CN111184864B - Application of ALOX12 specific inhibitor in preparation of medicine for treating nonalcoholic fatty liver disease and/or type II diabetes - Google Patents

Abstract

The invention discloses an application of an ALOX12 specific inhibitor in preparation of a medicine for treating non-alcoholic fatty liver disease and/or type II diabetes. According to the scheme, a litter control Flox mouse and an ALOX12 liver specific gene knockout mouse are taken as experimental subjects, the functions of the ALOX12 gene are researched through a high-fat and high-cholesterol diet induced obesity mouse model, and the result shows that the ALOX12 can promote the occurrence of nonalcoholic fatty liver disease and type II diabetes. Therefore, ALOX12 can be used as a treatment target of nonalcoholic fatty liver disease and type II diabetes.

Description

Application of ALOX12 specific inhibitor in preparation of medicine for treating nonalcoholic fatty liver disease and/or type II diabetes

Technical Field

The invention belongs to the field of gene function and application, and particularly relates to application of an ALOX12 specific inhibitor in preparation of a medicine for treating non-alcoholic fatty liver disease and/or type II diabetes.

Background

Non-alcoholic fatty liver disease (NAFLD) is a very common chronic liver disease affecting about 30% of the adult population worldwide, placing a heavy burden on human health. NAFLD is one of the most common pathological conditions leading to end-stage liver disease with cardiovascular and metabolic complications, characterized by excessive liver fat accumulation, associated with Insulin Resistance (IR), and well-defined, with > 5% of hepatocytes with steatosis, or proton density fat fraction > 5.6% assessed by proton magnetic resonance spectroscopy (1H-MRS) or quantitative fat/water selective Magnetic Resonance Imaging (MRI), according to histological analysis. The disease spectrum includes isolated steatosis, nonalcoholic steatohepatitis (NASH), advanced fibrosis, cirrhosis and hepatocellular carcinoma, and exacerbates the incidence of liver transplantation and death. In addition, the adverse effects of non-alcoholic fatty liver disease are far more than these, closely related to metabolic syndrome, obesity, diabetes, cardiometabolic diseases and many other diseases. The lack of knowledge of NAFLD and the lack of reliable and feasible non-invasive assessment strategies has hindered the development of effective intervention at an early stage. To date, the most recommended approach to improving NAFLD is still to change lifestyle, which is difficult to maintain for a long time and effective approved drugs are still in development.

Lipoxygenase (ALOX) is an enzyme that catalyzes the production of bioactive metabolites from arachidonic acid, linoleic acid, fatty acids and other polyunsaturated fatty acids, which participate in inflammatory and immune reactions. Mammalian ALOX is divided into four subtypes, depending on the specific location of insertion of oxygen molecules into arachidonic acid: alox5, Alox8, ALOX12 and Alox15, wherein the ALOX12 can be divided into 12S-LOX and 12R-LOX. ALOX12 in this study was platelet type 12S-LOX. ALOX12 is highly expressed in platelets and is widely expressed in various cell types including hepatocytes. ALOX12 can catalyze arachidonic acid to generate 12-HPETE and 12-HETE, and thus can catalyze linoleic acid metabolism to generate octadecadienol (HODEs). The current research considers that the activation of ALOX12 is involved in the tumor promotion effect and the tumor inhibition effect, and ALOX12 becomes the hot spot of the anti-tumor research in recent years. In addition, ALOX12 has been studied to be involved in the pathogenesis of skin diseases, platelet coagulation, and other diseases.

Disclosure of Invention

In order to solve the defects and shortcomings of the prior art, the invention aims to provide the application of an ALOX12 specific inhibitor in preparing a medicament for treating nonalcoholic fatty liver disease and/or type II diabetes, namely aims to research the correlation between the expression of an ALOX12 gene and the nonalcoholic fatty liver disease and type II diabetes.

The invention provides a new application of a target gene ALOX12 for treating non-alcoholic fatty liver disease and type II diabetes, and further applies the ALOX12 gene to the treatment of non-alcoholic fatty liver disease and type II diabetes.

In order to achieve the purpose, the technical scheme of the invention is as follows:

the invention provides an application of an ALOX12 specific inhibitor in preparation of a medicine for treating non-alcoholic fatty liver disease and/or type II diabetes.

Preferably, the ALOX12 specific inhibitor is an inhibitor that inhibits ALOX12 protein activity or protein level, or an inhibitor that inhibits ALOX12 mRNA level.

Further, the inhibitor for inhibiting the activity or the protein level of ALOX12 protein comprises an antibody of ALOX12, a protein, a polypeptide, an enzyme, a small molecule compound for inhibiting the activity or the protein level of ALOX12 protein; the antibody to ALOX12 is a human or humanized monoclonal antibody, including antibodies having the amino acid sequence of a human immunoglobulin, antibodies isolated from a human immunoglobulin library or from a mouse or other animal in which antibodies are expressed from human genes; the antibodies to ALOX12 include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules.

Still further, the antibodies to ALOX12 include monoclonal antibodies, synthetic antibodies, polyclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies, single chain Fv, single chain antibodies, Fab fragments, F (ab ') fragments, disulfide linked Fv's, and epitope binding fragments of any of the foregoing.

Still further, the inhibitor that inhibits the mRNA level of ALOX12 is an antisense nucleotide sequence thereof, siRNA, miRNA, shRNA, dsRNA, or other proteins, polypeptides, enzymes, and compounds capable of inhibiting the mRNA level of ALOX 12.

Further, the ALOX12 specific inhibitor is ML355, which has the following chemical structural formula:

further, the medicament comprises pharmaceutically acceptable auxiliary materials; the auxiliary materials comprise a diluent, an adhesive, an antioxidant, a pH regulator, a preservative, a lubricant and a disintegrant; the dosage form of the medicine is oral preparation or injection administration.

Further, the diluent is any one of lactose, starch, cellulose derivatives, inorganic calcium salt or sorbitol;

the adhesive is any one of starch, gelatin, sodium carboxymethylcellulose or polyvinylpyrrolidone;

the antioxidant is any one of vitamin E, sodium bisulfite, sodium sulfite and butylated hydroxyanisole;

the pH regulator is any one of hydrochloric acid, sodium hydroxide, citric acid, tartaric acid, Tris, acetic acid, sodium dihydrogen phosphate and disodium hydrogen phosphate;

the preservative is any one of methyl p-hydroxybenzoate, ethyl p-hydroxybenzoate, m-cresol or benzalkonium chloride;

the lubricant is any one of magnesium stearate, superfine silica gel powder or talcum powder;

the disintegrating agent is any one of starch, methylcellulose, xanthan gum and croscarmellose sodium.

Further, the non-alcoholic fatty liver disease includes simple hepatic steatosis, non-alcoholic steatohepatitis, hepatic fibrosis, liver cirrhosis and liver cancer.

A specific inhibitor of ALOX12 in the present invention may be an inhibitor that specifically inhibits ALOX12 protein activity or protein level, or an inhibitor that inhibits ALOX12 mRNA level. The inhibitory activity may be reversible or irreversible. Such inhibitors can block, inhibit, or attenuate agonist-mediated responses and can compete with agonist binding to ALOX 12.

Such antibodies of the invention include, but are not limited to, monoclonal antibodies, synthetic antibodies, polyclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies, single chain fv (scFv), including bispecific scFv, single chain antibodies, Fab fragments, F (ab') fragments, disulfide linked fv (sdfv), and epitope-binding fragments of any of the foregoing. In particular, antibodies for use in the present invention include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules. The immunoglobulin molecules used in the present invention may be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule. Preferably, the antibody is a human or humanized monoclonal antibody. As used herein, "human" antibodies include antibodies having the amino acid sequence of a human immunoglobulin, and include antibodies isolated from a human immunoglobulin library or from a mouse or other animal in which antibodies are expressed from human genes.

The above-described small molecule compounds of the present invention that specifically inhibit ALOX12 protein activity or protein level can be a variety of compounds having ALOX12 specific inhibitory activity, including but not limited to the compounds disclosed in US2017001955A1 (e.g., compounds 19, 22, 27, 35-41, 43, 46-51, 53, 55-59, 61-83 in this patent application, preferably compound 35, i.e., ML355

) J Med chem.2011 August 11; 54(15) 5485-5497, Discovery of patent and Selective Inhibitors of Human Platlet type 12-Lipoxygene (e.g., Compounds 1-17, 22 in Table 1 of this document). The above documents are hereby incorporated by reference in their entirety.

In one embodiment of the present invention, the inhibitor is ML355

The medicine further comprises pharmaceutically acceptable auxiliary materials. The pharmaceutically acceptable excipients are various excipients commonly used or known in the pharmaceutical field, including but not limited to: diluents, binders, antioxidants, pH adjusters, preservatives, lubricants, disintegrants, and the like.

The above-mentioned diluents are, for example: lactose, starch, cellulose derivatives, inorganic calcium salts, sorbitol, and the like. The above-mentioned binder is, for example: starch, gelatin, sodium carboxymethylcellulose, polyvinylpyrrolidone, and the like. The above-mentioned antioxidants are, for example: vitamin E, sodium bisulfite, sodium sulfite, butylated hydroxyanisole, etc. Examples of the pH adjuster include: hydrochloric acid, sodium hydroxide, citric acid, tartaric acid, Tris, acetic acid, sodium dihydrogen phosphate, disodium hydrogen phosphate, and the like. The above-mentioned preservatives are, for example: methyl paraben, ethyl paraben, m-cresol, benzalkonium chloride, and the like. The above-mentioned lubricants are, for example: magnesium stearate, aerosil, talc powder and the like. The above-mentioned disintegrating agents are, for example: starch, methyl cellulose, xanthan gum, croscarmellose sodium, and the like.

The dosage form of the medicament of the invention can be in the form of oral preparations, such as tablets, capsules, pills, powders, granules, suspensions, syrups and the like; it can also be administered by injection, such as injection solution, powder for injection, etc., by intravenous, intraperitoneal, subcutaneous or intramuscular route. All dosage forms used are well known to those of ordinary skill in the pharmaceutical arts.

The medicament of the present invention can be administered to any animal which is or has developed non-alcoholic fatty liver disease and/or type II diabetes. These animals include both human and non-human animals, such as pets or livestock, and the like.

The agents of the invention may be administered to a subject by routes known in the art, including, but not limited to, oral, parenteral, subcutaneous, intramuscular, intravenous, intraperitoneal, intrahepatic, intramyocardial, intrarenal, vaginal, rectal, buccal, sublingual, intranasal, transdermal and the like.

The dosage administered will depend on the age, health and weight of the recipient, the type of drug combination, the frequency of treatment, the route of administration, etc. The drug may be administered in a single daily dose, or the total daily dose may be administered in divided doses of two, three or four times daily. The medicament can be administered before, during or after surgery. The dose may be administered one or more times, and the administration time may range from a single day to several months or longer.

The above-mentioned drugs of the present invention may also be used in combination with other drugs capable of ameliorating or inhibiting non-alcoholic fatty liver disease and type II diabetes.

The invention has the following advantages and beneficial effects:

according to the scheme, littermate control Flox mice and ALOX12 liver specific gene knockout (ALOX12-HepKO) mice are used as experimental objects, the function of ALOX12 genes is researched through an obesity mouse model induced by High fat and High cholesterol diet (HFHC), and the result shows that the ALOX12-HKO mice show that the liver weight is obviously lower than that of the Flox mice fed with the same feed compared with the Flox mice. The results of pathological staining of liver weight, liver/body weight ratio and lipid components and the like show that the ALOX12-HKO HFHC mice have obviously reduced nonalcoholic fatty liver disease and have obviously reduced lipid accumulation. The functions of ALOX12 genes are researched by using littermate control NTg mice and ALOX12 liver specific transgenic (ALOX12-HepTg) mice as experimental objects and an obesity mouse model induced by High fat and High cholesterol diet (HFHC), and the result shows that compared with NTg mice, ALOX12-HepTg mice show that the liver weight is obviously higher than that of NTg mice fed with the same kind of feed. The results of pathological staining of liver weight, liver/body weight ratio and lipid components and the like show that the nonalcoholic fatty liver disease of mice in the ALOX12-HepTgHFHC group is obviously aggravated, and the lipid accumulation is obviously increased. This suggests that ALOX12 promotes the onset of nonalcoholic fatty liver disease, type II diabetes. Therefore, ALOX12 can be used as a treatment target of nonalcoholic fatty liver disease and type II diabetes.

Drawings

FIG. 1 is a graph showing the results of body weights of Flox and ALOX12-HepKO mice (. about.p. < 0.01vs Flox 0w group,. about.p. < 0.05vs Flox 16w group).

FIG. 2 is a fasting plasma glucose results of Flox and ALOX12-HepKO mice (. about.p.. sup. < 0.01 vs. Flox 0w group,. sup. p. < 0.05 vs. Flox 16w group).

FIG. 3 is a graph of liver weight results for Flox and ALOX12-HKO mice (p < 0.01vs Flox group).

FIG. 4 is a graph of HE and oil red O staining of Flox and ALOX12-HKO mice.

FIG. 5 is a graph showing the results of body weights of NTg and ALOX12-HepTg mice (p < 0.01vs NTg 0w group, #:p < 0.01vs NTg 16w group).

FIG. 6 is a graph of the results of liver weights of NTg and ALOX12-HepTg mice (. about.. about.p < 0.01 vs. NTg group).

FIG. 7 is a graph of HE and oil red O staining of NTg and ALOX12-HepTg mice.

FIG. 8 is a graph showing body weight results of mice administered with ML 3553 mg/kg and Vehicle control solution in nonalcoholic fatty liver (n.s: p > 0.05vs Vehicle 0w group,. p < 0.01vs Vehicle 16w group).

FIG. 9 is a graph showing fasting plasma glucose results in mice administered ML 3553 mg/kg and its control Vehicle in nonalcoholic fatty liver disease (p < 0.05vs Vehicle 16w group).

FIG. 10 is a graph showing the results of the liver weights of mice administered with ML 3553 mg/kg and Vehicle control solution in nonalcoholic fatty liver (p < 0.01vs Vehicle 16w group).

FIG. 11 is a graph showing HE and oil red O staining of mice in nonalcoholic fatty liver after administration of ML 3553 mg/kg and its control solution, Vehicle.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

Experimental animals and breeding:

species, sex, week age and source of experimental animals: c57BL/6(WT) mice, Flox mice and ALOX12-HKO (liver specific ALOX12 gene knockout) mice, NTg mice and ALOX12-HTg (ALOX12 liver specific transgene), male, 8 weeks old. C57BL/6 mice were purchased from Beijing Huafukang Biotech, Inc.

Animal feeding and environmental conditions: all experimental mice were housed in the SPF-grade animal house (license number: SYXK (Eo): 2019-0013) of the model animal institute of Wuhan university. The mouse is illuminated alternately every 12 hours at the temperature of 24 +/-2 ℃ and the humidity of 40-70 percent, and the mouse can eat freely by drinking water.

Construction of liver-specific ALOX12 knockout mice:

1. gene information and vector design:

according to the gene information, CRISPR Design (website: http:// chopchop. cbu. uib. no /) is used for designing a CRISPR targeting site in each of the introns 2 and 6.

The target sequences are (i) ALOX12-sRNA 1: GCAACAAGTAGCTATAGGTGTGG，SEQIDNO:1；

②ALOX12-sRNA2：CTGGCTCCAGAGACGTTAGCTGG，SEQ ID NO:2；

In addition, a Donor plasmid for homologous repair (Donor Vector) was designed, which included flanking homology arms, central exons 3, 4, 5, 6, and two loxp sequences in the same orientation.

2. Construction of targeting vectors:

two primers corresponding to the sgRNA1 and the sgRNA2 are respectively annealed and fused to form double-stranded DNA, and the double-stranded DNA is connected with pUC57-sgRNA (Addgene51132) cut by BsaI to construct a sgRNA expression vector. The upstream of the vector is provided with a T7 promoter which can be used for subsequent in vitro transcription experiments.

3. Construction of Donor Vector (Donor Vector):

the conditional knockout backbone vector pBluescript SK (+) -2loxp constructed in the laboratory comprises two loxp sequences in the same direction, and contains a plurality of restriction enzyme cutting sites between and on both sides of the two loxps, so that cloning selection is facilitated. The ALOX12 conditional knockout donor vector was constructed based on this backbone vector. The following primers were designed to amplify the left and right homology arms (LA and RA) and the middle exon part (M) of the donor vector according to the principle of primer design. Then, three steps of enzyme digestion connection are carried out to respectively connect the 3 amplified fragments into the skeleton vector.

4. In vitro transcription of targeting vectors:

the CRIPR/Cas9 system contains two parts: cas9 protein responsible for cleavage and grnas that direct Cas9 protein localization to target sites. In this experiment, the two fractions need to be transcribed separately in vitro. For the Cas9 protein, the expression vector pST1374-Cas9(Addgene 44758) was cleaved with PmeI, the linearized plasmid was recovered after purification as a Transcription template, and then in vitro Transcription experiments were performed using the T7 ULTRA Transcription Kit (Invitrogen, AM 1345). For sgRNA, in vitro Transcription was performed using T7 Transcription Kit (Invitrogen, AM 1354). The transcribed mRNA of Cas9 and sgRNA was purified and recovered using the Transcription Clean-Up Kit (Invitrogen, AM 1908).

5. Microinjection:

selecting 3-4 female mice 4-5 weeks old, injecting PMSG (5IU) intraperitoneally at 11:00 am on the first day, injecting hCG (5IU) 46-48 hours later, mating with wild male mice, and checking female embolus in the morning as donor female mice. On the fourth day, at 9:00 am, donor mice were sacrificed by cervical dislocation and fertilized eggs were removed for microinjection. 3 kinds of mRNA and donor plasmid were mixed to prepare a mixture in a certain ratio, and injected into mouse fertilized eggs using a microinjector (FemtoJet 5247 microinjector, available from Eppendorf). And transplanting the fertilized eggs after injection into a surrogate pregnant mother mouse through embryo transplantation, wherein the pregnant mother mouse is generally produced within 19 days.

6. Screening of first-building mice (Founder):

2 weeks after the birth of the mouse, ear or tail tissues are taken, and genomic DNA is extracted for identification. The gene-editing mice were subjected to gene identification using primers P2+ P3, P4+ P5 in Table 3 to detect and type two loxp insertion sites in the genome of newborn mice, respectively. If homologous recombination occurs, since part of the sequence in the genome is replaced by loxp in the donor vector, the difference in size from the original sequence can be resolved by high-concentration (3.0%) agarose gel electrophoresis separation. In addition, we synthesized a pair of primers (P1+ P5) to check whether the two loxp sites in the initial mouse are located on the same chromosome, the P1 primer is located upstream of the left homology arm, the P2 is located downstream of loxp2, and the amplified product is subjected to T-A cloning and sequencing. The results show that liver-specific ALOX12 gene knockout mice, flox mice, were successfully constructed. The first-built mice are used for mating with the laboratory conservation strain C57/B6, and breeding and line building are carried out until ALOX12-flox homozygous mice are finally obtained.

7. Establishment of liver-specific ALOX12 knockout mice:

the ALOX12-flox mice are mated with liver-specific Alb-Cre transgenic mice (JAX, 003574) preserved in the laboratory, and ALOX12flox/flox/Alb Cre mice, namely ALOX12-HepKO, are obtained through screening.

Construction of liver-specific ALOX12 transgenic mice:

the coding region (CDS region) of the gene ALOX12 was amplified using mouse cDNA obtained by reverse transcription as a template, and ligated into the pALB overexpression vector stored in this laboratory. The plasmid with correct sequencing is linearized, the recovered fragment is purified and used for microinjection, injected into fertilized eggs of C57BL/6 mice by a FemtoJet 5247 microinjection system, and transplanted into oviduct of a surrogate female mouse, and F0 generation mice are obtained after 19 days of pregnancy. 2 weeks after the birth of the mouse, ear or tail tissues are taken, and genomic DNA is extracted for identification. The identification primers for the transgenic mice were as follows:

PrimerF:5’-ACACCCTGGTCATCATCCTG-3’，SEQ ID NO:14；

PrimerR:5’-GCTCAAGGGGCTTCATGATG-3’，SEQ ID NO:15；

then, the positive initial mouse is mated with a wild type, and positive mice of F1 generation are obtained by screening. Randomly selecting F1 positive mice, and screening the animals with the highest target gene expression quantity by an RT-PCR method. Breeding the littermate positive mice continuously to obtain the stable genetic liver specificity ALOX12 transgenic mouse strain.

Transgenic primer table

The model is induced by high-fat feed to operate the process:

the experimental animal feed formula comprises: high fat high cholesterol diet (HFHC) (available from southbound terofen diet science & ltd., cat # TP 26304): percentage of heat: 14% of protein; 44% of carbohydrate; 42 percent of fat and 4.5kcal/g of total caloric mass ratio.

Mice food intake was recorded in detail weekly, and fasting body weight and fasting blood glucose were measured 1 time every 4 weeks. The material was obtained at the end of week 16, and a portion was fixed in formalin or embedded in o.c.t. frozen section embedding Medium (Tissue Freezing Medium) for pathological analysis.

Mouse weight, blood glucose level determination:

1) and (4) detecting the body weight.

Fasting: mice to be tested were fasted (without water deprivation) at 8:00 a.m., and experimental procedures were started at 2:00 a.m.

Weighing: a plastic keg is placed on a dynamic electronic balance, the mouse is grabbed and placed into a weighing keg and the weight is measured and the data recorded. And (3) detecting the feed amount: after the weighing operation was completed, the mice were fed with feed and the amount of feed in the mice was recorded on a dynamic electronic balance.

2) Fasting blood glucose level detection assay

All mice to be tested were fasted (without water deprivation) from 8:00 am to 2:00 pm, i.e. the experimental procedure was started 6 hours after fasting.

Preparing a glucometer: checking a battery of a glucometer (Onedouch, Jones, USA), pressing a right switch, correctly putting the test paper into a left slot, displaying a number of a corresponding code of the test paper strip on a screen, and then displaying a blood dripping pattern to prompt the glucometer to enter a state to be tested.

Fixing the mouse: grasping the rat tail with the right hand, holding a towel with the left hand, folding the towel in half, pinching the folded part of the towel with the thumb and the forefinger, wrapping the head and the body of the rat into the towel in the palm, and fixing the root of the rat tail with the thumb and the forefinger.

Thirdly, tail shearing: the ophthalmic scissors can quickly cut off the rat tail at a position 0.1-0.2cm away from the tail end of the rat tail until blood drops automatically flow out.

Fourthly, detecting the blood sugar: the edge of the glucometer test paper is touched with a blood drop, the blood is immersed in the test paper, and the glucometer counts down for 5 seconds to display the reading.

Liver weight and liver tissue lipid component determination

(1) Terminal liver tissue sampling

1) Mice were weighed and then sacrificed by removing their necks quickly. The mice were fixed supine and their chest and abdomen hair were moistened with distilled water.

2) Clamping the skin at the center of the abdomen of the mouse by using a pair of forceps, cutting the skin to the lower part of the xiphoid process along the center of the abdomen, cutting the skin to the tail end, exposing subcutaneous fascia, muscles and the like layer by layer, opening the abdominal cavity and fully exposing all visceral organs.

3) The liver of the mouse was quickly found and removed, the removed liver specimen was placed on sterile gauze, the residual blood on the surface of the liver was wiped off, the liver was placed in a sterile petri dish and quickly weighed.

4) Paraffin specimen: a part of the liver was excised and fixed in 10% neutral formalin. Freezing the specimen: a part of liver was cut, embedded in a tin foil mold with OCT, and frozen and fixed on dry ice.

(2) Liver tissue processing and pathological staining related experiments

1) Liver dehydration, transparency, and waxing

A portion of the liver lobe tissue fixed in 10% neutral formalin was excised into a labeled embedding frame and rinsed with running water at low flow rate for over 30 minutes. The following procedures are set on the machine according to the following flow: 75% alcohol (45 minutes) → 85% alcohol (45 minutes) → 95% alcohol (45 minutes) → anhydrous alcohol (1 hour); ② transparent: xylene (1 hour) → xylene (1 hour); ③ soaking in wax (65 ℃): paraffin (1 hour) → paraffin (1 hour). After the tissue is washed, the embedding frame containing the tissue is loaded into a basket of the machine, and the program is started. After the above procedures are completed, the tissue embedding frame is taken out and sent to a pathology room for embedding tissues, and meanwhile, the machine is cleaned for standby.

2) Liver tissue section

Sections were cut using a microtome (slice thickness 5 μm).

3) Hematoxylin-eosin (HE) staining of liver tissue

The paraffin section of the liver tissue was put into a 65 ℃ oven (30 minutes) → xylene (5 minutes × 3 times) → 100% alcohol (1 minute) → 90% alcohol (1 minute) → 70% alcohol (1 minute) → distilled water washing → hematoxylin (5 minutes) → tap water washing off loose color on the section → 1% hydrochloric acid alcohol (1 to 3 seconds) → tap water washing time → Scott blue promoting liquid (sodium hydrogen carbonate 0.35g, magnesium sulfate 2g, distilled water 100mL) (1 minute) → tap water washing time → eosin (1 minute) → distilled water washing off loose color on the section → 70% alcohol at one time → 90% alcohol at one time → 100% alcohol (30 seconds × 3 times) → xylene (2 minutes × 3 times) → sealing the sheet when the xylene is not dried, and photographed.

4) Liver tissue oil red O staining

Frozen liver tissue sections were air dried in a fume hood for 30 minutes and fixed in 4% paraformaldehyde for 10 minutes. The tissue was washed in double distilled water for a brief 10 minutes to remove paraformaldehyde from the tissue.

② treatment with 60% isopropanol for 1 minute.

③ staining with oil red O (Sigma, cat # O0625, concentration 0.5 g/100 mL 100% isopropanol) for 30 minutes.

And fourthly, rinsing the fabric for 1 minute by 3 times by using 60 percent isopropanol until the background is clean.

Fifthly, the cell nucleus is lightly stained by Mayer's hematoxylin staining solution (5 drops).

Sixthly, rinsing with water, promoting blue in dilute lithium carbonate water solution, fully washing with water, and washing with water until cell nucleus is blue.

Seventhly, sealing the slices with glycerol gelatin and taking a picture.

Example 1 liver-specific ALOX12 loss inhibits the progression of non-alcoholic fatty liver disease and type ii diabetes

8-week-old male, Flox and ALOX12-HKO mice were selected and fed with TP26304 High-fat High-cholesterol diet (HFHC), i.e., Flox HFHC group and ALOX12-HKO HFHC group. The fasting body weight and fasting blood sugar of the mice are detected at 0 week and 16 week, the terminal material drawing is carried out at 16 weeks, the liver Tissue is taken and weighed, and then a part of the liver Tissue is placed in formaldehyde solution for fixation or embedded in an O.C.T. frozen section embedding Medium (Tissue Freezing Medium) for pathological analysis.

The results showed that the body weight of ALOX12-HKO group was significantly lower than that of Flox control group (see FIG. 1) after mice were fed with HFHC feed, and fasting blood glucose of ALOX12-HKO group was also significantly lower than that of Flox control group (see FIG. 2) by fasting blood glucose test. Meanwhile, the weight of the liver of the mouse is weighed, the liver weight of the ALOX12-HKO group is obviously lower than that of the Flox control group (shown in figure 3), and the results of HE and oil red O staining show that the fat drop of the liver cell of the mouse after the ALOX12 knockout is obviously less than that of the Flox control group, and the vacuolar degeneration of the liver cell is relatively reduced (shown in figure 4). The ALOX12 gene knockout is proved to remarkably inhibit the progress of nonalcoholic fatty liver and type II diabetes.

Example 2 liver-specific ALOX12 overexpression can exacerbate the progression of non-alcoholic fatty liver disease and type II diabetes

8-week-old, male, NTg mice and ALOX12-HTg mice were selected and fed with TP26304 High-fat High-cholesterol diet (HFHC), namely NTg HFHC group and ALOX12-HTg HFHC group. The fasting body weight and fasting blood sugar of the mice are detected at 0 week and 16 week, the terminal material drawing is carried out at 16 weeks, the liver Tissue is taken and weighed, and then a part of the liver Tissue is placed in formaldehyde solution for fixation or embedded in an O.C.T. frozen section embedding Medium (Tissue Freezing Medium) for pathological analysis.

The results showed that the body weight of the ALOX12-HTg group was significantly higher than that of the NTg control group when the mice were fed with HFHC feed (see FIG. 5); the liver weight of ALOX12-HTg group was significantly higher than that of NTg control group (see FIG. 6), and HE and oil red O staining results show that ALOX12 over-expressed mouse liver cell lipid droplets were significantly more than that of NTg control group, and liver cell vacuolar degeneration was also more severe (see FIG. 7).

The results show that the ALOX12 gene after overexpression significantly influences the glucose metabolism and the fat metabolism steady state of a mouse in the HFHC feeding state, the ALOX12 gene can significantly deteriorate the glucose metabolism and the fat metabolism capability of the mouse, and the ALOX12 gene plays an important role in regulating and controlling nonalcoholic fatty liver and type II diabetes caused by high fat induction.

Example 3 ML355 is effective in inhibiting the progression of non-alcoholic fatty liver disease and type II diabetes

8-week-old, male, C57 mice were selected, randomly divided into Vehicle (solvent, formulation DMSO: Solutol: PEG400: water ═ 5:10:20:65(v: v: v: v)) and ML355(HY-12341, MCE Co.), and fed with TP26304 High-fat High-cholesterol diet (HFHC), i.e., Velchie HFHC group and ML355 HFHC group. From 10w, the ML355 group was intraperitoneally injected with 3mg/Kg ML355 (two-day beat), and the vehicle group was injected with the same volume of vehicle. The mice were weighed at weeks 10 and 16, respectively, and at the end of week 16, the mice were weighed, and the liver tissues were partially fixed in formalin or embedded in o.c.t. frozen section embedding Medium (Tissue Freezing Medium) for pathological analysis.

The results showed that at 16 weeks, ML355 HFHC group was significantly lower in body weight than the Vehilce HFHC control group (see fig. 8), blood glucose was significantly lower in ML355 HFHC group than the Vehilce HFHC control group (see fig. 9) by fasting blood glucose assay, liver weight was also lower in ML355 HFHC group than the Vehilce HFHC control group by weighing the mouse liver, and fat droplets were significantly less in liver cells and less in liver cell vacuolar degeneration were found in ML355 HFHC group than the Vehilce HFHC control group as a result of HE and oil red O staining (see fig. 11). ML355 is shown as a specific inhibitor of ALOX12, and can obviously inhibit the function of ALOX12, thereby reducing the progress of nonalcoholic fatty liver and type II diabetes.

Sequence listing

<110> Wuhan university

Application of <120> ALOX12 specific inhibitor in preparation of medicine for treating non-alcoholic fatty liver disease and/or type II diabetes

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gcaacaagta gctataggtg tgg 23

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctggctccag agacgttagc tgg 23

<210> 3

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gcgtcgacac cgcgatggag atttgtag 28

<210> 4

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gcgtcgacct atagctactt gttgctttgg ct 32

<210> 5

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tctaccggtg tgtggtgttg gtgacacc 28

<210> 6

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgggatccaa cgtctctgga gccagc 26

<210> 7

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgacgcgtag ctggaacaat gacattcttg 30

<210> 8

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ataagaatgc ggccgcggcc ctcggctact tagtct 36

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tggcaaggga caggagacta 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tgaaagtacc gctgaacgtg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgaggggaga atcacgctaa 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggggaaagag gatggatttc 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cccttccggt agctatttcc 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

acaccctggt catcatcctg 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gctcaagggg cttcatgatg 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

acaccctggt catcatcctg 20

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gctcaagggg cttcatgatg 20

Claims (4)

1. Use of a specific inhibitor of ALOX12 in the manufacture of a medicament for the treatment of non-alcoholic fatty liver disease, wherein: the nonalcoholic fatty liver disease is simple hepatic fatty liver degeneration, and the ALOX12 specific inhibitor is an inhibitor for inhibiting ALOX12 protein activity or protein level or inhibiting ALOX12 mRNA level; the inhibitor for inhibiting the mRNA level of ALOX12 is antisense nucleotide sequence, siRNA, miRNA, shRNA, dsRNA;

the inhibitor for inhibiting ALOX12 protein activity or protein level comprises an antibody of ALOX12, a small molecule compound for inhibiting ALOX12 protein activity or protein level; the antibody to ALOX12 is a human or humanized monoclonal antibody, including antibodies having the amino acid sequence of a human immunoglobulin, antibodies isolated from a human immunoglobulin library or from a mouse or other animal in which antibodies are expressed from human genes; the antibodies to ALOX12 include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules;

the antibody of ALOX12 includes, polyclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies, single chain Fv, single chain antibodies, Fab fragments, F (ab ') fragments, disulfide linked Fv's, and epitope binding fragments of any of the foregoing.

2. Use of a specific inhibitor of ALOX12 in the manufacture of a medicament for the treatment of non-alcoholic fatty liver disease according to claim 1, wherein: the small molecule compound for inhibiting the activity or the protein level of ALOX12 protein is ML355, and the chemical structural formula is as follows:

3. use of a specific inhibitor of ALOX12 in the manufacture of a medicament for the treatment of non-alcoholic fatty liver disease according to claim 2, wherein: the medicament comprises pharmaceutically acceptable auxiliary materials; the auxiliary materials comprise a diluent, an adhesive, an antioxidant, a pH regulator, a preservative, a lubricant and a disintegrant; the dosage form of the medicine is oral preparation or injection administration.

4. Use of a specific inhibitor of ALOX12 in the manufacture of a medicament for the treatment of non-alcoholic fatty liver disease according to claim 3, wherein:

the diluent is any one of lactose, starch, inorganic calcium salt or sorbitol;

the adhesive is any one of starch, gelatin, sodium carboxymethylcellulose or polyvinylpyrrolidone;

the antioxidant is any one of vitamin E, sodium bisulfite, sodium sulfite and butylated hydroxyanisole;

the pH regulator is any one of hydrochloric acid, sodium hydroxide, citric acid, tartaric acid, Tris, acetic acid, sodium dihydrogen phosphate and disodium hydrogen phosphate;

the preservative is any one of methyl p-hydroxybenzoate, ethyl p-hydroxybenzoate, m-cresol or benzalkonium chloride;

the lubricant is any one of magnesium stearate, superfine silica gel powder or talcum powder;

the disintegrating agent is any one of starch, methylcellulose, xanthan gum and croscarmellose sodium.

Images