CN106390141B - The function and application of the G-protein Signal Regulation factor 6 and its inhibitor in treatment fatty liver and type II diabetes - Google Patents

Abstract

The present invention discloses a kind of function and application of RGS6 gene in fatty liver diabetes conditions.Using RGS6 knock out mice and wild type C57 mouse as experimental subjects, the Mice model of obesity induced by high fat diet, the results showed that compared with wild type C57 mouse, RGS6 knock out mice weight loss, fasting blood glucose level is lower than control group WT mouse, and liver function is substantially better than WT mouse.Find that RGS6 knock out mice is obviously improved the tolerance of glucose by intraperitoneal injection glucose tolerance test.Illustrate that high fat diet group RGS6-KO mouse adipose liver pathological changes are substantially reduced from mouse liver general appearance, liver weight and liver/weight ratio and liver function related enzyme activity measurement result, accumulation of lipid substantially reduces.Therefore, RGS6 can be used as the drug targets of screening treatment fatty liver and/or type-2 diabetes mellitus, and inhibitor can be used for preparing the drug for the treatment of fatty liver and/or type-2 diabetes mellitus.

Description

The G-protein Signal Regulation factor 6 and its inhibitor are in treatment fatty liver and type II diabetes In function and application

Technical field

The invention belongs to the function of gene and application field, in particular to a kind of G-protein Signal Regulation factor 6 (Regulator of G protein signaling 6, RGS6) is as drug targets in screening prevention, alleviation and/or treatment It is applied in the drug of fatty liver and/or type II diabetes.

Background technique

With the increase of the aged, the life of urbanization and living-pattern preservation, fat, nonalcoholic fatty liver Disease, Metabolic syndrome seek peace the metabolic disorders crowd such as diabetes sharp increase, now have become the important harm of global public health.

Diabetes are caused by many factors such as inherent cause, immunologic function disorder, microorganism infection and mental elements Body hypoinsulinism, insulin resistance eventually lead to a series of metabolic disorders such as sugar, protein, fat, water and electrolyte Syndrome.According to statistics, global diabetic is more than 300,000,000 people, wherein type II diabetes (type 2diabetes Mellitus, T2DM) 90% or more is accounted for, to the year two thousand thirty, number of patients will be more than 400,000,000, it means that grow up at global 20-79 years old It is diabetic that 7.7% will be had in people.With the expansion of morbidity crowd, difficulty of prevention and cure will be continuously increased.Diabetes are slow Property complication is to lead to diabetic's lethal the main reason for disabling, and not only involves cardiovascular and cerebrovascular, kidney, retina, nerve Equal important organs and tissue, liver are also its important one of target organ.

Except nonalcoholic fatty liver (non-alcoholic fatty liver disease, NAFLD) refers to alcohol and It is right using over-deposit fatty in liver cell as the clinical case syndrome of main feature caused by other specific damage liver factors The health of crowd causes huge threat, becomes the most common liver diseases of western countries.The disease incidence of NAFLD in Asian countries Also it is riseing year by year, the incidence in Urban Areas is even as high as 60%.Nonalcoholic fatty liver is further developed into as non-wine Essence fat hepatitis, about 20% nonalcoholic steatohepatitis finally develop as cirrhosis even liver failure^[1]。

At this stage, the illness rate that T2DM merges NAFLD just increases year by year.Result of study is shown, in diabetic population, NAFLD illness rate may be up to 80%^[2].In some patients Liver fatty deposition may be influence its T2DM development it is main because Element^[3].On the other hand, if T2DM controls bad or abundant development, not only fatty liver is promoted to generate, but also aggravate hepatic injury, Even form nonalcoholic fatty liver disease, hepatic fibrosis, cirrhosis and hepatocellular carcinoma.T2DM, which merges NAFLD, to increase greatly Add the mortality risk as caused by cirrhosis, hepatocellular carcinoma and cardiovascular complication^[4].Currently, although control hyperlipidemia exists T2DM still needs to be probed into the therapeutic effect in NAFLD patient, but the treatment of NAFLD mainly includes for diabetes and painstaking effort The positive control of pipe risks and assumptions.Studies have shown that in the patient for merging T2DM and NAFLD, only Thiazolidinediones Pioglitazone shows being obviously improved for liver histological.Therefore future, we should formulate special screening criteria and treatment Scheme is to the patient applied to clinic T2DM and NAFLD patient, especially T2DM and NAFLD merging.

RGS6 (Regulator of G protein signaling 6) is a kind of albumen for adjusting G-protein signal, is belonged to R7 subfamily in RGS family can regulate and control a variety of including nervous system, cardiovascular system and lymphocyte activity Signal path^[5], RGS6 gene is located on No. 14 chromosomes of people, and RGS6 albumen has GTP enzymatic activity, can be sub- single in conjunction with G α Position inhibits the signal path relied on by g protein coupled receptor^[6].The study found that RGS6 albumen is able to suppress cell differentiation and increasing It grows, suspends cell from cell division cycle, to generate the effect for inhibiting cancer, the onset risk phase of RGS6 and bladder cancer It closes^[5], it is able to suppress the generation and progress of breast cancer^[7], and it is related to the prognosis of cancer of pancreas^[8].In addition studies have found that RGS6 energy Enough generations by promoting the activity increase active oxygen of Nox enzyme, the heart disease of co-solvents induction and the hair of alcoholic fatty liver Hair tonic exhibition^[9]。

Bibliography

[1]Perry R J,Samuel V T,Petersen K F,et al.The role of hepatic lipids in hepatic insulin resistance and type 2diabetes[J].Nature,2014,510(7503):84- 91.

[2]Fan JG,Farrell GC.Epidemiology of non-alcoholic fatty liver disease in china.J Hepatol.2009；50:204-210

[3]Loria P,Lonardo A,Anania F.Liver and diabetes.A vicious circle.Hepatol Res.2013；43:51-64

[4]Cusi K.Treatment of patients with type 2diabetes and non-alcoholic fatty liver disease:Current approaches and future directions.Diabetologia.2016；59:1112-1120

[5]Berman D M,Wang Y,Liu Z,et al.A functional polymorphism in RGS6modulates the risk of bladder cancer[J].Cancer Res,2004,64(18):6820-6826.

[6]Seki N,Hattori A,Hayashi A,et al.The human regulator of G-protein signaling protein 6gene(RGS6)maps between markers WI-5202and D14S277on chromosome 14q24.3[J].J Hum Genet,1999,44(2):138-140.

[7]Maity B,Stewart A,O'Malley Y,et al.Regulator of G protein signaling 6is a novel suppressor of breast tumor initiation and progression [J].Carcinogenesis,2013,34(8):1747-1755.

[8]Jiang N,Xue R,Bu F,et al.Decreased RGS6expression is associated with poor prognosis in pancreatic cancer patients[J].International Journal of Clinical&amp；Experiment...,2014.

[9]Stewart A,Maity B,Anderegg S P,et al.Regulator of G protein signaling 6is a critical mediator of both reward-related behavioral and pathological responses to alcohol[J].Proceedings of the National Academy of Sciences,2015,112(7):E786-E795.

Summary of the invention

For the defect and deficiency for solving the above-mentioned prior art, the purpose of the present invention is to provide a kind of expression of RGS6 gene Correlation between fatty liver, type II diabetes, provide a kind of RGS6 as drug targets in screening prevention, alleviate and/ Or the application in the drug for the treatment of fatty liver, type II diabetes, and then the inhibitor of RGS6 a kind of is provided in preparation prevention, alleviation And/or the application in the drug for the treatment of fatty liver, type II diabetes.

The purpose of the present invention is achieved through the following technical solutions

The present invention is induced using wild type C57 mouse and RGS6 knock out mice as experimental subjects by high fat diet Mice model of obesity (diet induced obesity, DIO) studies the function of RGS6 gene, as a result, it has been found that small with wild type WT Mouse comparison, RGS6 knock out mice show weight loss, and weight is significantly lower than the WT mouse of feed of the same race raising, and The fasting blood glucose level of RGS6 knock out mice is lower than control group WT mouse, and the liver function of RGS6 knock out mice is obviously excellent In WT mouse.Further find RGS6 knock out mice to the tolerance energy of glucose by intraperitoneal injection glucose tolerance test Power is obviously improved.From mouse liver general appearance, liver weight and liver/weight ratio and the measurement of liver function related enzyme activity are tied Fruit etc. illustrates that HFD group (High fat diet, high fat diet) RGS6-KO mouse adipose liver pathological changes are substantially reduced, accumulation of lipid It substantially reduces.This shows that RGS6 gene knockout can alleviate the generation of fatty liver, type II diabetes, and RGS6 gene can promote fat The generation of liver, type II diabetes.

Therefore, RGS6 gene can be used as drug target, construct the In vitro cell model or animal mould of RGS6 gene overexpression Type, the drug for screening prevention, alleviating and/or treat fatty liver and/or type II diabetes；RGS6 gene also can be used as gene Target gene in treating designs and prepares prevention, alleviation and/or drug and/or the life for the treatment of fatty liver and/or type II diabetes Object reagent achievees the purpose that prevention, alleviation and/or treatment fatty liver and/or type II diabetes by technique for gene engineering.Example Such as using RGS6 as target gene, the double-strand siRNA that design may interfere with RGS6 expression is injected into people after being chemically synthesized Body makes XX gene silencing by the method that RNA is interfered to treat fatty liver and/or type II diabetes；It can also design and construct The mutant of RGS6, enters cell after injection, the substrate specificity of competition RGS6 original shape is played and controlled to inhibit the function of RGS6 Treat purpose；Further, it is also possible to utilize the external of RGS6 gene overexpression using RGS6 as shot design micromolecular compound inhibitor Cell model or animal model, by screening, discovery wherein be capable of specificity inhibit RGS6 molecule, thus for fatty liver and/ Or the treatment of type II diabetes provides new therapeutic molecules.

For the above-mentioned function of RGS6, RGS6 is provided as drug targets in the drug of screening protection liver and glycometabolism Application.

For the above-mentioned function of RGS6, RGS6 is provided as drug targets in screening prevention, alleviation and/or treatment fatty liver And/or the application in the drug of type II diabetes.

For the above-mentioned function of RGS6, provide the inhibitor of RGS6 in preparation prevention, alleviate and/or treatment fatty liver and/ Or the application in the drug of type II diabetes.

A kind of drug for preventing, alleviating and/or treat fatty liver and/or type II diabetes, the inhibitor comprising RGS6.

The inhibitor of the RGS6 is preferably the rna interference vector of siRNA, RGS6 gene of RGS6 gene, RGS6's Antibody and other be able to suppress RGS6 expression inhibitor.

The present invention has the following advantages and effects with respect to the prior art:

(1) present invention discover that the new function of RGS6, i.e. RGS6 have the function of deteriorating fatty liver and type II diabetes.

(2) function in fatty liver and type II diabetes disease is being deteriorated based on RGS6, for develop prevention, alleviate and/ Or the drug offer target for the treatment of fatty liver and/or type II diabetes.

(3) inhibitor of RGS6 can be used for preparing the medicine of prevention, alleviation and/or treatment fatty liver and/or type II diabetes Object.

Detailed description of the invention

Fig. 1 is the target practice policy map for constructing RGS6 conditionity knock-out mice.

Fig. 2 is the weight of WT and RGS6-KO mouse, fasting blood-glucose result figure；

A is mouse weight result figure, and B is fasting blood glucose level statistical chart (*: p < 0.05vs WT NC group, *: p < of * 0.01vs WT NC group, #:p < 0.05vs WT HFD group, ##:p < 0.01vs WT HFD group).

Fig. 3 is that WT and RGS6-KO mouse passes through intraperitoneal injection glucose tolerance result figure；

A is by different time points mouse blood sugar level statistic figure after intraperitoneal injection glucose, and B is each group glucose tolerance in mice Area under the curve (area under the curve, AUC) compares figure (*: p < 0.01vs WT NC group of *, ##:p < 0.01vs WT HFD group).

Fig. 4 is the liver weight result figure of RGS6-KO and WT mouse；

A is that liver weight counts histogram, and B is liver weight and mouse itself weight ratio Data-Statistics histogram (##:p < 0.01vs WT HFD group).

Fig. 5 is the liver function measurement result figure of WT and RGS6-KO mouse；

AST, ALT and ALP is taken to detect mouse liver function respectively.(##:p < 0.01vs WT HFD group).

Specific embodiment

By following detailed description combination attached drawing it will be further appreciated that the features and advantages of the invention.Provided implementation Example is only the explanation to the method for the present invention, remaining content without limiting the invention in any way announcement.

Animal for research and raising:

Experimental animal kind, gender, week old and source: C57BL/6 mouse (WT) and RGS6 liver specific genes knock out (RGS6-KO) mouse, male, 8 week old.C57BL/6 mouse is purchased from Fukang Biotechnology Co., Ltd, Beijing China, and RGS6 liver is special Specific gene knock-out mice (RGS6-KO) by RGS6-floxed mouse with controlled by protein promoter, liver cell it is specific expressed Cre transgenic mice Albumin-Cre (be purchased from The Jackson Laboratory, article No. 003574) hybridization obtain.

The building of liver specificity RGS6 knock out mice:

According to gene information, included respectively using CRISPR Design (network address: http://crispr.mit.edu/) The target practice site of a CRISPR is respectively designed in son 4 and 5.Target sequence is respectively as follows:

RGS6-sRNA 1:GGTCACAGCATCATGCTGTAGGCGA TGG

RGS6-sRNA 2:ggAGTGGACACCACCCGTCTTACAA AGG

Furthermore the donor plasmid (Donor Vector) for homologous reparation has also been devised, it includes that two sides are homologous Arm, intermediate exon 5 and two loxp sequences in the same direction, construction strategy are shown in Fig. 1.

1. the building of targeting vector: corresponding two primers of sgRNA1 and sgRNA2 being fused into double-stranded DNA respectively, then It is connected into T4DNA ligase by the processed pUC57-sgRNA carrier of restriction enzyme BsaI.The carrier upstream has one A T7 promoter, can be used for subsequent In vitro transcription.

2. the building of donor vehicle (Donor Vector): according to design of primers principle, designing following primer (table 1) and be used for Expand the left and right homology arm (LA and RA) of donor vehicle and the exon part (M) of centre.Obtained product is expanded through in table 1 3 segments are obtained after shown digestion with restriction enzyme, it is connected into conditionity respectively and knocks out skeleton carrier pBluescript In SK (+) -2loxp, Donor Vector is obtained.

Primer sequence needed for table 1 constructs donor vehicle and corresponding restriction enzyme site

3. the transcription of targeting vector: (being responsible for the Cas9 egg of dissection in two parts for including to CRIPR/Cas9 system White and guidance Cas9 albumen navigates to the gRNA of target site) it is transcribed respectively.For Cas9 albumen, by its expression vector (pST1374-Cas9) digestion is carried out with PmeI, to recycle linearization plasmid after purification as transcription templates, uses T7mMESSAGE MMACHINE kit (AM1345, Ambion) is transcribed in vitro, and capped mRNA product is obtained.And with Poly (A) Tailing kit (Ambion) obtains mature mRNA product to above-mentioned product tailing；For sgRNA, use MEGAshortscript^TMKit (AM1354, Ambion company) is transcribed in vitro.It will transcribe obtained Cas9's and sgRNA MRNA is purified using miRNeasy Micro Kit (Qiagen, 217084).

4. the production of RGS6-floxed conditionity knock-out mice

The mRNA product of above-mentioned maturation is injected in mouse fertilized egg together with donor plasmid, is transplanted in replace-conceive rat body It is cultivated.Obtained mouse is identified.Raw mouse toe or tail tissue after a week is taken out, extracts genome, and lead to It crosses PCR method screening positive head and builds mouse.From determine occur homologous recombination mouse in select at random one be only used as F0 generation carry out after Continuous breeding, it is final to obtain RGS6-floxed Mice homozygous.

5. the production of liver specificity RGS6 knock out mice

Above-mentioned RGS6-floxed mouse is mated with liver specificity Albumin-Cre transgenic mice, screening obtains RGS6^{floxed/floxed}Tamoxifen, induction is injected intraperitoneally after mouse length to 6 week old or so in/Albumin-Cre mouse The expression of Cre enzyme, two loxp in the same direction of identification of Cre enzyme spcificity, and cut off sequence between the two and one of those Loxp finally obtains liver cell specificity RGS6 knock out mice.

Experimental animal feed formula: high lipid food (HFD) (is purchased from Fukang Biotechnology Co., Ltd, Beijing China, article No. D12942): percent of calories: protein: 20%；Carbohydrate: 20%；Fat: 60%, total thermal mass ratio: 5.24kcal/g.Low fat feed (NC) (is purchased from Fukang Biotechnology Co., Ltd, Beijing China, article No. D12450B): heat percentage Than: protein: 20%；Carbohydrate: 70%；Fat: 10%, total thermal mass ratio: 3.85kcal/g.

Feeding environment and condition: SPF grades of Experimental Animal Centers, room temperature between 22-24 DEG C, humidity between 40-70%, It is 12h that light and shade, which replaces lighting hours, and free water is ingested.

[embodiment 1] mouse fatty liver, type II diabetes model (diet induced obesity, DIO) obtain

(1) experimental animal is grouped: selecting 8 week old, male, WT mouse and RGS6-KO mouse, gives two kinds of special feedings respectively Expect D12942 high lipid food (High fat diet, HFD) and D12450B low fat feed (Normal chow, NC) raising, i.e. WT NC group, KO NC group, WT HFD group, KO HFD group totally 4 groups.

(2) model induces operating process by high lipid food:

Using WT and KO mouse, DIO model is established, phenotype correlation analysis is carried out, specifies RGS6 gene pairs fatty liver, II type The effect that diabetes play.8 week old are selected, male, WT mouse and RGS6-KO mouse give two kinds of special feeds respectively D12942 high lipid food (Highfat diet, HFD) and D12450B low fat feed (Normal chow, NC) raising, i.e. WT NC Group, KO NC group, WT HFD group, KO HFD group totally 4 groups.Weekly in detail record mouse food ration, mouse empty body weight and Fasting blood-glucose detected 1 time every 4 weeks.It tests the 14th week, intraperitoneal injection glucose experiment (IPGTT) is carried out, to evaluate mouse machine Body is to glucose tolerance.16th week terminal materials.

[embodiment 2] mouse weight, determination of blood glucose level

(1) mouse empty body weight, appetite detection

1) weight detects.

1. fasting: morning 8:00 will be to experiment mice fasting (can't help water), and afternoon, 2:00 started experimental implementation.

2. weighing: weighing respectively the 0th week, 4 weeks, 8 weeks, 12 weeks, a plastics keg is placed on dynamic electron balance, is grabbed Mouse is played, is put into and weighs in keg, measurement weight records data.Forage volume detection: after the completion of operation of weighing, to mouse plus Feed, and on dynamic electron balance record mouse forage volume.

(2) fasting blood glucose level test experience

It will need the mouse tested from morning 8:00 to fasting (can't help water) between 2:00 in afternoon, i.e. fasting is opened after 6 hours Beginning experimental implementation.

1. blood glucose meter prepares: blood glucose meter (Johnson Co., ONETOUCH) battery is checked, by right-side switch, by test paper It is properly placed left side slot, screen is shown and the number of blood sugar test paper respective code, then shows pattern of bleeding, and prompts blood glucose Instrument enters state to be measured.

2. fixed mouse: the right hand grabs rat-tail, and left hand holds one piece of towel, by towel doubling, pinches towel with thumb and index finger Mouse head and body are packed in the towel in palm, thumb and index finger and fixed by rat-tail root by fold position.

3. cutting tail: eye scissors cut rat-tail at away from rat-tail end 0.1-0.2cm rapidly, voluntarily flow out to drop of blood.

4. blood sugar test: blood glucose meter test paper edge being touched drop of blood, blood immerses test paper, shows within blood glucose meter countdown 5 seconds Reading.

The evaluation index of type II diabetes injury severity score mainly includes the levels such as weight, blood glucose, weight, change of blood sugar As a result as shown in Figure 1, give RGS6-KO mouse 12 weeks HFD feed and NC feed raising after, the HFD group since the 2nd week RGS6-KO mouse weight is significantly lower than the WT mouse weight of HFD group, is continued until the 12nd week (see Fig. 2A)；Through fasting blood-glucose Detection discovery HFD group mouse from the obviously more corresponding NC control group raising of the 4th week fasting blood glucose level, the RGS6- of HFD group KO mouse fasting blood glucose level is also significantly lower than WT group mouse fasting blood glucose level (see Fig. 2 B).It is shown after showing RGS6 gene knockout Work affects glycometabolism stable state of the mouse under HFD raising state, and RGS6 gene can significantly reduce the Sugar metabolism ability of mouse, table It plays an important role in bright RGS6 gene type II diabetes caused by induction high in fat.

[embodiment 3] glucose tolerance test (intraperitoneal glucose tolerance test, IPGTT)

It tests the 12nd week, intraperitoneal injection glucose experiment (IPGTT) is carried out, to evaluate mouse body to sugared tolerance.

(1) before surveying blood glucose, the empty body weight of mouse is first measured, the volume injected of glucose is calculated according to 10 μ L/g.

(2) fasting blood-glucose when first detection glucose sugar injection is i.e. 0 minute first, rapidly through grape is injected intraperitoneally after detection Liquid glucose.

(3) operating method is injected intraperitoneally: 1. fixing mouse；Pick up mouse, the little finger of toe of left hand and the nameless tail for grabbing mouse Bar, another three finger catches the neck of mouse, keeps the head of mouse downward, and mouse web portion is sufficiently exposed.2. inserting needle positioning and note Penetrate: from the right hand syringes of abdomen side inserting needle, by tip and mouse web portion angle at 45 °, inserting needle, hour hands are injected in pumpback Head walks a small distance in subcutaneous abdomen, enters abdominal cavity in the abdomen other side after ventrimeson, after having injected drug, slowly Syringe needle, and slight rotating needle are extracted, leakage is prevented.

(4) 15 points after intraperitoneal injection, 30 points, 60 points, 120 minutes points cut tail and survey mouse blood sugar value, and remember Record blood glucose numerical value and detection time.

Further pass through intraperitoneal injection glucose tolerance test (intraperitoneal glucose Tolerancetests, IPGTT) assess each group mouse to the processing capacity of glucose, in experiment the 12nd week, pass through injection After the glucose of 1.0g/kg weight, the WT mouse of HFD group and RGS6-KO mouse blood sugar level are reached in the sharp increase of 15 minutes points To peak value, as time goes by after injecting 30 minutes, KO group mouse blood sugar level slightly declines, after sixty minutes WT group mouse blood Sugar level is begun to decline, but the two was restored at 2 hours still in fasting blood glucose level (blood glucose at 0 minute) is higher than on an empty stomach Blood glucose level, and RGS6-KO mouse blood sugar level hour is constantly in the blood glucose level (figure lower than WT mouse from 0 minute to 2 3A).Compare each group mouse blood sugar area under the curve (area under the curve, AUC), finds the AUC of WT mouse HFD group It is significantly higher than NC group, the AUC of RGS6-KO HFD group shows RGS6 to maintenance sugared generation significantly less than the AUC (Fig. 3 B) of WT HFD group Thank to stable state with powerful ability of regulation and control.

[embodiment 4] liver general appearance and the measurement of liver organization lipid components

(1) terminal liver organization is drawn materials

1) after mouse weighing, de- neck is put to death rapidly.Lie on the back fixed mouse, and with distilled water by mouse chest, abdomen hair moistens It is wet.

2) skin is hit exactly with a tweezers clamp mouse web portion, hits exactly along abdomen and cut off under skin to xiphoid-process to head, to tail Skin is cut off at end, successively exposes subcutaneous fascia, and muscle etc. opens abdominal cavity, sufficiently exposes each internal organs.

3) liver specimens removed are placed on sterile gauze by the liver for quickly finding and removing mouse, wipe dry liver table Remained blood on face, liver is placed in sterile petri dish, is taken pictures rapidly, weighing.

(2) liver functional testing

1) computer labman software is opened, printer is then turned on Biochemical Analyzer；

2) select and clean detection probe, cuvette etc., guarantee probe is unobstructed, cuvette free from admixture adheres to, and light absorption value exists The term of reference of setting；

3) serum specimen to be detected is found out from -80 DEG C of refrigerators；Serum to be detected is melted again at room temperature to liquid State prepares detection；

4) whether Testing index reagent needed for checking on labman software is enough, sets Testing index and detection ordering Deng；

5) 50 μ l of blood serum sample to be checked is added, starts to detect；

6) record detection numerical value after to be detected.

Liver weight and liver weight and mouse weight ratio result as shown in Figure 4, HFD group RGS6-KO mouse without It is low compared with the WT mouse of HFD group (such as Fig. 4) with mouse weight ratio itself by liver weight or liver weight.Further liver function Can detection shows that HFD group mouse liver function is obviously poor compared with NC group, and RGS6-KO mouse three kinds of liver enzymes (AST (glutamic-oxalacetic transaminease), ASLT (glutamic-pyruvic transaminase), ALP (alkaline phosphatase)) (such as Fig. 5) lower compared with the WT mouse of HFD group.These result explanations The fatty liver of RGS6 knock out mice is clearly better.

The above results show that the type II diabetes that RGS6-KO mouse occurs under the induction of HFD and fatty live lesions are significant Mitigate.These have obvious action the result shows that RGS6 gene pairs aggravates type II diabetes and fatty liver.Result of the present invention is said Bright RGS6 gene has important facilitation in fatty liver, type II diabetes disease model.

The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention, It should be equivalent substitute mode, be included within the scope of the present invention.

SEQUENCE LISTING

<110>Wuhan University

<120>function in treatment fatty liver and type II diabetes of the G-protein Signal Regulation factor 6 and its inhibitor and Using

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 28

<212> DNA

<213> RGS6-sRNA1

<400> 1

ggtcacagca tcatgctgta ggcgatgg 28

<210> 2

<211> 28

<212> DNA

<213> RGS6-sRNA2

<400> 2

ggagtggaca ccacccgtct tacaaagg 28

<210> 3

<211> 50

<212> DNA

<213> RGS6 LA-F

<400> 3

tcgagtgccc accatgagca gagggagtca tcatcggtgc catcggacgt 50

<210> 4

<211> 42

<212> DNA

<213> RGS6 LA-R

<400> 4

ccgatggcac cgatgatgac tccctctgct catggtgggc ac 42

<210> 5

<211> 30

<212> DNA

<213> RGS6 M-F

<400> 5

ccggaattcc ctacagcatg atgctgtgac 30

<210> 6

<211> 28

<212> DNA

<213> RGS6 M-R

<400> 6

cgggatccta agacgggtgg tgtccact 28

<210> 7

<211> 47

<212> DNA

<213> RGS6 RA-F

<400> 7

cgcgtcaaag gagagctggg gcactcagag aatggcctcg gctttgc 47

<210> 8

<211> 47

<212> DNA

<213> RGS6 RA-R

<400> 8

ggccgcaaag ccgaggccat tctctgagtg ccccagctct cctttga 47

Claims (2)

1. RGS6 gene answering in screening prevention, the drug alleviated and/or treat nonalcoholic fatty liver as drug targets With, it is characterised in that: the screening prevents, alleviates and/or treat the drug of nonalcoholic fatty liver to be to inhibit RGS6 gene The drug of expression；The application is non-diagnostic and non-treatment.

Application of the inhibitor of 2.RGS6 in preparation prevention, the drug alleviated and/or treat nonalcoholic fatty liver, feature Be: the inhibitor of the RGS6 is the rna interference vector of siRNA, RGS6 gene of RGS6 gene.