CN105734132B - A kind of agaricus bisporus brown rot germ molecular detection primer and rapid detection method - Google Patents
A kind of agaricus bisporus brown rot germ molecular detection primer and rapid detection method Download PDFInfo
- Publication number
- CN105734132B CN105734132B CN201610155507.3A CN201610155507A CN105734132B CN 105734132 B CN105734132 B CN 105734132B CN 201610155507 A CN201610155507 A CN 201610155507A CN 105734132 B CN105734132 B CN 105734132B
- Authority
- CN
- China
- Prior art keywords
- agaricus bisporus
- brown rot
- primer
- soil
- rot germ
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of agaricus bisporus brown rot germ molecular detection primer and its detection methods, belong to corps diseases detection and field of biotechnology.The specific primer includes upstream primer MSF:5 '-CCGGGGACCTAAACTCTTCTG-3 ', downstream primer SR:5 '-AAAGTTGGGGTTTTACGGCG-3 '；Detection primer high specificity of the present invention, high sensitivity, detection method practicability is good, simple and efficient to handle；The present invention is able to achieve the detection of brown rot germ in cultivation of agaricus bisporus soil, it is of great significance for prevention agaricus bisporus brown rot, it can also be achieved the early detection of agaricus bisporus brown rot, the similar diseases such as agaricus bisporus soft rot, agaricus bisporus brown spot can also be effectively distinguished, are of great significance to the early stage prevention and control of agaricus bisporus brown rot, the diffusion sprawling of disease.
Description
Technical field
The present invention relates to a kind of agaricus bisporus brown rot germ molecular detection primer and its detection methods, are exclusively used in agaricus bisporus
The rapid molecular of brown rot germ detects, while can realize the detection and agaricus bisporus brown rot of field cultivation of agaricus bisporus soil
Early diagnosis and the monitoring of germ are identified, corps diseases detection and field of biotechnology are belonged to.
Background technique
Agaricus bisporus [Agaricus bisporus(Lange) Sing] abbreviation mushroom also known as agaricus bisporus, white mushroom, ocean
Mushroom, Western mushroom, button mushroom, Western matsutake etc..Agaricus bisporus is that history is more long, raw in edible mushroom merchandized handling
Object basic research is deeply, cultivation technique most modernize, cultural area is most wide, production scale maximum, total output and unit area
The highest edible mushroom of yield has the good reputation of " world mushroom ".The amino acid and vitamin content of agaricus bisporus are abundant, are a kind of high
The nutritional health food of albumen, low fat.Double spore mushroom protein matter content is almost higher than all vegetable crops, suitable with milk.
Agaricus bisporus starts from the 20-30 age in 20th century in China's cultivation.Or so nineteen twenty-five Hu Changchi introduces agaricus bisporus from Japan
It plants experimentally.1930-1931 Pan Zhi agriculture succeeds in the cultivation of Foochow, Yu little Tie in Hangzhou.Since condition is limited, technology closing
Fall behind, develops extremely slow.After 1950, grown rapidly.1966, Foochow carried out large-scale planting and batch adds
Work.1973, Taiwan Province possessed a mushroom, 1975 annual outputs more than 30,000 and is up to 60,000 tons.After the seventies, Jiangsu, Anhui, four
River, Guangdong, etc. provinces successively develop agaricus bisporus production, be generalized to a province (city, area) more than 20.1978, China introduced simultaneously
Secondary fermentation process is promoted, per unit area yield is greatly improved, accelerates the promotion and popularization of agaricus bisporus, or even started and " wanted in rural area
Get rich kind of a mushroom " upsurge.In the 1980s, as novel bacterial, new technology, new process emerge in large numbers, the production of agaricus bisporus,
The swift and violent growth of sale and outlet.China's agaricus bisporus total yield in 1985 breaks through 200,000 tons for 1990, outlet 170,000 up to 190,000 tons
Ton, occupies the second in the world, is only second to the U.S..350,000 tons of nineteen ninety-five China's agaricus bisporus total output.National agaricus bisporus in 2007
Total output accounts for 70% of Gross World Product or more, export volume also occupies No. 1 in the world up to 2,440,000 tons.China has become maximum
Agaricus bisporus producing country.And the domestic consumption of state of China is also rapidly increasing, and domestic consumption amount in 2000 accounts for up to 150,000 tons
The 35% of total output.The situation in comprehensive two market both at home and abroad is as it can be seen that the development prospect of agaricus bisporus is extremely wide.Double spore mushrooms
Mushroom industry has become the expenditure industry that China's export earns foreign exchange, adjusts the structure of agricultural production, increasing increasing peasant income, while agaricus bisporus is no longer
It is only merely a component part of agricultural, while also increasingly close with industrial relation.During agaricus bisporus industry development,
It influences and the relevant industries such as medicine, light industry, food, chemical industry, machinery and transportation logistics has been driven accordingly to develop.Develop double spore mushrooms
Mushroom industry is conducive to agricultural restructuring, increases increasing peasant income；Advantageously account for surplus rural labor force's problem of employment；Be conducive to
Drive the upstream and downstream firms joint development of double spore mushroom chain industries.Therefore agaricus bisporus industrial relations huge numbers of families push industry strong
Kang Fazhan can effectively facilitate increasing peasant income, growth of agricultural efficiency.
Wet bubble is also known as Wet bull, white rot, be by wart spore mould [Mycogone perniciosa
(Magn.)] a kind of worldwide disease caused by infecting is to occur that most universal, cause harm most serious disease on agaricus bisporus.Zeng You
Document announcement in the world main agaricus bisporus producing region all by the infringement of the disease, beauty, Australia, method, moral, Holland etc. these plant double spores
The country of mushroom, which also has, occurs the disease.Since the mushroom after infection Wet bull cannot eat, so that various countries' cultivated mushroom
Yield significantly reduce.The rampant of the disease even once made some countries have to the cultivation for abandoning agaricus bisporus.W.
Baunacke report causes the mushroom yield loss of Germany up to 10-25% due to mushroom warts lunata disease.Mushroom warts lunata disease has become
For mushroom grower it is weighed down with anxieties, ask doctor's disease for seeking medicine everywhere, disease generating region is almost present in each mushroom producing region in the whole nation.Mushroom wart
Spore mildew mainly infects agaricus bisporus, straw mushroom.To cause harm every year since wart spore is mould, the universal underproduction of agaricus bisporus is about 10%-20%,
The sick mushroom house loss in especially severe place is up to 50%-60%, and some even has no harvest.
Currently, biological characteristics, the Anttdisease Mechanism processed to mushroom warts lunata there has been Preliminary study, but so far, there has been no anti-
The produced mushroom of Wet bull comes out.Wart spore mould (M. perniciosa) it is a kind of soil inhabitant, the wart carried in soil
It is the source of infection of agaricus bisporus brown rot that spore is mould, and the soil disinfection sterilizing for being accordingly used in agaricus bisporus soil covering is that main prevention and treatment is arranged
It applies, and germicide spray processing after the onset is the assisting in preventing and treating measure of disease.Agaricus bisporus be under the jurisdiction of Eumycota, Basidiomycetes,
Holobasidiomycetidae, Agaricales, Agaricus edibilis (Hei San section), Agaricus (black umbrella category), and the mould category Deuteromycotina of wart spore, silk spore
Guiding principle, silk detailed outline, Moniliaceae.Agaricus bisporus and its pathogen mushroom warts lunata belong to Eumycota, and fungicide is to mushroom wart spore
Mould and mushroom has similar action site, has different degrees of inhibiting effect, thus double spores to wet bubble bacterium and mushroom
The wart spore mould of mushroom-cultivating soil detects and the early detection of agaricus bisporus brown rot germ is to prevention agaricus bisporus brown rot tool
It is significant.Therefore, establish that a set of wet bubble bacterium is convenient and efficient, result is reliable, the quick diagnosis technology of high sensitivity,
It realizes agaricus bisporus brown rot early warning and alert, the propagation of effectively control pathogen and plant disease epidemic, realizes that the prevention and treatment of " keeping away disease " is arranged
It applies, effectively controls the generation of agaricus bisporus brown rot, support agaricus bisporus industry develops in a healthy way.
In recent years, Protocols in Molecular Biology is quickly grown, wherein PCR(polymerase chain reaction) technology
Have the advantages that high specificity, high sensitivity, convenient and efficient, is widely used in the diagnosis of phytopathogen and mirror in Plant Pathology
It is fixed.Fungi ribosomes transcribed spacer ITS(internal transcribed spacer) conservative in sequence kind and section belong to
The characteristics of inter-species changeability, designs specific primer according to its this characteristic and carries out PCR, and then Rapid identification and diagnosis of plant disease
Opportunistic pathogen has obtained extensive use, and the specific primer and detection method of various plants pathogen have been developed, and realizes quickly
Accurately identification, such as cymbidium anthracnose bacterium, tomato early blight bacterium, citrus processing, sweet potato black rot pathogen etc..It is related at present
There is not been reported for the research of agaricus bisporus brown rot germ rapid molecular detection.
Summary of the invention
For being difficult to prevent and treat to agaricus bisporus brown rot in the prior art, brown rot germ (wart in cultivation of agaricus bisporus soil
Spore is mould) be difficult to detect, the detection and identification program of agaricus bisporus brown rot germ is cumbersome, accuracy high to identification skill requirement
It is low, it is difficult to realize the problems such as the prediction and warning of agaricus bisporus brown rot, provide a kind of agaricus bisporus brown rot germ Molecular Detection
Primer and its detection method.
To achieve the above object, this invention takes following technical schemes:
Present invention firstly provides a kind of agaricus bisporus brown rot germ molecular detection primer, nucleotide sequences are as follows:
Upstream primer MSF:5 '-CCGGGGACCTAAACTCTTCTG-3 '
Downstream primer MSR:5 '-AAAGTTGGGGTTTTACGGCG-3 '.
The primer MSF and MSR goes out the product of 397bp to agaricus bisporus brown rot germ specific amplification.
The present invention also provides a kind of rapid detection methods of agaricus bisporus brown rot germ, comprising the following steps:
(1) DNA is extracted from agaricus bisporus fructification or cultivating soil；
When for detecting in pathogen pure culture and agaricus bisporus with the presence or absence of brown rot germ, extracted using CTAB method
Strains tested genomic DNA；When for detecting in cultivation of agaricus bisporus soil with the presence or absence of brown rot germ, using soil DNA
Rapidly extracting kit extracts.
(2) PCR amplification: 25 μ L of PCR reaction system is carried out as template to extract the DNA in agaricus bisporus or cultivating soil,
Comprising 2.5 μ 10 × PCR of L buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is 5U/ μ L
Taq enzyme, each 0.5 μ L of the MSF and MSR of 10 μm of ol/L, 1 μ L of DNA profiling add ddH2O is to total volume up to 25 μ L；PCR reacts item
Part are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 45sec, 55 DEG C of annealing 45sec, 72 DEG C of extension 1min, totally 35 recycle；72℃
Extend 10min；
(3) resulting PCR product is walked on 1.2% Ago-Gel with the electrophoretic analysis of 0.5 × tbe buffer liquid, voltage is
4-5V/cm；Testing result is determined according to the size of amplified production, if energy specific amplification goes out the product of 397bp, can determine that
There are brown rot germs in the agaricus bisporus or cultivating soil, and otherwise there is no double in the agaricus bisporus or cultivating soil
Spore wet bubble bacterium.
Positive beneficial effect of the invention is:
(1) high specificity: primer pair agaricus bisporus brown rot germ designed by the present invention has very strong specificity, can
For distinguishing agaricus bisporus brown patch germ, agaricus bisporus Bacteria erwinia and other soil inhabitants, so as to effectively detect double spores
Brown rot germ on mushroom and in soil；
(2) accuracy is good: the present invention be according to fungi ribosomes transcribed spacer (rDNA-ITS) sequence in fungi kind
The characteristics of the belonging to inter-species changeability design of well-conserved and section there is the PCR of specific amplified effect to agaricus bisporus brown rot germ
Primer.The agaricus bisporus tissue to the agaricus bisporus brown rot germ of different geographic origins, morbidity, carrying agaricus bisporus brown rot
The soil of germ and the agaricus bisporus of health have carried out detection verifying, only agaricus bisporus brown rot germ, morbidity agaricus bisporus
The electrophoretic band of 397 bp, explanation can be specifically amplified in the soil of tissue and carrying agaricus bisporus brown rot germ
Primer designed by the present invention is accurate and reliable for detecting agaricus bisporus brown rot germ；
(3) high sensitivity: the present invention has combined the special primer of design with ITS gene universal primer (ITS1/ITS4)
After carrying out nest-type PRC amplification, 1fg can reach in DNA level to the detection sensitivity of agaricus bisporus brown rot germ；
(4) applicability is wide, practicability is good: the detection method of agaricus bisporus brown rot germ of the invention, can not only be to germ
Mycelium is detected, and can also be detected to the agaricus bisporus of soil and infection brown rot germ for agaricus bisporus soil covering,
It can thus realize " keeping away disease " measure important in Plant Protection.
(5) easy to operate quick: the present invention can determine that after need to only carrying out DNA extraction, PCR amplification and agarose electrophoresis
As a result, general entire detection process can be completed within 5 hours, it is simple and efficient to handle.
Detailed description of the invention
Fig. 1 is primer pair agaricus bisporus brown rot germ specific amplification electrophoretogram of the present invention: wherein swimming lane M is 2000bp
DNA Marker, swimming lane 2, swimming lane 3 are agaricus bisporus brown rot germ, and swimming lane 4-11 is respectively as follows: agaricus bisporus brown patch germ (Toland
Family name's Pseudomonas alba), agaricus bisporus Bacteria erwinia (Verticillium sp), agaricus bisporus wilting germ (pinch outs), corn line it is withered
Germ (Rhizoctonia solani Kuhn), Glorosprium musarum Cookeet Mass (glue born of the same parents anthrax-bacilus), Didymella bryoniae (melon spherical cavity bacterium), stem rot of sweet potato
Bacterium (sweet potato Fusariumsp), negative control.
Fig. 2 is the sensitivity detection amplification electrophoretogram of primer agaricus bisporus brown rot germ of the present invention: figure A: substance PCR schemes B
For nest-type PRC, wherein figure A swimming lane M is 2000bp DNA Marker, swimming lane 2-12 be respectively as follows: 100ng, 10ng, 1ng,
100pg, 10pg, 1pg, 100fg, 10fg, 1fg, negative control, positive control；Scheming B swimming lane M is 2000bp DNA
Marker, swimming lane 2-13 are respectively as follows: 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg, 100ag, feminine gender
Control, positive control.
Fig. 3 is that the agaricus bisporus that the present invention falls ill and cultivating soil expand electrophoretogram, and wherein swimming lane M is 2000bp DNA
Marker, swimming lane 2-10 are respectively natually morbid agaricus bisporus, natural occurrence cultivation of agaricus bisporus soil, artificial infection morbidity
Agaricus bisporus tissue, artificial infection morbidity cultivation of agaricus bisporus soil, healthy agaricus bisporus, agaricus bisporus secondary fermentation cultivation
Training material, the soil of sterilizing, negative control, positive control.
Specific embodiment
In order to make content of the present invention easily facilitate understanding, With reference to embodiment to of the present invention
Technical solution is described further.
Test method as used in the following examples is conventional method unless otherwise specified.
Test material as used in the following examples, reagent etc., unless otherwise specified, commercially obtain.
The design of 1 molecular detection primer of embodiment and the foundation of agaricus bisporus brown rot germ special molecular detection method
1. the extraction of agaricus bisporus brown rot germ genomic DNA:
The genomic DNA of 12 plants of agaricus bisporus brown rot germs of this laboratory preservation is extracted using CTAB method, it is specific to walk
It is rapid as follows:
(1) it takes 0.1 g hypha powder in 1.5 mL centrifuge tubes, 900 μ L2%CTAB extracting solutions is added, are shaken using oscillator
Mixing is swung, 60 DEG C of water-bath 60min, under room temperature, 12000r/min are centrifuged 15 min；
(2) 700 μ L of supernatant is taken, isometric phenol, chloroform, isoamyl alcohol mixed liquor (each volume ratio is 25:24:1), temperature are added
And shake, under room temperature, 8000 r/min are centrifuged 10min；
(3) 500 μ L of supernatant is taken, isometric chloroform is added and extracts again once, under room temperature, 8000 r/min centrifugation
10min；
(4) 350 μ L of supernatant is taken, 1/10 volume, 3 mol/L NaAc and 2 times of volume dehydrated alcohols are added, -20 DEG C heavy
Form sediment 60 min, and under the conditions of 4 DEG C, 8000 r/min are centrifuged 5 min；
(5) liquid is discarded supernatant, 700 μ L volumetric concentrations of addition are 70% ice ethyl alcohol, jog 10sec, under the conditions of 4 DEG C, 8000
R/min is centrifuged 10sec, dries, and 50 μ L TE buffers is added, -20 DEG C save backup.
2. agaricus bisporus brown rot germ ITS sequence measures:
With fungi ribosomes internal gene transcribed spacers (rDNA-ITS) universal primer TS1:5'-
TCCGTAGGGAACCTGCGG-3' and ITS4:5'-TCCTCCGCTTATTGATATGC-3' is that primer pair extraction agaricus bisporus is brown
The DNA of maize ear rot bacterium carries out PCR amplification, amplification reaction system and response procedures are as follows: 25 μ L of PCR reaction system includes 2.5 μ L
10 × PCR buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L
(Dalian Takara treasured bioengineering Co., Ltd), each 0.5 μ L of the TIS1 and ITS4 of 10 μm of ol/L, 1 μ L of DNA profiling add
ddH2O is to total volume up to 25 μ L；PCR reaction condition are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 1 min, 55 DEG C of annealing 45sec,
72 DEG C of 1 min of extension, totally 35 recycle；72 DEG C of extension 10min；Gained PCR product send Dalian treasured bioengineering Co., Ltd to survey
Sequence.
3. the design of agaricus bisporus brown rot germ special molecular detection primer:
Become according to agaricus bisporus brown rot germ ribosomes the Internal Transcribed Spacer (rDNA-ITS) sequence in fungi inter-species height
Different and kind internal stability, the ITS sequence of 12 plants of agaricus bisporus brown rot germs obtained sequencing with Clustal X software with
In GenBankMycogoneCategory ITS sequence not of the same race, agaricus bisporus brown patch germ ITS sequence, agaricus bisporus Bacteria erwinia
ITS sequence carries out homology analysis and difference site is compared, with Primer Primer5 software design to agaricus bisporus brown rot
Germ has one couple of PCR primers (Sheng Gong bioengineering Co., Ltd synthesizes by Shanghai) of specific amplification effect, i.e., special point
The sequence of sub- detection primer are as follows:
Upstream primer MSF:5 '-CCGGGGACCTAAACTCTTCTG-3 '；
Downstream primer MSR:5 '-AAAGTTGGGGTTTTACGGCG-3 '.
4. the foundation of agaricus bisporus brown rot germ rapid molecular detection method:
(1) DNA is extracted from agaricus bisporus brown rot germ or agaricus bisporus fructification or cultivation of agaricus bisporus soil:
1. extracting strains tested genomic DNA using CTAB method for when detecting pathogen pure culture；
2. when for detecting agaricus bisporus fructification with the presence or absence of agaricus bisporus brown rot germ, being extracted and being supplied using CTAB method
Try strain gene group DNA；
3. when for detecting in cultivating soil with the presence or absence of wet bubble bacterium, using soil DNA rapidly extracting kit
It extracts.
(2) PCR amplification: 25 μ L of PCR reaction system is carried out by template of the DNA of extraction, includes 2.5 10 × PCR of μ L
Buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L, 10 μm of ol/L's
Each 0.5 μ L of MSF and MSR, 1 μ L of DNA profiling, adds ddH2O is to total volume up to 25 μ L；PCR reaction condition are as follows: 94 DEG C of initial denaturations
5min；94 DEG C of denaturation 45sec, 55 DEG C of annealing 45sec, 72 DEG C of extension 1min, totally 35 recycle；72 DEG C of extension 10min；
(3) resulting PCR product is walked on 1.2% Ago-Gel with the electrophoretic analysis of 0.5 × tbe buffer liquid, voltage is
4-5V/cm；Testing result is determined according to the size of amplified production, if energy specific amplification goes out the product of 397bp, can determine that
There are agaricus bisporus brown rot germs in the agaricus bisporus fructification or cultivating soil, otherwise the agaricus bisporus fructification
Or agaricus bisporus brown rot germ is not present in cultivating soil.
2 agaricus bisporus brown rot germ specific amplification of embodiment
1. extracting 2 plants of agaricus bisporus brown rot germs, agaricus bisporus brown patch germ, agaricus bisporus soft rot using CTAB method
Bacterium, agaricus bisporus wilting germ and other Different Crop pathogens (predominantly soil-borne pathogen, including Rhizoctonia solani Kahn, perfume (or spice)
Any of several broadleaf plants anthrax bacteria, Didymella bryoniae, stem rot of sweet potato bacterium) genomic DNA.
2. for the DNA for trying bacterium be that template carries out PCR amplification: 25 μ L of PCR reaction system to extract, include 2.5 μ L 10 ×
PCR buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L, 10 μ
Each 0.5 μ L of the MSF and MSR of mol/L, 1 μ L of DNA profiling, adds ddH2O is to total volume up to 25 μ L；PCR reaction condition are as follows: 94 DEG C pre-
It is denaturalized 5min；94 DEG C of denaturation 45sec, 55 DEG C of annealing 45sec, 72 DEG C of extension 1min, totally 35 recycle；72 DEG C of extension 10min；Electricity
Swimming detection amplified production.
3. specific amplification result
As shown in Figure 1,2 plants of wet bubble bacterium can go out the band of 397bp with specific amplification, and agaricus bisporus brown spot
Bacterium, agaricus bisporus Bacteria erwinia, agaricus bisporus wilting germ and for trying other crop pathogens and negative control without amplification item
Band shows that molecular detection primer of the invention can distinguish agaricus bisporus brown rot germ and other crop pathogens, tool
There is very strong specificity, detection method of the invention can be used for the specific amplification of agaricus bisporus brown rot germ.
The sensitivity of the primer pair agaricus bisporus brown rot germ of the present invention of embodiment 3 detects
1. extracting the genomic DNA of agaricus bisporus germ using CTAB method；
2. by the genomic DNA of the agaricus bisporus germ of extraction, after spectrophotometric determination concentration, with sterile ultrapure water
Dilution, is configured to series of concentrations, spare；
It include 2.5 3. carrying out standard PCR amplification: 25 μ L of PCR reaction system as template at series of concentrations DNA using preparation
μ 10 × PCR of L buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq of 5U/ μ L
Enzyme, each 0.5 μ L of the MSF and MSR of 10 μm of ol/L, 1 μ L of DNA profiling add ddH2O is to total volume up to 25 μ L；PCR reaction condition are as follows:
94 DEG C of initial denaturation 5min；94 DEG C of denaturation 45sec, 55 DEG C of annealing 45sec, 72 DEG C of extension 1min, totally 35 recycle；72 DEG C of extensions
10min；Electrophoresis detection amplified production.
4. carrying out nested PCR amplification as template at series of concentrations DNA using preparation:
(1) first round PCR is expanded: with fungi ribosomes internal gene transcribed spacers (rDNA-ITS) universal primer TS1:
5'-TCCGTAGGGAACCTGCGG-3' and ITS4:5'-TCCTCCGCTTATTG ATATGC-3' be outer primer to preparation at
Series of concentrations DNA carries out first round PCR amplification, amplification reaction system and response procedures are as follows: 25 μ L of PCR reaction system includes
2.5 μ 10 × PCR of L buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is 5U/ μ L's
Taq enzyme (Dalian Takara treasured bioengineering Co., Ltd), each 0.5 μ L of the TIS1 and ITS4 of 10 μm of ol/L, 1 μ L of DNA profiling,
Add ddH2O is to total volume up to 25 μ L；PCR reaction condition are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of 1 min of denaturation, 55 DEG C of annealing
45sec, 72 DEG C of 1 min of extension, totally 35 recycle；72 DEG C of extension 10min；
(2) second wheel PCR amplifications: using the product of first round PCR amplification as template, second is carried out by primer of MSF/MSR
PCR amplification is taken turns, 25 μ L of PCR reaction system includes 2.5 μ 10 × PCR of L buffer, and 2.0 μ L concentration are the dNTP of 2.5mmol/L
Mixture, 0.15 μ L concentration are the Taq enzyme of 5U/ μ L, and each 0.5 μ L of the MSF and MSR of 10 μm of ol/L, 1 μ L of DNA profiling add ddH2O
To total volume up to 25 μ L；PCR reaction condition are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of denaturation 45sec, 55 DEG C of annealing 45sec, 72 DEG C
Extend 1min, totally 35 circulations；72 DEG C of extension 10min；Electrophoresis detection amplified production.
5. testing result
As shown in Fig. 2, when carrying out Standard PCR as primer using primer MSF/MSR of the present invention, in 25 μ L reaction systems,
The agaricus bisporus brown rot germ DNA of 10pg can obtain view strip band, and detection sensitivity can reach 10pg(Fig. 2-A)；And into
One step is with the universal primer TS1:5'-TCCGTAGGGAACCTGCGG- of fungi ribosomes internal gene transcribed spacers (rDNA-ITS)
3' and ITS4:5'-TCCTCCGCTTATTGATATGC-3' is that the product of external primer amplification is template, with primer MSF/ of the present invention
When MSR is that primer carries out the second wheel amplification, in 25 μ L reaction systems, the agaricus bisporus brown rot germ DNA of 1fg can be obtained can
Depending on band, detection sensitivity can reach 1fg (Fig. 2-B).
The detection of agaricus bisporus brown rot germ in the morbidity agaricus bisporus fructification of embodiment 4 and cultivation of agaricus bisporus soil
1. extracting agaricus bisporus fructification genomic DNA using CTAB method；It is mentioned using soil DNA rapidly extracting kit
Take soil genomic DNA to be measured.
It include 2.5 2. carrying out standard PCR amplification: 25 μ L of PCR reaction system as template at series of concentrations DNA using preparation
μ 10 × PCR of L buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq of 5U/ μ L
Enzyme, each 0.5 μ L of the MSF and MSR of 10 μm of ol/L, 1 μ L of DNA profiling add ddH2O is to total volume up to 25 μ L；PCR reaction condition are as follows:
94 DEG C of initial denaturation 5min；94 DEG C of denaturation 45sec, 55 DEG C of annealing 1min, 72 DEG C of extension 45sec, totally 35 recycle；72 DEG C of extensions
10min；Electrophoresis detection amplified production.
3. testing result
As shown in figure 3, natually morbid agaricus bisporus fructification, natural occurrence cultivation of agaricus bisporus soil, artificial infection
The agaricus bisporus fructification of morbidity, artificial infection morbidity cultivation of agaricus bisporus soil can produce 397bp or so in positive control
View strip band, and healthy agaricus bisporus fructification, the culture material of agaricus bisporus secondary fermentation, the soil of sterilizing, negative control
Occur without any band, shows that primer of the present invention and detection method can also be used in field agaricus bisporus brown rot morbidity fructification
And the detection of cultivating soil.
The foregoing is merely presently preferred embodiments of the present invention, all equivalent changes done according to scope of the present invention patent with
Modification, is all covered by the present invention.
Sequence table
<110>Inst. of Plant Protection, fujian Academy of Agricultural Science
<120>a kind of agaricus bisporus brown rot germ molecular detection primer and rapid detection method
<160>4
<170>PatentIn version 3.5
<210>1
<211>18
<212>DNA
<213>Artificial Sequence
<400>1
tccgtagggaacctgcgg 18
<210>2
<211>20
<212>DNA
<213>Artificial Sequence
<400>2
tcctccgcttattgatatgc 20
<210>3
<211> 21
<212>DNA
<213>Artificial Sequence
<400>3
ccggggacctaaactcttctg 21
<210>4
<211>20
<212>DNA
<213>Artificial Sequence
<400>4
aaagttggggttttacggcg 20
Claims (3)
1. a kind of agaricus bisporus brown rot germ molecular detection primer, it is characterised in that: the nucleotide sequence of primer are as follows:
Upstream primer MSF:5 '-CCGGGGACCTAAACTCTTCTG-3 '
Downstream primer MSR:5 '-AAAGTTGGGGTTTTACGGCG-3 '.
2. a kind of rapid detection method of agaricus bisporus brown rot germ, it is characterised in that: the following steps are included:
(1) DNA is extracted in the soil from the agaricus bisporus of infection brown rot germ or for cultivation of agaricus bisporus earthing；
(2) using the DNA extracted in the agaricus bisporus from infection brown rot germ or the soil for cultivation of agaricus bisporus earthing as mould
Plate carries out PCR amplification: 25 μ L of PCR reaction system, includes 2.5 μ 10 × PCR of L buffer, and 2.0 μ L concentration are 2.5mmol/L's
DNTP Mixture, 0.15 μ L concentration are the Taq enzyme of 5U/ μ L, 10 μm of ol/L primer MSF described in claim 1 and primer MSR
Each 0.5 μ L, 1 μ L of DNA profiling, adds ddH2O is to total volume up to 25 μ L；PCR reaction condition are as follows: 94 DEG C of initial denaturation 5min；94 DEG C of changes
Property 45sec, 55 DEG C of annealing 45sec, 72 DEG C of extension 1min, totally 35 circulation；72 DEG C of extension 10min；
(3) resulting PCR product is walked on 1.2% Ago-Gel with the electrophoretic analysis of 0.5 × tbe buffer liquid, voltage 4-
5V/cm；Testing result is determined according to the size of amplified production, if energy specific amplification goes out the product of 397bp, determines double spores
Mushroom or for there are wet bubble bacterium in the soil of cultivation of agaricus bisporus earthing.
3. agaricus bisporus brown rot germ molecular detection primer as described in claim 1 is in Soil K+adsorption agaricus bisporus brown rot germ
In application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610155507.3A CN105734132B (en) | 2016-03-18 | 2016-03-18 | A kind of agaricus bisporus brown rot germ molecular detection primer and rapid detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610155507.3A CN105734132B (en) | 2016-03-18 | 2016-03-18 | A kind of agaricus bisporus brown rot germ molecular detection primer and rapid detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105734132A CN105734132A (en) | 2016-07-06 |
| CN105734132B true CN105734132B (en) | 2019-01-04 |
Family
ID=56250871
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610155507.3A Active CN105734132B (en) | 2016-03-18 | 2016-03-18 | A kind of agaricus bisporus brown rot germ molecular detection primer and rapid detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105734132B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241249B (en) * | 2019-07-18 | 2021-03-05 | 华中农业大学 | Primer and method for rapidly detecting pathogen of agaricus bisporus wart spongiform in covering soil |
| CN111500760B (en) * | 2020-05-09 | 2022-05-20 | 福建省农业科学院植物保护研究所 | Molecular detection primer for rapidly identifying verruca rubra and application |
| CN113881792B (en) * | 2021-11-23 | 2022-05-24 | 广西壮族自治区农业科学院 | PCR detection primer and kit for West nerviliae and application of PCR detection primer and kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063219A (en) * | 2015-08-20 | 2015-11-18 | 福建省农业科学院植物保护研究所 | Guava colletotrichum orbiculare specificity PCR detecting primer and detecting method of guava colletotrichum orbiculare |
| CN105256060A (en) * | 2015-11-24 | 2016-01-20 | 福建省农业科学院植物保护研究所 | PCR detection primer and method for anoectochilus roxburghii colletotrichum orbiculare |
-
2016
- 2016-03-18 CN CN201610155507.3A patent/CN105734132B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063219A (en) * | 2015-08-20 | 2015-11-18 | 福建省农业科学院植物保护研究所 | Guava colletotrichum orbiculare specificity PCR detecting primer and detecting method of guava colletotrichum orbiculare |
| CN105256060A (en) * | 2015-11-24 | 2016-01-20 | 福建省农业科学院植物保护研究所 | PCR detection primer and method for anoectochilus roxburghii colletotrichum orbiculare |
Non-Patent Citations (1)
| Title |
|---|
| rDNA- ITS 在植物病原真菌分子检测中的应用;刘春来等;《东北农业大学学报》;20070228;第38卷(第1期);第101-106页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105734132A (en) | 2016-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101974650B (en) | Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit | |
| CN105734132B (en) | A kind of agaricus bisporus brown rot germ molecular detection primer and rapid detection method | |
| CN105648106B (en) | A kind of Exserohilum turcicum molecular detection primer and rapid detection method | |
| CN105256060B (en) | A kind of roxburgh anoectochilus terminal bud anthrax bacteria PCR detection primer and its detection method | |
| Song et al. | First report of a new potato disease caused by Galactomyces candidum F12 in China | |
| CN104830698A (en) | Pokkah boeng disease pathogen separating and identifying method | |
| CN104846094A (en) | Quick detection method for a variety of pathogen molecules of strawberry root rot diseases and application of quick detection method | |
| CN105755122A (en) | Sweet potato fusarium wilt germ molecule detecting primer and rapid detection method | |
| CN106399529B (en) | A kind of Phyllosticta musarum molecular detection primer and detection method | |
| Paul et al. | Morpho-molecular, cultural and pathological characterization of Athelia rolfsii causing southern blight disease on common bean | |
| CN108546772A (en) | Exserohilum turcicum LAMP detection primer and its rapid detection method and application | |
| CN104651493A (en) | Method for quickly identifying point mutation of nucleotide of phytophthora capsici leonian PcORP1 gene and pesticide resistance of mutant phytophthora capsici leonian PcORP1 gene to oxathiapiprolin | |
| CN105648107B (en) | A kind of southern corn leaf blight molecular detection primer and rapid detection method | |
| Ma et al. | A new disease of strawberry, fruit rot, caused by Geotrichum candidum in China. | |
| CN105586431B (en) | A kind of asparagus stem wilt bacteria molecular detection primer and rapid detection method | |
| CN105063040B (en) | Phytophthora infestans germ PCR detection primers, kit and detection method | |
| CN106244720B (en) | A kind of anthracnose of peach bacterium molecule detection primer and detection method | |
| CN106244721B (en) | A kind of capsicum stain anthrax bacteria molecular detection primer and detection method | |
| Li et al. | Fusarium redolens causes black rot disease in Gastrodia elata grown in China | |
| CN103882125B (en) | A kind of real time fluorescence quantifying PCR method detecting Chinese cabbage verticillium pathogenic bacteria | |
| CN105779315A (en) | Preparation method of asparagus stem blight generic transformant mediated by agrobacterium | |
| CN106435005A (en) | Roxburgh anoectochilus terminal bud stalk rot pathogen LAMP (loop-mediated isothermal amplification) detection primer and detection method thereof | |
| CN106702014A (en) | Peanut focal spot bacterial molecular detection primer and rapid detection method thereof | |
| CN102424851B (en) | Molecular detection method for Edrus deodara (Roxb) Lobd blight and primers therefor | |
| CN105039560A (en) | Litchi colletotrichum LAMP primer as well as rapid detection method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |