CN106362166B - Function and application of tumor necrosis factor receptor-related pan-scaffold and signaling protein in treatment of fatty liver and type II diabetes - Google Patents

Abstract

The invention discloses a function and application of a TRUSS gene in fatty liver diabetes. The results of a high-fat diet-induced obese mouse model with a TRUSS gene knockout mouse and a wild type C57 mouse as experimental subjects show that the TRUSS gene knockout mouse has reduced body weight and a fasting blood glucose level lower than that of a control group WT mouse compared with the wild type C57 mouse. An intraperitoneal injection glucose tolerance experiment shows that the tolerance capability of the TRUSS gene knockout mouse to glucose is obviously enhanced. Pathological staining results of the weight of the liver and the ratio of the liver to the body weight of the mouse, lipid components and glycogen content and the like show that fatty liver pathological changes of a TRUSS-KO mouse on high-fat diet are obviously reduced, lipid accumulation is obviously reduced, and the degree of liver injury is obviously reduced. Therefore, the TRUSS can be used as a drug target for screening and treating fatty liver and/or type II diabetes, and the inhibitor can be used for preparing a drug for treating fatty liver and/or type II diabetes.

Description

Function and application of tumor necrosis factor receptor-related pan-scaffold and signaling protein in treatment of fatty liver and type II diabetes

Technical Field

The invention belongs to the field of functions and applications of genes, and particularly relates to an application of a Tumor necrosis factor receptor-associated pan-stent and a signal protein gene (TRUSS) as a drug target in screening drugs for preventing, relieving and/or treating fatty liver and/or type II diabetes.

Background

With the improvement of the living standard and the change of the living style of human beings, the incidence rate of diabetes mellitus is continuously rising and the characteristics of globalization and low age are presented. According to statistics, the number of diabetes patients is more than 3 hundred million people all over the world, wherein the type2diabetes mellitus (T2 DM) accounts for more than 90 percent, and the number of the diabetes patients is more than 4 hundred million by 2030. It is worth noting that the incidence of T2DM in the early stage is increased sharply in children, adolescents and young people at present, which means that the incidence of diabetes in the future is expanded, and the difficulty of prevention and treatment is greatly increased. Many drug targets have been discovered and applied to the field of diabetes treatment, but many conventional anti-T2 DM drugs have side effects such as hypoglycemia, cardiovascular events, weight gain, etc. which limit their use due to the problem of the target mechanism. In recent years, new antidiabetic drugs aiming at DPP-4, GLP-1R, SGLT2 and other targets show relatively low risk of side effects and good hypoglycemic effect, but the drugs still cannot fundamentally treat diabetes. Therefore, antidiabetic drugs with better therapeutic effect and higher patient compliance have been sought.

Non-alcoholic fatty liver disease (NAFLD) is a clinical pathological syndrome characterized by steatosis and fat storage in liver parenchymal cells in humans without excessive alcohol intake. Simple fatty liver is not static and if no measures are taken for its development, it can progress to non-alcoholic steatohepatitis (NASH), hepatic fibrosis, cirrhosis, and even liver cancer, with the proportion of cirrhosis or liver cancer being 5% -10% and 1% -2%, respectively. In addition, fatty liver can also damage the function of digestive system, reduce human immunity, weaken detoxification function, influence hormone metabolism, seriously influence the health and life quality of people and bring heavy burden to society. The pathogenesis of NAFLD is not completely clear, and an effective treatment means is not available at present, so that the prevention is mainly performed.

The prevalence of NAFLD is increasing year by year as the incidence of NAFLD has increased rapidly and is on a downward trend in recent years, with increasing levels of living and changing lifestyle, T2DM has been on the rise in prevalence of NAFLD, results of studies have shown that NAFLD prevalence can reach as high as 80% ^[1] in the diabetic population, liver fat deposition may be the major factor affecting the development of T2DM in some patients, on the other hand, if T2DM controls poorly or fully, not only promotes fatty liver formation but also aggravates liver damage, even formation of nonalcoholic steatohepatitis, hepatic fibrosis, cirrhosis and hepatocellular carcinoma ^[3], patients with T2DM combined NAFLD have less ability to control blood glucose than patients with T2DM not combined NAFLD ^[4]. T2DM combined NAFLD will greatly increase the risk of mortality due to liver cirrhosis, hepatocellular carcinoma and cardiovascular complications, although controlling hyperlipidemia in T2DM patients with NAFLD, NAFLD and NAFLD are still shown to be a significant clinical treatment challenge for patients with NAFLD, NAFLD-and NAFLD-related therapies are still shown to be a significant in the future, and a clinical trial for the development of NAFLD-resistant NAFLD-targeting NAFLD-specific NAFLD-associated medications-chemotherapeutic drug-for patients.

In addition, the TRUSS comprises five (P/S/A/T) x (Q/E) E or STRUSSE consensus sequences and TRAF-2 binding patterns, four of which are located at the N-terminal end of the TRUSS and one of which is located at the C-terminal end, and the TRUSS is found to regulate the degradation of the proto-Myc gene, and to play a certain role in the carcinogenesis ^[6], and further, the TRUSS can bind to the cell cycle of the TRUSS 2, and the pathological binding of the TRUSS to the cell cycle of the TRUSS 3875 leads to the pathological degradation of the gene under pathological conditions reported by the TRUSS 387 ^[7], although the pathological binding of the TRUSS to the fatty acid receptor related protein (TRUSS) is widely reported and is enriched in heart, liver and testis tissues.

Reference documents:

1.Fan JG,Farrell GC.Epidemiology of non-alcoholic fatty liver disease in china.J Hepatol.2009；50:204-210

2.Loria P,Lonardo A,Anania F.Liver and diabetes.A vicious circle.Hepatol Res.2013；43:51-64

3.Smith BW,Adams LA.Nonalcoholic fatty liver disease and diabetes mellitus:Pathogenesis and treatment.Nat Rev Endocrinol.2011；7:456-465

4.Williamson RM,Price JF,Glancy S,Perry E,Nee LD,Hayes PC,Frier BM,Van Look LA,Johnston GI,Reynolds RM,Strachan MW.Prevalence of and riskfactors for hepatic steatosis and nonalcoholic fatty liver disease in peoplewith type 2 diabetes:The edinburgh type 2 diabetes study.Diabetes Care.2011；34:1139-1144

5.Cusi K.Treatment of patients with type 2 diabetes and non-alcoholic fatty liver disease:Current approaches and futuredirections.Diabetologia.2016；59:1112-1120

6.Choi SH,Wright JB,Gerber SA,Cole MD.Myc protein is stabilized by suppression of a novel e3 ligase complex in cancer cells.Genes Dev.2010；24:1236-1241

7.Jamal A,Swarnalatha M,Sultana S,Joshi P,Panda SK,Kumar V.The g1 phase e3 ubiquitin ligase truss that gets deregulated in human cancers is anovel substrate of the s-phase e3 ubiquitin ligase skp2.Cell Cycle.2015；14:2688-2700

Disclosure of Invention

In order to solve the defects and shortcomings of the prior art, the invention aims to provide a correlation between the expression of the TRUSS gene and fatty liver and type II diabetes, provide a new application of the target gene TRUSS for treating fatty liver and type II diabetes, and further apply the TRUSS gene to the treatment of fatty liver and type II diabetes.

The purpose of the invention is realized by the following technical scheme:

According to the invention, a wild type C57 mouse and a TRUSS gene knockout mouse are taken as experimental objects, the function of the TRUSS gene is researched through a high fat diet induced obesity mouse model (DIO), and the result shows that compared with the wild type WT mouse, the weight of the TRUSS gene knockout mouse is obviously lower than that of a WT mouse fed with the same feed, the appearance is a lighter obesity state, and the fasting blood glucose level of the TRUSS gene knockout mouse is also lower than that of a control group WT mouse. Further, an intraperitoneal glucose tolerance experiment shows that the tolerance of the TRUSS gene knockout mouse to glucose is obviously enhanced. Pathological staining results of the liver weight, the liver/body weight ratio, the lipid components and the glycogen content of the mice and the like show that fatty liver lesions of the TRUSS-KO mice in the HFD group (High fat diet) are obviously reduced, the lipid accumulation is obviously reduced, and the liver injury degree is obviously reduced. The result shows that the TRUSS gene knockout can delay the occurrence of fatty liver and type II diabetes, and the TRUSS gene can promote the occurrence of fatty liver and type II diabetes.

Therefore, the TRUSS gene can be used as a drug target to construct an in vitro cell model or an animal model of the TRUSS gene overexpression, and is used for screening drugs for preventing, relieving and/or treating fatty liver and/or type II diabetes; the TRUSS gene can also be used as a target gene in gene therapy, a medicament and/or a biological reagent for preventing, relieving and/or treating fatty liver and/or type II diabetes is designed and prepared, and the purpose of preventing, relieving and/or treating fatty liver and/or type II diabetes is achieved through a gene engineering technology. For example, the TRUSS is used as a target gene, double-stranded siRNA capable of interfering the expression of the TRUSS is designed, the siRNA is synthesized by a chemical method, and is injected into a human body to silence the TRUSS gene by an RNA interference method so as to treat fatty liver and/or type II diabetes; the mutant of the TRUSS can be designed and constructed, enters cells after being injected, and competes for the action substrate of the TRUSS prototype, so that the function of the TRUSS is inhibited, and the treatment purpose is achieved; in addition, a small molecule compound inhibitor can be designed by taking the TRUSS as a target spot, and a molecule which can specifically inhibit the TRUSS is discovered by screening an in-vitro cell model or an animal model with the TRUSS gene overexpressed, so that a novel therapeutic molecule is provided for treating fatty liver and/or type II diabetes.

Aiming at the functions of the TRUSS, the application of the TRUSS serving as a drug target in screening drugs for protecting the liver and the glycometabolism is provided.

Aiming at the functions of the TRUSS, the application of the TRUSS serving as a drug target in screening drugs for preventing, relieving and/or treating fatty liver and/or type II diabetes is provided.

Aiming at the functions of the TRUSS, the application of the TRUSS inhibitor in preparing the medicine for preventing, relieving and/or treating fatty liver and/or type II diabetes is provided.

A medicament for the prevention, alleviation and/or treatment of fatty liver and/or type II diabetes comprising an inhibitor of TRUSS.

the inhibitor of the TRUSS is preferably siRNA of the TRUSS gene, RNA interference vector of the TRUSS gene, antibody of the TRUSS and other inhibitors capable of inhibiting the expression of the TRUSS.

Compared with the prior art, the invention has the following advantages and effects:

(1) The invention discovers a new function of TRUSS, namely the TRUSS has the function of deteriorating fatty liver and type II diabetes.

(2) Based on the function of TRUSS in exacerbating fatty liver and type II diabetes, the TRUSS provides a target for developing a medicament for preventing, relieving and/or treating fatty liver and/or type II diabetes.

(3) The TRUSS inhibitor can be used for preparing medicines for preventing, relieving and/or treating fatty liver and/or type II diabetes.

Drawings

FIG. 1 is a schematic diagram of a strategy for constructing a TRUSS liver-specific knockout mouse.

FIG. 2 is a graph of the body weight, fasting plasma glucose results of WT and TRUSS-KO mice;

a is the body weight results of the mice, B is the statistics of fasting blood glucose levels (.: p < 0.05vs WT NC group, #: p < 0.05vs WT HFD group).

FIG. 3 is a graph of the results of glucose tolerance by intraperitoneal injection in WT and TRUSS-KO mice;

A is a statistical graph of blood glucose levels of mice at different time points after intraperitoneal injection of glucose, and B is a comparative graph of the area under the glucose tolerance curve (AUC) of each group of mice (: p < 0.05vs WT NC group, #: p < 0.05vs WTHFD group).

FIG. 4 is a histogram of the liver weight, liver weight ratio of mice to mice per se for TRUSS-KO and WT mice (#: p < 0.05vs WT HFD group).

FIG. 5 is a graph of oil red O and glycogen staining of WT and TRUSS-KO and WT mice.

Detailed Description

The features and advantages of the present invention will be further understood from the following detailed description taken in conjunction with the accompanying drawings. The examples provided are merely illustrative of the method of the present invention and do not limit the remainder of the disclosure in any way.

Experimental animals and breeding:

Species, sex, week age and source of experimental animals: c57BL/6(WT) mice and TRUSS liver specific knockout (TRUSS-KO) mice, male, 8 weeks old. The C57BL/6 mouse is purchased from Beijing Huafukang biotech GmbH, a TRUSS liver specificity gene knockout mouse (TRUSS-KO) is obtained by hybridizing a TRUSS-floxed mouse and a Cre transgenic mouse Albumin-Cre (purchased from The Jackson Laboratory, cat number 003574) which is controlled by a protein promoter and specifically expresses liver cells, and The construction strategy is shown in figure 1.

Construction of liver-specific TRUSS knockout mice:

According to gene information, CRISPR Design (website: http:// CRISPR. mit. edu /) is utilized to Design a CRISPR targeting site in each of the introns 3 and 4. The target sequences are respectively

TRUSS-sRNA1：ggCTGAGTGTCTCTACGCAACTA AGG

TRUSS-sRNA2：ggCTTGACCCCGCCTCCGTTTTCT TGG

A Donor plasmid for homologous repair (Donor Vector) was also designed, which included flanking homology arms, the middle exon 4, and two loxp sequences in the same orientation.

Firstly, constructing a targeting vector: two primers corresponding to sgRNA1 and sgRNA2 were fused into double-stranded DNA, respectively, and then ligated into a pUC57-sgRNA vector treated with restriction enzyme BsaI using T4DNA ligase. The upstream of the vector is provided with a T7 promoter which can be used for subsequent in vitro transcription experiments.

Secondly, construction of a conditional knockout backbone vector pBluescript SK (+) -2 loxp:

respectively synthesizing 4 oligomeric single-stranded nucleotide sequences:

loxp1-F：

AGCTTGACGTCATAACTTCGTATAGCATACATTATAGCAATTTATACCGGTGAT，

loxp1-R：

ATCACCGGTATAAATTGCTATAATGTATGCTATACGAAGTTATGACGTCA；

loxp2-F：

GATCCCTTAAGATAACTTCGTATAGCATACATTATAGCAATTTATACGCGTA，

loxp2-R：

CTAGTACGCGTATAAATTGCTATAATGTATGCTATACGAAGTTATCTTAAGG；

the oligonucleotide sequences anneal to form two strands, loxp1 and loxp 2. The pBluescript IISK (+) vector is double-cut by HindIII (NEB, R0104L) and EcoRV (NEB, R0195L) and then connected into a loxp1 annealing double strand, and then the vector with correct sequence is double-cut by BamHI (NEB, R01 0136L) and SpeI (NEB, R0133L) and connected into a loxp2 annealing double strand, so that the conditional knockout framework vector is obtained and named as pBluescript SK (+) -2 loxp.

Construction of Donor vectors (Donor Vector): the following primers (Table 1) were designed to amplify the left and right homology arms (LA and RA) and the middle exon part (M) of the donor vector according to the primer design principle. The amplified product was digested with restriction enzymes shown in Table 1 to obtain 3 fragments, which were ligated to the conditional knock-out backbone Vector pBluescriptSK (+) -2loxp, respectively, to obtain Donor Vector.

TABLE 1 primer sequences and corresponding cleavage sites required for construction of donor vectors

Primer name	Primer sequences	Cleavage site
			TRUSS LA-F	CCGCTCGAGGCTCAGACTCCAGTTGAACATTTA	XhoI
TRUSS LA-R	ATGGACGTCCTAAGGAGCATCTCTGAAGAATCT	AatII
			TRUSS M-F	TCTACCGGTTTGCGTAGAGACACTCAGGGAT	AgeI
TRUSS M-R	CGGGATCCAAACGGAGGCGGGGTCAA	BamHI
			TRUSS RA-F	CGACGCGTTCTTGGGAGGTTTTTATGCTG	MluI
TRUSS RA-R	ATAAGAATGCGGCCGCGCCTGTCTGAGGAATGTGGT	NotI

Transcription of targeting vector comprises that two parts (Cas 9 protein which is responsible for cutting action and gRNA which guides Cas9 protein to a target site) contained in a CRIPR/Cas9 system are respectively transcribed, for Cas9 protein, an expression vector (pST1374-Cas9) is cut by enzyme with PmeI, a linear plasmid is recovered after purification as a transcription template, T7mMESSAGE mRNA Kit (AM1345, Ambion) is used for in vitro transcription, a capped mRNA product is obtained, the product is tailed by a Poly (A) Tailing Kit (Ambion), a mature mRNA product is obtained, for sgRNA, MESHORTPTI ^TM Kit (AM1354, Ambion company) is used for in vitro transcription, and the transcribed mRNA of Cas9 and sgRNA is purified by using mieasy RNT (Qiagen, 217084).

Preparation of TRUSS-floxed conditional knockout mouse

Injecting the mature mRNA product and donor plasmid into mouse fertilized egg, and transplanting to surrogate mother mouse for breeding. The resulting mice were identified. And (3) taking out toe or tail tissues of the mice one week after the mice are born, extracting genomes, and screening positive initial mice by a PCR method. Randomly selecting one of the mice which are confirmed to have homologous recombination as F0 generation for subsequent propagation, and finally obtaining the TRUSS-floxed homozygous mouse.

Preparation of liver specificity TRUSS gene knockout mouse

Mating the TRUSS-floxed mouse with a liver specificity Albumin-Cre transgenic mouse, screening to obtain a TRUSS ^{floxed/floxed}/Albumin-Cre mouse, injecting Tamoxifen into the abdominal cavity after the mouse grows to about 6 weeks, inducing the expression of Cre enzyme, specifically identifying two equidirectional loxps by the Cre enzyme, cutting off a sequence between the two loxps and one loxp, and finally obtaining a liver cell specificity TRUSS gene knockout mouse.

the experimental animal feed formula comprises: high Fat Diet (HFD) (purchased from beijing waukang biotechnology limited, cat # D12942): percentage of heat: 20 percent of protein; 20% of carbohydrate; fat 60%, and the total caloric mass ratio is 5.24 kcal/g. Low fat feed (NC) (available from beijing huafukang biotechnology limited, cat # D12450B): percentage of heat: 20 percent of protein; 70% of carbohydrate; 10 percent of fat and 3.85kcal/g of total caloric mass ratio.

Raising environment and conditions: in the SPF-level experimental animal center, the room temperature is 22-24 ℃, the humidity is 40-70%, the illumination time is 12h alternately in light and dark, and the animals can drink water freely for ingestion.

Example 1 mouse model for fatty liver and type II Diabetes (DIO)

(1) grouping experimental animals: 8-week-old, male, WT and TRUSS-KO mice were selected and fed with two special diets, D12942 High Fat Diet (HFD) and D12450B low fat diet (Normal chow, NC), respectively, i.e., 4 groups of WT NC, KO NC, WT HFD and KO HFD.

(2) The model is induced by high-fat feed to operate the process:

WT and KO mice are adopted to establish a DIO model for phenotype correlation analysis, and the function of the TRUSS gene on fatty liver and type II diabetes is determined. 8-week-old, male, WT and TRUSS-KO mice were selected and fed with two special diets, D12942 High Fat Diet (HFD) and D12450B low fat diet (Normal chow, NC), respectively, i.e., 4 groups of WT NC, KO NC, WT HFD and KO HFD. Mice food intake was recorded in detail weekly, mice fasting body weight and fasting blood glucose were measured 1 time every 2 weeks. On week 10 of the experiment, an intraperitoneal glucose injection experiment (IPGTT) was performed to evaluate the glucose tolerance of the mouse body. The material was obtained at the end of week 12, and the mouse liver was weighed, and a portion was fixed in formalin or embedded in o.c.t frozen section embedding Medium (Tissue Freezing Medium) for pathological analysis.

[ example 2] measurement of mouse body weight and blood sugar level

(1) Measurement of fasting body weight and food intake of mice

1) And (4) detecting the body weight.

fasting: mice to be tested were fasted (without water deprivation) at 8:00 a.m., and experimental procedures were started at 2:00 a.m.

Weighing: weigh at weeks 0, 2, 4, 6, 8, 10 and 12 respectively, place a plastic keg on a dynamic electronic balance, grab the mouse, place it in the weighing keg, measure the body weight log data. And (3) detecting the feed amount: after the weighing operation was completed, the mice were fed with feed and the amount of feed in the mice was recorded on a dynamic electronic balance.

(2) Fasting blood glucose level detection assay

All mice to be tested were fasted (without water deprivation) from 8:00 am to 2:00 pm, i.e. the experimental procedure was started 6 hours after fasting.

Preparing a glucometer: checking a battery of a glucometer (Onedouch, Jones, USA), pressing a right switch, correctly putting the test paper into a left slot, displaying a number of a corresponding code of the test paper strip on a screen, and then displaying a blood dripping pattern to prompt the glucometer to enter a state to be tested.

Fixing the mouse: grasping the rat tail with the right hand, holding a towel with the left hand, folding the towel in half, pinching the folded part of the towel with the thumb and the forefinger, wrapping the head and the body of the rat into the towel in the palm, and fixing the root of the rat tail with the thumb and the forefinger.

Thirdly, tail shearing: the ophthalmic scissors can quickly cut off the rat tail at a position 0.1-0.2cm away from the tail end of the rat tail until blood drops automatically flow out.

Fourthly, detecting the blood sugar: the edge of the glucometer test paper is touched with a blood drop, the blood is immersed in the test paper, and the glucometer counts down for 5 seconds to display the reading.

The severity of type II diabetes injury was evaluated by the weight and blood glucose levels, and the results of weight and blood glucose changes are shown in FIG. 2. WT mice fed with HFD diet had a significantly higher weight than their NC diet group starting at week 4, and TRUSS-KO mice fed with HFD diet and NC diet for 12 weeks had a significantly lower weight than WT mice fed with HFD diet starting at week 4 and continued for week 12 (see FIG. 2A); fasting blood glucose measurements found that fasting blood glucose levels at weeks 6, 8, 10, and 12 in the HFD group were significantly higher than those in the corresponding NC control group, and fasting blood glucose levels in the TRUSS-KO mice in the HFD group were significantly lower than those in the WT group (see fig. 2B). The result shows that the knockout of the TRUSS gene obviously influences the glucose metabolism steady state of a mouse in an HFD feeding state, the TRUSS gene can obviously reduce the glucose metabolism capability of the mouse, and the TRUSS gene can promote the generation of type II diabetes caused by high fat induction.

[ example 3] glucose tolerance test (IPGTT)

On week 10 of the experiment, an intraperitoneal glucose (IPGTT) experiment was performed to evaluate the body's ability to tolerate sugar in mice.

(1) Before measuring blood glucose, fasting body weight of the mice was measured, and the injection volume of glucose was calculated from 10. mu.L/g.

(2) The fasting blood sugar is firstly detected before glucose injection, namely 0 minute, and the glucose liquid is quickly injected into the abdominal cavity after detection.

(3) The operation method of the intraperitoneal injection comprises the following steps: firstly, fixing a mouse; the mouse is grabbed, the tail of the mouse is grabbed by the little finger and the ring finger of the left hand, the neck of the mouse is grabbed by the other three fingers, the head of the mouse is downward, and the abdomen of the mouse is fully exposed. Needle insertion positioning and injection: the syringe is held by the right hand when the needle is inserted from one side of the abdomen, the tip and the abdomen of the mouse form an included angle of 45 degrees, the needle is inserted and withdrawn, the needle head passes a small distance under the abdomen skin during injection, the needle head passes through the abdominal midline and then enters the abdomen at the other side of the abdomen, after the medicine is injected, the needle head is slowly pulled out, and the needle head is slightly rotated to prevent liquid leakage.

(4) And respectively measuring the blood sugar value of the mouse by cutting tails at 15 min, 30 min, 60 min and 120 min after the intraperitoneal injection, and recording the blood sugar value and the detection time.

The glucose handling capacity of the mice in each group was further evaluated by intraperitoneal glucose tolerance test (IPGTT), and at week 10 of the test, after injection of 1.0g/kg body weight of glucose, the blood glucose levels of WT mice and TRUSS-KO mice in the HFD group sharply increased to a peak at a time point of 15 minutes, slightly decreased in both groups as the time progressed to 60 minutes after injection, but remained at a level higher than the fasting blood glucose level (blood glucose at 0 minute), restored to the fasting blood glucose level at 2 hours, and the blood glucose level of TRUSS-KO mice in the HFD group remained at a level lower than that of WT mice from 0 minute to 2 hours (fig. 3A). Comparing the area under the blood glucose curve (AUC) of mice in each group, the AUC of WT mouse HFD group was found to be significantly higher than that of NC group, and the AUC of TRUSS-KO HFD group was significantly lower than that of WT HFD group (fig. 3B), indicating that TRUSS can inhibit the steady state of sugar metabolism. Example 4 measurement of liver gross appearance and lipid composition in liver tissue

(1) Terminal liver tissue sampling

1) Mice were weighed and then sacrificed by removing their necks quickly. The mice were fixed supine and their chest and abdomen hair were moistened with distilled water.

2) Clamping the skin at the center of the abdomen of the mouse by using a pair of forceps, cutting the skin to the lower part of the xiphoid process along the center of the abdomen, cutting the skin to the tail end, exposing subcutaneous fascia, muscles and the like layer by layer, opening the abdominal cavity and fully exposing all visceral organs.

3) The liver of the mouse was quickly found and removed, the removed liver specimen was placed on sterile gauze, the residual blood on the surface of the liver was wiped off, the liver was placed in a sterile petri dish and quickly weighed.

4) Paraffin specimen: a part of the liver was excised and fixed in 10% neutral formalin. Freezing the specimen: a part of liver was cut, embedded in a tin foil mold with OCT, and frozen and fixed on dry ice.

2. Liver tissue processing and pathological staining related experiments

1) Liver dehydration, transparency, and waxing

A portion of the liver lobe tissue fixed in 10% neutral formalin was excised into a labeled embedding frame and rinsed with running water at low flow rate for over 30 minutes. The following procedures are set on the machine according to the following flow: 75% alcohol (45 minutes) → 85% alcohol (45 minutes) → 95% alcohol (45 minutes) → anhydrous alcohol (1 hour); ② transparent: xylene (1 hour) → xylene (1 hour); ③ soaking in wax (65 ℃): paraffin (1 hour) → paraffin (1 hour). After the tissue is washed, the embedding frame containing the tissue is loaded into a basket of the machine, and the program is started. After the above procedures are completed, the tissue embedding frame is taken out and sent to a pathology room for embedding tissues, and meanwhile, the machine is cleaned for standby.

2) Liver tissue section

sections were cut using a microtome (slice thickness 5 μm).

3) Glycogen staining of liver tissue

The paraffin section of the liver tissue was put into a 65 ℃ oven (30 minutes) → xylene (5 minutes × 3 times) → 100% alcohol (1 minute) → 90% alcohol (1 minute) → 70% alcohol (1 minute) → distilled water washing → periodic acid (10 minutes) → tap water washing off floating color on the section → snowflake reagent staining (10-15 minutes) → tap water washing several times → hematoxylin (1 minute) → distilled water washing off floating color on the section → 70% alcohol one time → 90% alcohol one time → 100% alcohol (30 seconds × 3 times) → xylene (2 minutes × 3 times) → sealing the section when the xylene was not dried, and photographed.

4) Liver tissue oil red O staining

Frozen liver tissue sections were air dried in a fume hood for 30 minutes and fixed in 4% paraformaldehyde for 10 minutes. The tissue was washed in double distilled water for a brief 10 minutes to remove paraformaldehyde from the tissue.

② treatment with 60% isopropanol for 1 minute.

③ staining with oil red O (Sigma, cat # O0625, concentration 0.5 g/100 mL 100% isopropanol) for 30 minutes.

And fourthly, rinsing the fabric for 1 minute by 3 times by using 60 percent isopropanol until the background is clean.

Fifthly, the cell nucleus is lightly stained by Mayer's hematoxylin staining solution (5 drops).

Sixthly, rinsing with water, promoting blue in dilute lithium carbonate water solution, fully washing with water, and washing with water until cell nucleus is blue.

Seventhly, sealing the slices with glycerol gelatin and taking a picture.

The results of the liver weight and the liver weight ratio are shown in FIG. 4, and both the liver weight and the ratio of the liver weight to the body weight of the mouse in the TRUSS-KO mice in the HFD group are lower than those in the WT mice in the HFD group (see FIG. 4). Further, by tissue sectioning, oil O and glycogen staining was performed, and the liver tissues of each group of mice were observed under a microscope to undergo significant pathological changes under the high-fat diet feeding condition. By liver oil red O staining, fat deposition was observed in liver tissues of both WT mice and TRUSS-KO mice under HFD feeding conditions, and it was observed that hepatocytes of NC group mice were steatosis, vacuolated and fused into a sheet, and liver cell morphology had almost completely destroyed, whereas hepatocyte morphology of TRUSS-KO group mice was slightly changed (as in fig. 5). By examining the extent of liver damage by liver glycogen staining, it was found that liver glycogen content was significantly increased in the TRUSS-KO mice in the HFD group as compared with that in the WT group (see FIG. 5), indicating that liver damage was less in the TRUSS-KO mice in the HFD group than in the WT group. These results indicate that fatty liver was significantly suppressed in the TRUSS knockout mice.

The TRUSS gene is shown to have obvious effect on promoting the generation of type II diabetes and fatty liver. The result of the invention shows that the TRUSS gene has the function of promoting the disease deterioration in fatty liver and type II diabetes disease models.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> Wuhan university

<120> efficacy of tumor necrosis factor receptor-associated pan-scaffolds and signaling proteins in the treatment of fatty liver and type II diabetes

Energy and application

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 26

<212> DNA

<213> TRUSS-sRNA1

<400> 1

ggctgagtgt ctctacgcaa ctaagg 26

<210> 2

<211> 27

<212> DNA

<213> TRUSS-sRNA2

<400> 2

ggcttgaccc cgcctccgtt ttcttgg 27

<210> 3

<211> 54

<212> DNA

<213> loxp1-F

<400> 3

agcttgacgt cataacttcg tatagcatac attatagcaa tttataccgg tgat 54

<210> 4

<211> 50

<212> DNA

<213> loxp1-R

<400> 4

atcaccggta taaattgcta taatgtatgc tatacgaagt tatgacgtca 50

<210> 5

<211> 52

<212> DNA

<213> loxp2-F

<400> 5

gatcccttaa gataacttcg tatagcatac attatagcaa tttatacgcg ta 52

<210> 6

<211> 52

<212> DNA

<213> loxp2-R

<400> 6

ctagtacgcg tataaattgc tataatgtat gctatacgaa gttatcttaa gg 52

<210> 7

<211> 33

<212> DNA

<213> TRUSS LA-F

<400> 7

ccgctcgagg ctcagactcc agttgaacat tta 33

<210> 8

<211> 33

<212> DNA

<213> TRUSS LA-R

<400> 8

atggacgtcc taaggagcat ctctgaagaa tct 33

<210> 9

<211> 31

<212> DNA

<213> TRUSS M-F

<400> 9

tctaccggtt tgcgtagaga cactcaggga t 31

<210> 10

<211> 26

<212> DNA

<213> TRUSS M-R

<400> 10

cgggatccaa acggaggcgg ggtcaa 26

<210> 11

<211> 29

<212> DNA

<213> TRUSS RA-F

<400> 11

cgacgcgttc ttgggaggtt tttatgctg 29

<210> 12

<211> 36

<212> DNA

<213> TRUSS RA-R

<400> 12

ataagaatgc ggccgcgcct gtctgaggaa tgtggt 36

Claims (1)

1. The application of the TRUSS gene as a drug target in screening drugs for preventing, relieving and/or treating fatty liver and type II diabetes is characterized in that: the drug is a drug for inhibiting the expression of the TRUSS gene; said use is non-diagnostic and non-therapeutic.