CN105734132A - Agaricus bisporus Monilinia fructicola molecular detection primer and quick detection method - Google Patents
Agaricus bisporus Monilinia fructicola molecular detection primer and quick detection method Download PDFInfo
- Publication number
- CN105734132A CN105734132A CN201610155507.3A CN201610155507A CN105734132A CN 105734132 A CN105734132 A CN 105734132A CN 201610155507 A CN201610155507 A CN 201610155507A CN 105734132 A CN105734132 A CN 105734132A
- Authority
- CN
- China
- Prior art keywords
- agaricus bisporus
- primer
- brown rot
- rot germ
- soil
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to Agaricus bisporus Monilinia fructicola molecular detection primer and a quick detection method and belongs to the technical field of crop disease damage detection and biology. The specific primer comprises an upstream primer MSF: 5'-CCGGGGACCTAAACTCTTCTG-3' and a downstream primer SR: 5'-AAAGTTGGGGTTTTACGGCG-3'; the detection primer has high specificity and sensitivity, and the detection method is highly practical and simple and quick to perform; it is possible to detect Monilinia fructicola in Agaricus bisporus culture soil, the primer is significant to the prevention of Agaricus bisporus Monilinia fructicola and enables early detection of Agaricus bisporus Monilinia fructicola, the primer is effective in distinguishing similar diseases such as Agaricus bisporus soft rot and Agaricus bisporus brown blotch and is significant to the early control of Agaricus bisporus brown blotch and the spread of this disease.
Description
Technical field
The present invention relates to a kind of Agaricus bisporus brown rot germ molecular detection primer and detection method thereof, be exclusively used in Agaricus bisporus
The rapid molecular detection of brown rot germ, can realize the detection of field cultivation of agaricus bisporus soil and Agaricus bisporus brown rot simultaneously
The monitoring of early diagnosis and pathogenic bacteria is identified, belongs to corps diseases detection and biological technical field.
Background technology
Agaricus bisporus [Agaricus bisporus (Lange) Sing] is called for short mushroom, has another name called Agaricus Bisporus, white mushroom, ocean
Mushroom, the West mushroom, button mushroom, the West Tricholoma matsutake (lto et lmai) Singer etc..Agaricus bisporus is that in edible fungi merchandized handling, history is the longest, raw
Thing basic research is deeply, cultivation technique modernizes most, cultural area is the widest, production scale is maximum, total output and unit are
The edible fungi that yield is the highest, has the good reputation of " world mushroom ".The aminoacid of Agaricus bisporus and vitamin content enrich, and are a kind of high
Albumen, low-fat nutritional health food.Double spore mushroom protein matter content is almost higher than all vegetable crops, suitable with milk.
Agaricus bisporus starts from the 20-30 age in 20th century in China's cultivation.About nineteen twenty-five, Hu Changchi introduces Agaricus bisporus from Japan
Plant experimentally.1930-1931 Pan Zhi agriculture in Foochow, the Yu little Tie cultivation in Hangzhou all succeeds.Owing to condition is limited, technology is closed
Fall behind, develop the slowest.After 1950, it is thus achieved that fast development.1966, Foochow carried out large-scale planting and batch adds
Work.1973, Taiwan Province had more than 30,000 mushroom field, and 1975 annual productions are up to 60,000 tons.After the seventies, Jiangsu, Anhui, four
River, Guangdong, etc. save successively development Agaricus bisporus and produce, be generalized to more than 20 province (city, district).1978, China introduced also
Promote ferment in second time technology, per unit area yield is greatly improved, accelerates popularizing of Agaricus bisporus, even started in rural area and " wanted
Get rich kind of a mushroom " upsurge.The eighties in 20th century, along with novel bacterial, new technique, the emerging in large numbers of new technology, the production of Agaricus bisporus,
Sell and the swift and violent growth of outlet.China's Agaricus bisporus in 1985 always produces and reaches 190,000 tons, within 1990, breaks through 200,000 tons, exports 170,000
Ton, occupies the second in the world, is only second to the U.S..Nineteen ninety-five China's Agaricus bisporus total output 350,000 tons.National Agaricus bisporus in 2007
Total output reaches 2,440,000 tons, accounts for more than the 70% of Gross World Product, and export volume also occupies No. 1 in the world.China has become maximum
Agaricus bisporus manufacturing country.And the domestic consumption of state of China also increases swift and violent, within 2000, domestic consumption amount has reached 150,000 tons, accounts for
The 35% of total output.The situation in comprehensive two markets both at home and abroad is visible, and the development prospect of Agaricus bisporus is the most wide.Double spore mushrooms
Mushroom industry has become China's export and has earned foreign exchange, adjusts the structure of agricultural production, the expenditure industry of increase increasing peasant income, and Agaricus bisporus is no longer simultaneously
Only it is merely an ingredient of agricultural, also the closest with industrial relations.During Agaricus bisporus industry development,
Affect and driven the relevant industries such as medicine, light industry, food, chemical industry, machinery and transportation logistics to develop accordingly.The double spore mushroom of development
Mushroom industry is conducive to agricultural restructuring, increases increasing peasant income；Advantageously account for surplus rural labor force's problem of employment；Be conducive to
The upstream and downstream firms driving double spore mushroom chain industry develops jointly.Therefore Agaricus bisporus industrial relations huge numbers of families, promote industry to be good for
Kang Fazhan can effectively facilitate increasing peasant income, growth of agricultural efficiency.
Wet bubble, also known as Wet bull, white rot, is by wart spore mycete [Mycogone perniciosa
(Magn.)] infect a kind of worldwide disease caused, be occur on Agaricus bisporus the most universal, cause harm the most serious disease.Zeng You
Document announcement main Agaricus bisporus producing region in the world is all encroached on by this disease, the double spore of these plantations such as U.S., Australia, method, moral, Holland
The most all there is this disease of generation in the country of mushroom.Owing to the mushroom after infecting Wet bull can not eat so that various countries' cultivated mushroom
Yield reduce significantly.The wildness of this disease the most once made some country have to abandon the cultivation of Agaricus bisporus.W.
Baunacke reports, owing to mushroom warts lunata is sick, causes the mushroom yield loss of Germany to reach 10-25%.Mushroom warts lunata disease becomes
Ask the disease that doctor seeks medicine anxiously, everywhere for mushroom agriculture, disease generating region is almost present in national each mushroom producing region.Mushroom wart
Spore mildew mainly infects Agaricus bisporus, Volvariella volvacea (Bull.Ex Franch.) Singer．.It is annual that due to mould the causing harm of wart spore, the universal underproduction of Agaricus bisporus is about 10%-20%,
The loss of sick mushroom house up to 50%-60%, the even total crop failure having that especially severe is local.
At present, the biological characteristics of mushroom warts lunata, Anttdisease Mechanism processed be there has been Preliminary study, but so far, not yet have anti-
The produced mushroom of Wet bull comes out.Wart spore mycete (M. perniciosa) is a kind of soil inhabitant, the wart carried in soil
Spore is mould is the source of infection of Agaricus bisporus brown rot, and the preventing and treating that the soil disinfection sterilizing that thus be accordingly used in agaricus bisporus soil covering is main is arranged
Execute, and after falling ill, germicide spray process is the assisting in preventing and treating measure of disease.Agaricus bisporus be under the jurisdiction of Eumycota, Basidiomycetes,
Holobasidiomycetidae, Agaricales, Agaricus edibilis (Hei San section), Agaricus (black umbrella genus), and wart spore mould genus Deuteromycotina, silk spore
Guiding principle, silk detailed outline, Moniliaceae.Agaricus bisporus and its pathogen mushroom warts lunata belong to Eumycota, and antibacterial is to mushroom wart spore
Mould have similar action site with mushroom, all has an inhibitory action in various degree to wet bubble bacterium and mushroom, thus double spore
The wart spore mycete detection of mushroom-cultivating soil and the early stage detection of Agaricus bisporus brown rot germ are to prevention Agaricus bisporus brown rot tool
Significant.Therefore, set up that a set of wet bubble bacterium is convenient and swift, reliable results, highly sensitive quick diagnosis technology,
Realize Agaricus bisporus brown rot early warning and alert, the propagation effectively controlling pathogen and plant disease epidemic, it is achieved the preventing and treating of " keeping away disease " is arranged
Execute, effectively control the generation of Agaricus bisporus brown rot, support Agaricus bisporus industry and develop in a healthy way.
In recent years, Protocols in Molecular Biology quickly grows, wherein PCR(polymerase chain reaction) technology
There is high specificity, highly sensitive, conveniently advantage, be widely used in diagnosis and the mirror of phytopathogen in Plant Pathology
Fixed.Fungus ribosome transcribed spacer ITS(internal transcribed spacer) conservative in sequence kind and section belong to
Variable feature between kind, carries out PCR according to its this characteristics design specific primer, so Rapid identification and diagnosis of plant sick
Former bacterium is achieved with extensively application, and specific primer and the detection method of various plants pathogen are developed, it is achieved that quickly
Identify accurately, such as cymbidium anthracnose bacterium, tomato early blight bacterium, citrus processing, sweet potato black rot pathogen etc..The most relevant
There is not been reported in the research of Agaricus bisporus brown rot germ rapid molecular detection.
Summary of the invention
It is difficult to prevent and treat to Agaricus bisporus brown rot in prior art, brown rot germ (wart in cultivation of agaricus bisporus soil
Spore is mould) be difficult to detect, detection and the evaluation program of Agaricus bisporus brown rot germ be loaded down with trivial details, to identifying that skill requirement is high, accuracy
Low, it is difficult to realize the difficult problem such as prediction and warning of Agaricus bisporus brown rot, it is provided that a kind of Agaricus bisporus brown rot germ Molecular Detection
Primer and detection method thereof.
For achieving the above object, this invention takes techniques below scheme:
Present invention firstly provides a kind of Agaricus bisporus brown rot germ molecular detection primer, its nucleotides sequence is classified as:
Forward primer MSF:5 '-CCGGGGACCTAAACTCTTCTG-3 '
Downstream primer MSR:5 '-AAAGTTGGGGTTTTACGGCG-3 '.
Described primer MSF and MSR goes out the product of 397bp to Agaricus bisporus brown rot germ specific amplification.
Present invention also offers the method for quick of a kind of Agaricus bisporus brown rot germ, comprise the following steps:
(1) from Agaricus bisporus sporophore or cultivating soil, DNA is extracted；
When whether pathogen pure culture and Agaricus bisporus existing brown rot germ for detecting, CTAB method is used to extract for examination
Strain gene group DNA；When whether cultivation of agaricus bisporus soil existing brown rot germ for detecting, use soil DNA quick
Extraction test kit extracts.
(2) PCR amplification is carried out for template extracting DNA in Agaricus bisporus or cultivating soil: PCR reaction system 25 μ L,
Comprising 2.5 μ L 10 × PCR buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is 5U/ μ L
Taq enzyme, MSF and MSR each 0.5 μ L, the DNA profiling 1 μ L of 10 μm ol/L, add ddH2O reaches 25 μ L to cumulative volume；PCR reacts bar
Part is: 94 DEG C of denaturations 5min；94 DEG C of degeneration 45sec, 55 DEG C of annealing 45sec, 72 DEG C extend 1min, totally 35 circulations；72℃
Extend 10min；
(3) PCR primer of upper step gained is with the liquid electrophoretic analysis of 0.5 × tbe buffer on 1.2% agarose gel, and voltage is 4-
5V/cm；Size according to amplified production judges testing result, if energy specific amplification goes out the product of 397bp, then can determine that institute
There is brown rot germ in the Agaricus bisporus stated or cultivating soil, otherwise described Agaricus bisporus or cultivating soil do not exist double spore
Wet bubble bacterium.
The present invention actively has the beneficial effects that:
(1) high specificity: the primer designed by the present invention has the strongest specificity to Agaricus bisporus brown rot germ, it is possible to be used for
Difference Agaricus bisporus brown patch germ, Agaricus bisporus Bacteria erwinia and other soil inhabitants, it is thus possible to effectively detect Agaricus bisporus
Brown rot germ above and in soil；
(2) accuracy is good: the present invention is according to fungus ribosome transcribed spacer (rDNA-ITS) sequence height in fungus kind
Between degree conservative and section belong to kind, the design of variable feature has the PCR of specific amplified effect and draws Agaricus bisporus brown rot germ
Thing.To different the Agaricus bisporus brown rot germ of geographic origin, the Agaricus bisporus tissues of morbidity, carry Agaricus bisporus brown rot
The soil of bacterium and healthy Agaricus bisporus have carried out detection checking, the only Agaricus bisporus group of Agaricus bisporus brown rot germ, morbidity
Knit and carry the electrophoretic band that can specifically amplify 397 bp in the soil of Agaricus bisporus brown rot germ, this is described
Primer designed by invention is used for detecting Agaricus bisporus brown rot germ accurately and reliably；
(3) highly sensitive: the present invention special primer and ITS gene universal primer (ITS1/ITS4) of design are joined together into
After the amplification of row nest-type PRC, the detection sensitivity of Agaricus bisporus brown rot germ be can reach 1fg in DNA level；
(4) suitability is wide, practicality good: the detection method of the Agaricus bisporus brown rot germ of the present invention, can not only be to pathogenic bacteria mycelia
Body detects, and also can detect for the soil of agaricus bisporus soil covering and the Agaricus bisporus of infection brown rot germ, thus
" keeping away disease " measure important in Plant Protection can be realized.
(5) easy and simple to handle quickly: the present invention only need to carry out DNA extraction, PCR amplification and sepharose electrophoresis after i.e. can determine that
As a result, general whole detection process can complete in 5 hours, simple and efficient to handle.
Accompanying drawing explanation
Fig. 1 be primer of the present invention to Agaricus bisporus brown rot germ specific amplification electrophoretogram: wherein swimming lane M is 2000bp
DNA Marker, swimming lane 2, swimming lane 3 are Agaricus bisporus brown rot germ, and swimming lane 4-11 is respectively as follows: Agaricus bisporus brown patch germ (Toland
Family name's Pseudomonas alba), Agaricus bisporus Bacteria erwinia (Verticillium sp), Agaricus bisporus wilting germ (pinch outs), Semen Maydis stricture of vagina withered
Pathogenic bacteria (Rhizoctonia solani Kuhn), Glorosprium musarum Cookeet Mass (glue born of the same parents' anthrax), Didymella bryoniae (melon spherical cavity bacterium), stem rot of sweet potato
Bacterium (Rhizoma Dioscoreae esculentae Fusariumsp), negative control.
Fig. 2 is the susceptiveness detection amplification electrophoretogram of primer Agaricus bisporus brown rot germ of the present invention: figure A: substance PCR, schemes B
For nest-type PRC, wherein figure A swimming lane M be 2000bp DNA Marker, swimming lane 2-12 be respectively as follows: 100ng, 10ng, 1ng,
100pg, 10pg, 1pg, 100fg, 10fg, 1fg, negative control, positive control；Figure B swimming lane M is 2000bp DNA
Marker, swimming lane 2-13 are respectively as follows: 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg, 100ag, feminine gender
Comparison, positive control.
Fig. 3 is the Agaricus bisporus fallen ill of the present invention and cultivating soil amplification electrophoretogram, and wherein swimming lane M is 2000bp DNA
Marker, swimming lane 2-10 are respectively the Agaricus bisporus of natural occurrence, natural occurrence cultivation of agaricus bisporus soil, artificial vaccination morbidity
Agaricus bisporus tissue, artificial vaccination morbidity cultivation of agaricus bisporus soil, healthy Agaricus bisporus, the cultivation of Agaricus bisporus ferment in second time
Training material, the soil of sterilizing, negative control, positive control.
Detailed description of the invention
In order to make content of the present invention easily facilitate understanding, below in conjunction with detailed description of the invention to of the present invention
Technical scheme is described further.
Test method used in following embodiment if no special instructions, is conventional method.
Test material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
The design of embodiment 1 molecular detection primer and the foundation of Agaricus bisporus brown rot germ special molecular detection method
1. the extraction of Agaricus bisporus brown rot germ genomic DNA:
Using CTAB method to extract the genomic DNA of the 12 strain Agaricus bisporus brown rot germs that this laboratory preserves, concrete steps are such as
Under:
(1) take 0.1 g mycelium powder in 1.5 mL centrifuge tubes, add 900 μ L2%CTAB extracting solution, use agitator vibration mixed
Even, 60 DEG C of water-bath 60min, under room temperature condition, 12000r/min is centrifuged 15 min；
(2) taking supernatant 700 μ L, add equal-volume phenol, chloroform, isoamyl alcohol mixed liquor (each volume ratio is 25:24:1), gentleness is shaken
Dynamic, under room temperature condition, 8000 r/min are centrifuged 10min；
(3) taking supernatant 500 μ L, add equal-volume chloroform and extract once again, under room temperature condition, 8000 r/min are centrifuged
10min；
(4) take supernatant 350 μ L, add 1/10 volume 3 mol/L NaAc and 2 times of volume dehydrated alcohol ,-20 DEG C of precipitations 60
Min, under the conditions of 4 DEG C, 8000 r/min are centrifuged 5 min；
(5) abandoning supernatant, adding 700 μ L volumetric concentrations is 70% ice ethanol, jog 10sec, under the conditions of 4 DEG C, 8000 r/
Min is centrifuged 10sec, dries, and adds 50 μ L TE buffer, and-20 DEG C save backup.
2. Agaricus bisporus brown rot germ ITS sequence measures:
With fungus Internal Transcribed Spacer (rDNA-ITS) universal primer TS1:5'-TCCGTAGGGAACCTGCGG-3'
It is that primer carries out PCR to the DNA extracting Agaricus bisporus brown rot germ with ITS4:5'-TCCTCCGCTTATTGATATGC-3'
Amplification, amplification reaction system and response procedures be: PCR reaction system 25 μ L, comprises 2.5 μ L 10 × PCR buffer, 2.0 μ L
Concentration is the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is Taq enzyme (the Takara Dalian treasured biological engineering of 5U/ μ L
Company limited), TIS1 and ITS4 each 0.5 μ L, the DNA profiling 1 μ L of 10 μm ol/L, add ddH2O reaches 25 μ L to cumulative volume；PCR is anti-
The condition is answered to be: 94 DEG C of denaturations 5min；94 DEG C of degeneration 1 min, 55 DEG C of annealing 45sec, 72 DEG C extend 1 min, totally 35 circulations；
72 DEG C extend 10min；Gained PCR primer send Dalian treasured biological engineering company limited to check order.
3. the design of Agaricus bisporus brown rot germ special molecular detection primer:
According to Agaricus bisporus brown rot germ ribosome the Internal Transcribed Spacer (rDNA-ITS) sequence between fungus kind height variation and
Kind of internal stability, the ITS sequence of 12 strain Agaricus bisporus brown rot germs order-checking obtained with Clustal X software with
In GenBank, Mycogone belongs to ITS sequence the most of the same race, Agaricus bisporus brown patch germ ITS sequence, Agaricus bisporus Bacteria erwinia
ITS sequence carries out homology analysis and difference site is compared, by Primer Primer5 software design to Agaricus bisporus brown rot
Pathogenic bacteria have specific amplification effect one couple of PCR primers (by Shanghai Sheng Gong biological engineering company limited synthesize), the most special point
The sequence of sub-detection primer is:
Forward primer MSF:5 '-CCGGGGACCTAAACTCTTCTG-3 '；
Downstream primer MSR:5 '-AAAGTTGGGGTTTTACGGCG-3 '.
4. the foundation of Agaricus bisporus brown rot germ rapid molecular detection method:
(1) from Agaricus bisporus brown rot germ or Agaricus bisporus sporophore or cultivation of agaricus bisporus soil, DNA is extracted:
When being 1. used for detecting pathogen pure culture, CTAB method is used to extract strains tested genomic DNA；
2. it is used for detecting Agaricus bisporus sporophore when whether there is Agaricus bisporus brown rot germ, uses CTAB method to extract for examination bacterium
Pnca gene group DNA；
3. it is used for detecting time whether cultivating soil exists wet bubble bacterium, uses soil DNA rapid extraction test kit to carry
Take.
(2) carry out PCR amplification with the DNA extracted for template: PCR reaction system 25 μ L, comprise 2.5 μ L 10 × PCR
Buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L, 10 μm ol/L
MSF and MSR each 0.5 μ L, DNA profiling 1 μ L, add ddH2O reaches 25 μ L to cumulative volume；PCR reaction condition is: 94 DEG C of denaturations
5min；94 DEG C of degeneration 45sec, 55 DEG C of annealing 45sec, 72 DEG C extend 1min, totally 35 circulations；72 DEG C extend 10min；
(3) PCR primer of upper step gained is with the liquid electrophoretic analysis of 0.5 × tbe buffer on 1.2% agarose gel, and voltage is 4-
5V/cm；Size according to amplified production judges testing result, if energy specific amplification goes out the product of 397bp, then can determine that institute
The Agaricus bisporus sporophore stated or cultivating soil exist Agaricus bisporus brown rot germ, otherwise described Agaricus bisporus sporophore or
Cultivating soil does not exist Agaricus bisporus brown rot germ.
Embodiment 2 Agaricus bisporus brown rot germ specific amplification
1. use CTAB method to extract 2 strain Agaricus bisporus brown rot germs, Agaricus bisporus brown patch germ, Agaricus bisporus Bacteria erwinia, double
(predominantly soil-borne pathogen, including Rhizoctonia solani Kahn, Fructus Musae anthrax for spore mushroom wilting germ and other Different Crop pathogen
Pathogenic bacteria, Didymella bryoniae, stem rot of sweet potato bacterium) genomic DNA.
2. carry out PCR amplification for template extracting the DNA for examination bacterium: PCR reaction system 25 μ L, comprise 2.5 μ L 10 ×
PCR buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L, 10 μ
MSF and MSR each 0.5 μ L, the DNA profiling 1 μ L of mol/L, adds ddH2O reaches 25 μ L to cumulative volume；PCR reaction condition is: 94 DEG C pre-
Degeneration 5min；94 DEG C of degeneration 45sec, 55 DEG C of annealing 45sec, 72 DEG C extend 1min, totally 35 circulations；72 DEG C extend 10min；Electricity
Swimming detection amplified production.
3. specific amplification result
As it is shown in figure 1,2 strain wet bubble bacterium can go out the band of 397bp with specific amplification, and Agaricus bisporus brown patch germ,
Agaricus bisporus Bacteria erwinia, Agaricus bisporus wilting germ and for trying other crop pathogens and negative control all without amplified band,
Show that Agaricus bisporus brown rot germ can be made a distinction with other crop pathogenses by the molecular detection primer of the present invention, have very
Strong specificity, the detection method of the present invention can be used for the specific amplification of Agaricus bisporus brown rot germ.
The susceptiveness of Agaricus bisporus brown rot germ is detected by embodiment 3 primer of the present invention
1. use CTAB method to extract the genomic DNA of Agaricus bisporus pathogenic bacteria；
2. by the genomic DNA of the Agaricus bisporus pathogenic bacteria of extraction, after spectrophotometric determination concentration, dilute with aseptic ultra-pure water
Release, be configured to series concentration, standby；
3. carry out standard PCR amplification with one-tenth series concentration DNA of preparation for template: PCR reaction system 25 μ L, comprise 2.5 μ L
10 × PCR buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L, 10
MSF and MSR each 0.5 μ L, the DNA profiling 1 μ L of μm ol/L, adds ddH2O reaches 25 μ L to cumulative volume；PCR reaction condition is: 94 DEG C pre-
Degeneration 5min；94 DEG C of degeneration 45sec, 55 DEG C of annealing 45sec, 72 DEG C extend 1min, totally 35 circulations；72 DEG C extend 10min；Electricity
Swimming detection amplified production.
4. carry out nested PCR amplification with one-tenth series concentration DNA of preparation for template:
(1) first round PCR amplification: with fungus Internal Transcribed Spacer (rDNA-ITS) universal primer TS1:5'-
TCCGTAGGGAACCTGCGG-3' with ITS4:5'-TCCTCCGCTTATTG ATATGC-3' is that outer primer becomes system to preparation
Row concentration DNA carries out the amplification of first round PCR, amplification reaction system and response procedures: PCR reaction system 25 μ L, comprises 2.5
μ L 10 × PCR buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L
(Takara Dalian treasured biological engineering company limited), TIS1 and ITS4 each 0.5 μ L, the DNA profiling 1 μ L of 10 μm ol/L, add
ddH2O reaches 25 μ L to cumulative volume；PCR reaction condition is: 94 DEG C of denaturations 5min；94 DEG C of degeneration 1 min, 55 DEG C of annealing 45sec,
72 DEG C extend 1 min, totally 35 circulations；72 DEG C extend 10min；
(2) second take turns PCR amplification: with the first round PCR amplification product as template, carry out second with MSF/MSR for primer and take turns PCR
Amplification, PCR reaction system 25 μ L, comprise 2.5 μ L 10 × PCR buffer, 2.0 μ L concentration are the dNTP of 2.5mmol/L
Mixture, 0.15 μ L concentration is the Taq enzyme of 5U/ μ L, MSF and MSR each 0.5 μ L, the DNA profiling 1 μ L of 10 μm ol/L, adds ddH2O
25 μ L are reached to cumulative volume；PCR reaction condition is: 94 DEG C of denaturations 5min；94 DEG C of degeneration 45sec, 55 DEG C of annealing 45sec, 72 DEG C
Extend 1min, totally 35 circulations；72 DEG C extend 10min；Electrophoresis detection amplified production.
5. testing result
As in figure 2 it is shown, with primer MSF/MSR of the present invention for primer carry out Standard PCR time, in 25 μ L reaction systems, 10pg's
Agaricus bisporus brown rot germ DNA can obtain visual band, and its detection sensitivity can reach 10pg(Fig. 2-A)；And further with
The universal primer TS1:5'-TCCGTAGGGAACCTGCGG-3' of fungus Internal Transcribed Spacer (rDNA-ITS) and
ITS4:5'-TCCTCCGCTTATTGATATGC-3' be the product of external primer amplification be template, with primer MSF/MSR of the present invention
For primer carry out second take turns amplification time, in 25 μ L reaction systems, the Agaricus bisporus brown rot germ DNA of 1fg can obtain visually
Band, its detection sensitivity can reach 1fg (Fig. 2-B).
Embodiment 4 is fallen ill the detection of Agaricus bisporus brown rot germ in Agaricus bisporus sporophore and cultivation of agaricus bisporus soil
1. use CTAB method to extract Agaricus bisporus sporophore genomic DNA；Use soil DNA rapid extraction test kit to extract to treat
Survey soil genomic DNA.
2. carry out standard PCR amplification with one-tenth series concentration DNA of preparation for template: PCR reaction system 25 μ L, comprise 2.5
μ L 10 × PCR buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq of 5U/ μ L
Enzyme, MSF and MSR each 0.5 μ L, the DNA profiling 1 μ L of 10 μm ol/L, add ddH2O reaches 25 μ L to cumulative volume；PCR reaction condition is:
94 DEG C of denaturations 5min；94 DEG C of degeneration 45sec, 55 DEG C of annealing 1min, 72 DEG C extend 45sec, totally 35 circulations；72 DEG C of extensions
10min；Electrophoresis detection amplified production.
3. testing result
As it is shown on figure 3, the Agaricus bisporus sporophore of natural occurrence, natural occurrence cultivation of agaricus bisporus soil, artificial vaccination morbidity
Agaricus bisporus sporophore, artificial vaccination morbidity cultivation of agaricus bisporus soil, positive control all can produce about 397bp can
Depending on band, and healthy Agaricus bisporus sporophore, the planting material of Agaricus bisporus ferment in second time, the soil of sterilizing, the equal nothing of negative control
Any band occurs, shows that primer of the present invention and detection method can be additionally used in field Agaricus bisporus brown rot morbidity sporophore and cultivation
The detection of ridging earth.
The foregoing is only presently preferred embodiments of the present invention, all impartial changes done according to scope of the present invention patent with
Modify, all should belong to the covering scope of the present invention.
Sequence table
<110>Inst. of Plant Protection, fujian Academy of Agricultural Science
<120>a kind of Agaricus bisporus brown rot germ molecular detection primer and method for quick
<160>4
<170>PatentIn version 3.5
<210>1
<211>18
<212>DNA
<213>Artificial Sequence
<400>1
tccgtagggaacctgcgg 18
<210>2
<211>20
<212>DNA
<213>Artificial Sequence
<400>2
tcctccgcttattgatatgc 20
<210>3
<211> 21
<212>DNA
<213>Artificial Sequence
<400>3
ccggggacctaaactcttctg 21
<210>4
<211>20
<212>DNA
<213>Artificial Sequence
<400>4
aaagttggggttttacggcg 20
Claims (4)
1. an Agaricus bisporus brown rot germ molecular detection primer, it is characterised in that: the nucleotides sequence of primer is classified as:
Forward primer MSF:5 '-CCGGGGACCTAAACTCTTCTG-3 '
Downstream primer MSR:5 '-AAAGTTGGGGTTTTACGGCG-3 '.
Agaricus bisporus brown rot germ molecular detection primer the most according to claim 1, it is characterised in that described forward primer
MSF and downstream primer MSR goes out the product of 397bp to Agaricus bisporus brown rot germ specific amplification.
3. the method for quick of an Agaricus bisporus brown rot germ, it is characterised in that: comprise the following steps:
(1) from the Agaricus bisporus infecting brown rot germ or the soil being used for cultivation of agaricus bisporus earthing, DNA is extracted；
(2) with from infect brown rot germ Agaricus bisporus or for cultivation of agaricus bisporus earthing soil in extract DNA as mould
Plate carries out PCR amplification: PCR reaction system 25mL, comprises 2.5mL 10 × PCR buffer, and 2.0mL concentration is 2.5mmol/L's
DNTP Mixture, 0.15mL concentration is the Taq enzyme of 5U/mL, each 0.5mL of primer MSF and primer MSR of 10mmol/L, DNA mould
Plate 1mL, adds ddH2O reaches 25mL to cumulative volume；PCR reaction condition is: 94 DEG C of denaturations 5min；94 DEG C of degeneration 45sec, 55 DEG C are moved back
Fire 45sec, 72 DEG C extend 1min, totally 35 circulations；72 DEG C extend 10min；
(3) PCR primer of upper step gained is with the liquid electrophoretic analysis of 0.5 × tbe buffer on 1.2% agarose gel, and voltage is 4-
5V/cm；Size according to amplified production judges testing result, if energy specific amplification goes out the product of 397bp, then judges double spore
Mushroom or for cultivation of agaricus bisporus earthing soil in there is wet bubble bacterium.
4. Agaricus bisporus brown rot germ molecular detection primer as claimed in claim 1 is at Soil K+adsorption Agaricus bisporus brown rot germ
In application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610155507.3A CN105734132B (en) | 2016-03-18 | 2016-03-18 | A kind of agaricus bisporus brown rot germ molecular detection primer and rapid detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610155507.3A CN105734132B (en) | 2016-03-18 | 2016-03-18 | A kind of agaricus bisporus brown rot germ molecular detection primer and rapid detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105734132A true CN105734132A (en) | 2016-07-06 |
| CN105734132B CN105734132B (en) | 2019-01-04 |
Family
ID=56250871
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610155507.3A Active CN105734132B (en) | 2016-03-18 | 2016-03-18 | A kind of agaricus bisporus brown rot germ molecular detection primer and rapid detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105734132B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241249A (en) * | 2019-07-18 | 2019-09-17 | 华中农业大学 | The primer and method of agaricus bisporus Wet bull pathogen in a kind of quick detection earthing |
| CN111500760A (en) * | 2020-05-09 | 2020-08-07 | 福建省农业科学院植物保护研究所 | Molecular detection primer for rapidly identifying verruca rosea and application thereof |
| CN113881792A (en) * | 2021-11-23 | 2022-01-04 | 广西壮族自治区农业科学院 | PCR detection primer and kit for West nerviliae and application of PCR detection primer and kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063219A (en) * | 2015-08-20 | 2015-11-18 | 福建省农业科学院植物保护研究所 | Guava colletotrichum orbiculare specificity PCR detecting primer and detecting method of guava colletotrichum orbiculare |
| CN105256060A (en) * | 2015-11-24 | 2016-01-20 | 福建省农业科学院植物保护研究所 | PCR detection primer and method for anoectochilus roxburghii colletotrichum orbiculare |
-
2016
- 2016-03-18 CN CN201610155507.3A patent/CN105734132B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063219A (en) * | 2015-08-20 | 2015-11-18 | 福建省农业科学院植物保护研究所 | Guava colletotrichum orbiculare specificity PCR detecting primer and detecting method of guava colletotrichum orbiculare |
| CN105256060A (en) * | 2015-11-24 | 2016-01-20 | 福建省农业科学院植物保护研究所 | PCR detection primer and method for anoectochilus roxburghii colletotrichum orbiculare |
Non-Patent Citations (1)
| Title |
|---|
| 刘春来等: "rDNA- ITS 在植物病原真菌分子检测中的应用", 《东北农业大学学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241249A (en) * | 2019-07-18 | 2019-09-17 | 华中农业大学 | The primer and method of agaricus bisporus Wet bull pathogen in a kind of quick detection earthing |
| CN111500760A (en) * | 2020-05-09 | 2020-08-07 | 福建省农业科学院植物保护研究所 | Molecular detection primer for rapidly identifying verruca rosea and application thereof |
| CN111500760B (en) * | 2020-05-09 | 2022-05-20 | 福建省农业科学院植物保护研究所 | Molecular detection primer for rapidly identifying verruca rubra and application |
| CN113881792A (en) * | 2021-11-23 | 2022-01-04 | 广西壮族自治区农业科学院 | PCR detection primer and kit for West nerviliae and application of PCR detection primer and kit |
| CN113881792B (en) * | 2021-11-23 | 2022-05-24 | 广西壮族自治区农业科学院 | PCR detection primer and kit for West nerviliae and application of PCR detection primer and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105734132B (en) | 2019-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105734132B (en) | A kind of agaricus bisporus brown rot germ molecular detection primer and rapid detection method | |
| CN105256060B (en) | A kind of roxburgh anoectochilus terminal bud anthrax bacteria PCR detection primer and its detection method | |
| CN110229758A (en) | A kind of Rhizoma Atractylodis Macrocephalae endogenetic fungus and its application in prevention and treatment Root Rot of Largehead Atractylodes | |
| CN105648106B (en) | A kind of Exserohilum turcicum molecular detection primer and rapid detection method | |
| SONG et al. | First report of a new potato disease caused by Galactomyces candidum F12 in China | |
| CN104313128B (en) | Method based on loop-mediated isothermal amplification technique detection Fusarium graminearum and Primer composition | |
| CN105112533B (en) | PCR primer and its detection method for botrytis cinerea detection | |
| CN106381341A (en) | Phytophthora colocasiae nested PCR detection primer and application thereof | |
| CN109971656A (en) | Raw Trichoderma viride and its application in one plant of ginger | |
| CN103045747B (en) | Molecular detection primer for sweet potato black rot germs and application of molecular detection primer | |
| CN104651493B (en) | Method for identifying point mutation of nucleotide of phytophthora capsici leonian PcORP1 gene and pesticide resistance of mutant phytophthora capsici leonian PcORP1 gene to oxathiapiprolin | |
| CN102433387B (en) | Molecular detection method and primers for detecting fusarium oxysporum | |
| CN106755339A (en) | Cucumber anthracnose LAMP detection primer and its application | |
| CN104232748B (en) | Whether a kind of red bayberry nursery stock carries the rapid molecular detection method of wilting germ | |
| CN105755122A (en) | Sweet potato fusarium wilt germ molecule detecting primer and rapid detection method | |
| CN106282386A (en) | A kind of Glorosprium musarum Cookeet Mass molecular detection primer and detection method | |
| CN106399529B (en) | A kind of Phyllosticta musarum molecular detection primer and detection method | |
| Zheng et al. | Root rot of Codonopsis tangshen caused by Ilyonectria robusta in Chongqing, China | |
| CN105755157A (en) | PCR (Polymerase Chain Reaction) detection primer group for magnaporthe grisea and detection method thereof | |
| CN105648107B (en) | A kind of southern corn leaf blight molecular detection primer and rapid detection method | |
| CN105586431B (en) | A kind of asparagus stem wilt bacteria molecular detection primer and rapid detection method | |
| CN105063040B (en) | Phytophthora infestans germ PCR detection primers, kit and detection method | |
| CN102643903B (en) | PCR (Polymerase Chain Reaction) detection primer for phytophthora capsici leonian, kit containing primer and application thereof | |
| CN106244720B (en) | A kind of anthracnose of peach bacterium molecule detection primer and detection method | |
| CN105779315A (en) | Preparation method of asparagus stem blight generic transformant mediated by agrobacterium |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |