.When so just having caused with this dna sequence dna of digestion with restriction enzyme, will lack one or many restriction enzyme sites, the result produces few one or many one endonuclease bamhis.So just formed when using, produced the restriction fragment of different lengths size, different quantities with a kind of restriction enzyme cutting different plant species dna sequence dna.After with these fragment electrophoresis, change film, sex change, hybridize with the probe that mark is crossed, wash film, can analyze its polymorphum result.But the RFLP technology also has some obvious defects, and like technical sophistication, the cycle is long, and expense is high; Need radioactive substance in the detection, limited widespread use; Detect the polymorphum level and too rely on restriction enzyme, polymorphum is reduced; The DNA amount is big, and analysis speed is slow.

Present method has been set up a kind of detection CCR5-Δ 32 genotypic methods through the PCR design of primers.Finally obtain several amplified productions and judge whether the CCR5 gene 32 transgenations of CCR5-Δ and CCR5-Δ 32 genotype take place through observing: finally have to a kind of amplified production and represent the 32 pure and mild sudden changes of CCR5-Δ; Obtain two kinds of amplified productions and represent that sample is the CCR5 wild-type, obtaining three kinds of amplified production representative samples is CCR5-Δ 32 heterozygous mutants.This method is compared with RFLP with dna sequencing, have fast, accurately, method is simple, cost is low advantage, utilize and clinically use and promote.

Reference:

[1]L.L.Chen，J.Zhang，H.L.Gao，D.F.Liao，K.Li，The?relationship?between?CCR5?and?HIV-1?disease.J?University?of?South?China(Medical?Edition).33，166(2005).

[2]K.Allers，G.Hutter，J.Hofmann，C.Loddenkemper，K.Rieger，E.Thiel，T.Schneider，Evidence?for?the?cure?of?HIV?infection?by?CCR5Δ32/Δ32?stem?cell?transplantation.Blood.117，279(2011).

[3]R.J.Landovitz，J.S.Currier，Clinical?practice.Postexposure?prophylaxis?for?HIV?infection.N.Engl.J.Med.18，1768(2009).

Summary of the invention

The purpose of this invention is to provide a group-specific PCR primer and judge CCR5-Δ 32 genotypic methods through detecting amplified production band number, this method has fast, accurate, method is simple, cost is low advantage, utilizes clinically to use and promote.

Based on above-mentioned purpose, the present invention adopts following technical scheme:

Step 1. is extracted sample genomic dna with ordinary method.

Step 2. designs and synthesizes the genotype that three Auele Specific Primers are used to detect CCR5-Δ 32; The CCR5 genotype that is detected comprises CCR5 wild-type, CCR5-Δ 32 pure and mild mutants, CCR5-Δ 32 heterozygous mutant types; Described CCR5-Δ 32 genes refer to the 3317th～3348 disappearance of CCR5 wild type gene, and 32 continuous nucleotide sequences of disappearance are SEQ ID No.4.

Article three, specificity comprises two forward primers and a reverse primer, wherein forward primer SEQ ID No:1 and forward primer SEQ ID No:2 and reverse primer SEQ ID NO:3, and sequence is following:

S1del?SEQ?ID?No：13’-TCACTTGGGTGGTGGCTG-5’

S2del?SEQ?ID?No：23’-ATTTTCCATACAGTCAGTATCAATT-5’

As3del?SEQ?ID?No：33’-GCAGGACCAGCCCCAAGA-5’

The 3317th～3348 disappearance of CCR5 wild type gene, 32 continuous nucleotide SEQ ID No.4 of disappearance, sequence is: CAGTATCAATTCTGGAAGAATTTCCAGACATT.

Wherein, forward primer SEQ ID No.1 and anti-primer sequence SEQ ID NO:3 amplification region are the 3213rd～3377 Nucleotide of CCR5 gene, the saltation zone of 32 base deletions of CCR5-Δ 32 genic mutation types that comprised; CCR5 gene wild-type, the heterozygous mutant type, the amplified production length of the sample of homozygous mutation type is respectively: 165bp (wild-type); 133bp (pure and mild mutant); Two kinds of 165bp and 133bp (heterozygous).

3 ' terminal and the 3317th～3327 11 base complementrities pairing of CCR5 gene of forward primer SEQ ID NO:2, the sudden change zone that 32 base deletions (CCR5 gene the 3317th～3348) possibly take place that is positioned at that we detect.Forward primer SEQ ID NO:2 and reverse primer SEQ ID No:3 amplification region are the 3303rd～3377 of CCR5 gene.The product situation that in three kinds of genotype, increases is: wild-type and heterozygous mutant type can amplify the purpose product of 75bp size, the homozygous mutation type product that then can not increase.

Step 3. is template with three primers in the step 2 with the sample genomic dna, carries out the multiplex PCR amplification, because three kinds of situation can appear in the genotypic difference of sample CCR5:

Situation one: sample is the CCR5 wild-type

Use forward primer SEQ ID No:1 and reverse primer SEQ ID NO:3 amplification to form purpose product nucleotide sequence length and be 165bp, 32 base sequences that comprised our detection that product is complete; The nucleotide sequence length of using forward primer SEQ ID No:2 and reverse primer SEQ ID NO:3 to form amplification purpose product is 75bp.

Situation two: sample is CCR5-Δ 32 pure and mild mutants

Use forward primer SEQ ID No:1 and reverse primer SEQ ID NO:3 amplification to form purpose product length of nucleotides and be 133bp, product has lacked 32 base sequences that we detect; And forward primer SEQ ID No:2 can't be hybridized with template is complementary.

Situation three: sample is CCR5-Δ 32 heterozygous mutant types

With forward primer SEQ ID No:1 and reverse primer SEQ ID NO:3; Be template with wild-type CCR5 and CCR5-Δ 32 allelotrope respectively; Amplification forms two kinds of products; Wherein wild-type CCR5 amplified allele formation length is the product of 165bp, and CCR5-Δ 32 amplified alleles form the product of 133bp;

Use forward primer SEQ ID No:2 and reverse primer SEQ ID NO:3 to be template, form the amplified production of 75bp nucleotide sequence with wild-type CCR5 allelotrope; CCR5-Δ 32 allelotrope can't be hybridized with forward primer SEQ ID No:2 is complementary.

Wherein, step 3 is said, and per 25 μ L multi-PRC reaction systems comprise: the 2X Tagmix of 12.5 μ L, and three specific PCR primer SEQ ID No.1,2,3 are respectively 10 μ M, 20 μ M, 10 μ M, template 40ng, all the other are water.

Wherein, step 3 is said, and the multi-PRC reaction condition is: 95 ℃ of preparatory sex change 5min, and 95 ℃ of sex change 10S, 68 ℃ of annealing 10S, 72 ℃ are extended 09S, and totally 10 each cycle annealing lapses of temperature of circulation were once; 95 ℃ of sex change 10S then, 50 ℃ of annealing 09S, 72 ℃ of 06S, totally 35 circulations; Last 72 ℃ of 5min.

Step 4. is observed product band number, the genotype of the CCR5 of judgement sample with the amplified production in the agarose gel electrophoresis separation detection step 3:

(1) obtain 2 bands, the nucleotide sequence length of two kinds of products is 165bp and 75bp, and the expression cdna sample is a wild-type CCR5 genotype;

(2) obtain 1 band, the product nucleotide sequence length is 133bp, and the expression cdna sample is CCR5-Δ 32 genotype of pure and mild sudden change;

(3) obtain 3 bands, three kinds of product nucleotide sequence length are respectively 165bp, 133bp and 75bp, and the expression cdna sample is CCR5-Δ 32 genotype of heterozygous mutant.

Major advantage of the present invention is: fast, accurately, method is simple, cost is low advantage, utilize and clinically use and promote.

Description of drawings

CCR5 wild-type people Whole Blood Genomic DNA order-checking collection of illustrative plates among Fig. 1 embodiment one;

CCR5-Δ 32 DNAs order-checking collection of illustrative plates among Fig. 2 embodiment one;

The pcr amplification product agarose gel electrophoresis figure of CCR5-Δ 32 pure and mild mutants among Fig. 3 embodiment two (/-), CC R5 wild-type (+/+) and mixing sample (+/-).

Embodiment

Below knot and accompanying drawing and embodiment the present invention is further described:

Embodiment one, preparation CCR5-Δ 32 DNAs

Experimental procedure is following:

1) extract people's whole blood sample genomic dna with ordinary method, dna sequencing proof sample is the CCR5 wild-type, and sequencing result is as shown in Figure 1.

2) design and the preparation primer that is used to prepare CCR5-Δ 32 disappearance property templates to A and primer to B; Wherein, primer comprises forward primer T1CCR5mut and reverse primer T2CCR5mut to A, and sequence is following:

Forward primer T1CCR5mut 3 '-GGAAATACAATGTGTCAACT-5 '

Reverse primer T2CCR5mut 3 '-TGACTATCTTTACTGTATGGAAAATGAGAG-5 '

Wherein, primer comprises forward primer T3CCR5mut and reverse primer T4CCR5mut to B, and sequence is following:

Forward primer T3CCR5mut 3 '-TTTTCCATACAGTAAAGATAGTCATCTTGG-5 '

Reverse primer T4CCR5mut 3 '-GCAGCAGTGCGTCATCCCAA-5 '

Wherein, primer is CCR5 gene 3049-3359 (lacking 32 bases of 3317～3348) position nucleotide sequence to A amplification CCR5 gene downstream purpose fragment;

Primer is CCR5 gene the 3304th～3634 (lacking 32 bases of 3317～3348) nucleotide sequence to the CCR5 upstream region of gene purpose fragment of B amplification;

Primer is held the forward primer 5 ' of B with primer the reverse primer 3 ' end of A during design has 24 base complementrities pairings.

3) respectively with primer to A and B, be template with the sample genomic dna, pcr amplification obtains CCR5 gene downstream purpose fragment and upper reaches purpose fragment;

Its pcr amplification system is: the 2X Tag mix (Biomega, Shanghai) of 12.5 μ L, forward primer: 10 μ M, reverse primer: 10 μ M, genome 40ng adds water to TV 25 μ L.

Its pcr amplification reaction condition: 95 ℃ of preparatory sex change 5min, 95 ℃ of sex change 20S, 50 ℃ of annealing 20S, 72 ℃ are extended 30S, 30 circulations altogether, last 72 ℃ of 10min.

4) will pass through in the CCR5 upstream region of gene purpose fragment and downstream purpose fragment adding reaction tubes of gel-purified, carry out pcr amplification.

The PCR reaction system: the 2X Tag mix (Biomega, Shanghai) of 12.5 μ L, upper reaches purpose fragment 40ng, downstream purpose fragment 40ng, forward primer T1CCR5mut:10 μ M, reverse primer T4CCR5mut:10 μ M adds water to TV 25 μ L.

The PCR reaction conditions: 95 preparatory sex change 5min, 95 ℃ of sex change 20S, 50 ℃ of annealing 20S, 72 ℃ are extended 30S, 30 circulations altogether, last 72 ℃ of 10min.

At first; The downstream purpose is segmental matches with terminal 24 base complementrities of the segmental strand of upper reaches purpose; Primer and guides extension each other, forms the CCR5-Δ 32 disappearance property nucleotide sequences of disappearance the 3317th～3348 32 continuous nucleotide sequences of CCR5 gene that we detected.

Then, use T1CCR5mut, two peripheral primers of T4CCR5mut are classified template as with CCR5-Δ 32 disappearance property nucleotides sequences, carry out pcr amplification, obtain the product of a large amount of CCR5-Δ 32 pure and mild sudden changes.

5) make up CCR5-Δ 32 DNAs: with the product of CCR5-Δ 32 pure and mild sudden changes purified after, the T-A plasmid vector links to each other, and transforms, and selects positive bacterium colony, dna sequencing is identified.The result proves that product is CCR5-Δ 32 pure and mild mutants, and is as shown in Figure 2.

Embodiment two, detect the genotype of CCR5 wild-type sample, CCR5-Δ 32 pure and mild mutant samples and mixing samples with three Auele Specific Primers.

CCR5 wild-type sample: people's whole blood sample genomic dna is the CCR5 wild-type through dna sequencing.

CCR5-Δ 32 pure and mild mutant sample: embodiment one preparation gained CCR5-Δ 32 DNAs.

Mixing sample: CCR5-Δ 32 DNAs and CCR5 wild type gene group DNA by etc. copy number hybrid analog-digital simulation CCR5-Δ 32 heterozygous samples.

Experimental procedure is following:

1) design and preparation are to three specific PCR primers of the transgenation design of CCR5-Δ 32, and primer sequence is following:

S1del?SEQ?ID?No：1TCACTTGGGTGGTGGCTG

S2del?SEQ?ID?No：2ATTTTCCATACAGTCAGTATCAATT

As3del?SEQ?ID?No：3GCAGGACCAGCCCCAAGA

2) with three Auele Specific Primers, be template with CCR5 wild-type dna sample, CCR5-Δ 32 pure and mild mutant DNAs and mixing sample respectively, carry out the multiplex PCR amplification.

The multi-PRC reaction system is: the 2X Tag mix (Biomega, Shanghai) of 12.5 μ L, and three each 10 μ M of Auele Specific Primer, template 40ng adds water to TV 25 μ L.

The multi-PRC reaction condition: 95 ℃ of preparatory sex change of 5min, 95 ℃ of 10S, 68 ℃ of annealing 10S, 72 ℃ are extended 09S, and totally 10 each cycle annealing lapses of temperature of circulation were once.95 ℃ of sex change 10S then, 50 ℃ of annealing 09S, 72 ℃ are extended 06S, totally 35 circulations.Last 72 ℃ are extended 5min.

3) agarose gel electrophoresis detects pcr amplification product, and CCR5-Δ 32 pure and mild mutants (/-), CCR5 wild-type (+/+), mixing sample (+/-) be corresponding 1 band respectively, 2 bands, and 3 bands, the result is as shown in Figure 3.

Claims (5)

1. one group of primer that detects the CCR5 transgenation is characterized in that, comprises that the nucleotides sequence of three primers is classified SEQ ID No.1,2,3 as to three specific PCR primers of the transgenation design of CCR5-Δ 32.

2. a method that detects the CCR5 transgenation is characterized in that, may further comprise the steps:

Step 1) is extracted genomic dna from sample;

Step 2) by synthetic three the specific PCR primer that design to the transgenation of CCR5-Δ 32 of claim 1;

Step 3) is template with three specific PCR primers with the genomic dna, carries out the multiplex PCR amplification;

Step 4) is with agarose gel electrophoresis separating step 3) in amplified production, observation product band number, the genotype of the CCR5 of judgement sample:

(1) observe 2 bands, sample is the CCR5 wild-type;

(2) observe 1 band, sample is CCR5-Δ 32 pure and mild mutator gene types;

(3) observe 3 bands, sample is CCR5-Δ 32 heterozygous mutant genotype.

3. by the said a kind of method that detects the CCR5 transgenation of claim 2, it is characterized in that homozygous mutation type, homozygous wildtype and heterozygous mutant type are through three Auele Specific Primer pcr amplifications, the electrophoretic separation amplified production forms 1 band respectively, 2 bands, 3 bands.

4. by the said a kind of method that detects the CCR5 transgenation of claim 2; It is characterized in that; How many affirmations that genotype and band quantitative relation are meant different genotype is decided by the band quantity of pcr amplification product, and must not rely on the length of pcr amplification product or the number of base pair.

5. by the said a kind of method that detects the CCR5 transgenation of claim 2, it is characterized in that, in the step 3); Per 25 μ L multi-PRC reaction systems comprise: the 2X Tag mix of 12.5 μ L; Article three, specific PCR primer SEQ ID No.1,2,3 is respectively 10 μ M, 20 μ M, 10 μ M; Template 40ng, all the other are water.

Images