CN106390141A

CN106390141A - Function and application of RGS6 (regulator of G protein signaling 6) and RGS6 inhibitor in treatment of fatty liver disease and T2DM (type 2 diabetes mellitus)

Info

Publication number: CN106390141A
Application number: CN201610888108.8A
Authority: CN
Inventors: 李红良; 姬燕晓; 王丕晓; 张晓晶
Original assignee: Wuhan University WHU
Current assignee: Wuhan University WHU
Priority date: 2016-10-11
Filing date: 2016-10-11
Publication date: 2017-02-15
Anticipated expiration: 2036-10-11
Also published as: CN106390141B

Abstract

The invention discloses a function and an application of an RGS6 (regulator of G protein signaling 6) gen in treatment of fatty liver and diabetes mellitus diseases. An RGS6 gene knockout mouse and a wild type C57 mouse are taken as experimental subjects, by means of a high-fat DIO (diet induced obesity) mouse model, a result shows that compared with the wild type C57 mouse, the weight of the RGS6 gene knockout mouse is reduced, the fasting blood-glucose level is lower than that of the WT mouse in a control group, and the liver function is obviously better than that of the WT mouse. An IPGTT (intraperitoneal glucose tolerance test) shows that the glucose tolerance ability of the RGS6 gene knockout mouse is improved obviously. Results of determination in general appearance of the mouse liver, the liver weight, the liver/weight ratio and activity of a liver function related enzyme prove that fatty liver lesions of the RGS6-KO (knockout) mouse in a high fat diet group are relieved obviously, and the lipid accumulation is reduced remarkably. Therefore, the RGS6 can be taken as a target for screening drugs for treating fatty liver and/or T2DM, and an RGS6 inhibitor can be used for preparing the drugs for treating fatty liver and/or T2DM.

Description

The G-protein Signal Regulation factor 6 and its inhibitor are in treatment fatty liver and type II diabetes In function and application

Technical field

The invention belongs to the function of gene and application, particularly to a kind of G-protein Signal Regulation factor 6 (Regulator of G protein signaling 6, RGS6) and/or treats in screening prevention, alleviation as drug targets Apply in the medicine of fatty liver and/or type II diabetes.

Background technology

With the increase of the aged, the life of urbanization and living-pattern preservation, fat, NASH Disease, Metabolic syndrome seek peace the metabolic disorder crowd such as diabetes increase severely, now have become as the important harm of global public health.

Diabetes are to be caused by many factors such as inherent cause, immunologic function disorder, microorganism infection and mental elements Body hypoinsulinism, insulin resistance, ultimately result in a series of metabolic disorder such as sugar, protein, fat, water and electrolyte Syndrome.According to statistics, global diabetic is more than 300,000,000 people, wherein type II diabetes (type 2diabetes Mellitus, T2DM) account for more than 90%, to the year two thousand thirty, number of patients will exceed 400,000,000 it means that growing up in global 20-79 year 7.7% will be had in people is diabetic.With the expansion of morbidity crowd, difficulty of prevention and cure will be continuously increased.Diabetes are slow Property complication is to lead to the lethal main cause disabling of diabetic, not only involves cardiovascular and cerebrovascular, kidney, retina, nerve In important organ and tissue, liver is also one of its important target organ.

NASH (non-alcoholic fatty liver disease, NAFLD) refer to except alcohol and Other clearly damage the fatty clinical case syndrome as principal character for the over-deposit with liver cell that liver factor causes, right The health of crowd causes huge threat, becomes the modal liver diseases of western countries.The incidence of disease of NAFLD in Asian countries Also riseing year by year, the incidence in Urban Areas is even as high as 60%.NASH is further developed into as non-wine Essence fat hepatitis, about 20% nonalcoholic steatohepatitis finally develop into cirrhosis or even liver failure^[1].

At this stage, the illness rate of T2DM merging NAFLD just increases year by year.Result of study shows, in diabetic population, NAFLD illness rate may be up to 80%^[2].In some patients Liver fatty deposition possibly affect its T2DM development main because Element^[3].On the other hand, if T2DM controls not good or abundant development, not only promote fatty liver to generate, and so that hepatic injury is increased, Even form nonalcoholic fatty liver disease, hepatic fibrosis, cirrhosis and hepatocellular carcinoma.T2DM merges NAFLD and will increase Plus the mortality risk being led to due to cirrhosis, hepatocellular carcinoma and cardiovascular complication^[4].At present although controlling hyperlipidemia to exist T2DM still needs to be probed into the therapeutic action in NAFLD patient, but the treatment of NAFLD is mainly included for diabetes and painstaking effort The positive control of pipe risks and assumptions.Research shows, in the patient merging T2DM and NAFLD, only Thiazolidinediones Pioglitazone shows being obviously improved of liver histological.It is therefore following that we should formulate special screening criteria and treatment Scheme is to being applied to clinical T2DM and NAFLD patient, the patient of especially T2DM and NAFLD merging.

RGS6 (Regulator of G protein signaling 6) is a kind of albumen adjusting G-protein signal, belongs to R7 subfamily in RGS family, can regulate and control multiple including nervous system, cardiovascular system and lymphocyte activity Signal path^[5], on No. 14 chromosomes of people, RGS6 albumen has GTP enzymatic activity to RGS6 gene, can be sub- single in conjunction with G α The signal path that position suppression is relied on by g protein coupled receptor^[6].Research finds, RGS6 albumen can suppress cell differentiation and increasing Grow, so that cell is suspended from CDC, thus producing the effect of suppression cancer, the onset risk phase of RGS6 and carcinoma of urinary bladder Close^[5], generation and the progress of breast cancer can be suppressed^[7], and related to the prognosis of cancer of pancreas^[8].In addition studies have found that RGS6 energy Enough pass through to promote sending out of the generation of the activity increase active oxygen of Nox enzyme, the heart disease that co-solvents induce and alcoholic fatty liver Hair tonic exhibition^[9].

Bibliography

[1]Perry R J,Samuel V T,Petersen K F,et al.The role of hepatic lipids in hepatic insulin resistance and type 2diabetes[J].Nature,2014,510(7503):84- 91.

[2]Fan JG,Farrell GC.Epidemiology of non-alcoholic fatty liver disease in china.J Hepatol.2009；50:204-210

[3]Loria P,Lonardo A,Anania F.Liver and diabetes.A vicious circle.Hepatol Res.2013；43:51-64

[4]Cusi K.Treatment of patients with type 2diabetes and non-alcoholic fatty liver disease:Current approaches and future directions.Diabetologia.2016；59:1112-1120

[5]Berman D M,Wang Y,Liu Z,et al.A functional polymorphism in RGS6modulates the risk of bladder cancer[J].Cancer Res,2004,64(18):6820-6826.

[6]Seki N,Hattori A,Hayashi A,et al.The human regulator of G-protein signaling protein 6gene(RGS6)maps between markers WI-5202and D14S277on chromosome 14q24.3[J].J Hum Genet,1999,44(2):138-140.

[7]Maity B,Stewart A,O'Malley Y,et al.Regulator of G protein signaling 6is a novel suppressor of breast tumor initiation and progression [J].Carcinogenesis,2013,34(8):1747-1755.

[8]Jiang N,Xue R,Bu F,et al.Decreased RGS6expression is associated with poor prognosis in pancreatic cancer patients[J].International Journal of Clinical&amp；Experiment...,2014.

[9]Stewart A,Maity B,Anderegg S P,et al.Regulator of G protein signaling 6is a critical mediator of both reward-related behavioral and pathological responses to alcohol[J].Proceedings of the National Academy of Sciences,2015,112(7):E786-E795.

Content of the invention

For solving defect and the deficiency of above-mentioned prior art, it is an object of the invention to provide a kind of expression of RGS6 gene Correlation and fatty liver, type II diabetes between, provide a kind of RGS6 as drug targets screening prevention, alleviate and/ Or the application in treatment fatty liver, the medicine of type II diabetes, and then provide a kind of inhibitor of RGS6 in preparation prevention, alleviate And/or the application in treatment fatty liver, the medicine of type II diabetes.

The purpose of the present invention is achieved through the following technical solutions

The present invention, with wild type C57 mouse and RGS6 knock out mice as experimental subjects, is induced by high fat diet Mice model of obesity (diet induced obesity, DIO) studies the function of RGS6 gene, it is found that little with wild type WT Mouse contrasts, and RGS6 knock out mice shows and loses weight, and its body weight is significantly lower than the WT mouse that feed of the same race is raised, and The fasting blood glucose level of RGS6 knock out mice is less than control group WT mouse, and the liver function of RGS6 knock out mice is substantially excellent In WT mouse.Further the tolerance energy to glucose for the RGS6 knock out mice is found by lumbar injection glucose tolerance test Power is obviously improved.From mouse liver general appearance, liver weight and liver/weight ratio and liver function related enzyme activity measure knot All explanation HFD group (High fat diet, high fat diet) RGS6-KO mouse adipose liver pathological changes such as fruit substantially mitigate, accumulation of lipid Substantially reduce.This shows that RGS6 gene knockout can alleviate the generation of fatty liver, type II diabetes, and RGS6 gene can promote fat Liver, the generation of type II diabetes.

Therefore, RGS6 gene as drug target, can build In vitro cell model or the animal mould of RGS6 gene overexpression Type, for the medicine of screening prevention, alleviation and/or treatment fatty liver and/or type II diabetes；RGS6 gene also can be used as gene Target gene in treatment, designs and prepares prevention, alleviates and/or treat fatty liver and/or the medicine of type II diabetes and/or life Thing reagent, reaches prevention by technique for gene engineering, alleviates and/or treat fatty liver and/or the purpose of type II diabetes.Example As with RGS6 as target gene, design may interfere with double-strand siRNA of RGS6 expression, after being chemically synthesized, is injected into people Body makes XX gene silencing treat fatty liver and/or type II diabetes by the method that RNA disturbs；Can also design and build The mutant of RGS6, enters cell, the substrate specificity of competition RGS6 original shape, thus suppressing the function of RGS6, playing and controlling after injection Treat purpose；Further, it is also possible to RGS6 for shot design micromolecular compound inhibitor, external using RGS6 gene overexpression Cell model or animal model, by screening, find wherein be capable of specificity suppression RGS6 molecule, thus for fatty liver and/ Or the treatment of type II diabetes provides new therapeutic molecules.

For the above-mentioned functions of RGS6, provide RGS6 as drug targets in screening protection liver and glycometabolic medicine Application.

For the above-mentioned functions of RGS6, provide RGS6 as drug targets in screening prevention, alleviation and/or treatment fatty liver And/or the application in the medicine of type II diabetes.

For the above-mentioned functions of RGS6, provide the inhibitor of RGS6 preparation prevention, alleviate and/or treatment fatty liver and/ Or the application in the medicine of type II diabetes.

The medicine of a kind of prevention, alleviation and/or treatment fatty liver and/or type II diabetes, comprises the inhibitor of RGS6.

The inhibitor of described RGS6 is preferably the rna interference vector of siRNA, RGS6 gene of RGS6 gene, RGS6's Antibody and other can suppress RGS6 expression inhibitor.

The present invention has such advantages as with respect to prior art and effect：

(1) present invention discover that the New function of RGS6, that is, RGS6 has the effect deteriorating fatty liver and type II diabetes.

(2) based on RGS6 deteriorating the function in fatty liver and type II diabetes disease, its be develop prevention, alleviate and/ Or the medicine for the treatment of fatty liver and/or type II diabetes provides target.

(3) inhibitor of RGS6 can be used for preparing the medicine of prevention, alleviation and/or treatment fatty liver and/or type II diabetes Thing.

Brief description

Fig. 1 is the target practice policy map building RGS6 conditionity knock-out mice.

Fig. 2 is the body weight of WT and RGS6-KO mouse, fasting blood-glucose result figure；

A is Mouse Weight result figure, and B is fasting blood glucose level statistical chart (*：P ＜ 0.05vs WT NC group, * *：P ＜ 0.01vs WT NC group, #：P ＜ 0.05vs WT HFD group, ##：P ＜ 0.01vs WT HFD group).

Fig. 3 is that WT and RGS6-KO mouse passes through lumbar injection glucose tolerance result figure；

A is different time points mouse blood sugar level statistic figure after lumbar injection glucose, and B is each group glucose tolerance in mice TG-AUC (area under the curve, AUC) comparison diagram (* *：P ＜ 0.01vs WT NC group, ##：P ＜ 0.01vs WT HFD group).

Fig. 4 is the liver weight result figure of RGS6-KO and WT mouse；

A counts block diagram for liver weight, and B is liver weight and mouse weight ratio Data-Statistics block diagram (## itself：P ＜ 0.01vs WT HFD group).

Fig. 5 is the liver function measurement result figure of WT and RGS6-KO mouse；

Take AST, ALT and ALP that mouse liver function is detected respectively.(##：P ＜ 0.01vs WT HFD group).

Specific embodiment

By combination accompanying drawing described further below it will be further appreciated that the features and advantages of the invention.The enforcement being provided Example is only the explanation to the inventive method, and limits remaining content of present invention announcement never in any form.

Animal for research and raising：

Animal used as test kind, sex, week old and source：C57BL/6 mouse (WT) and RGS6 liver specific genes knock out (RGS6-KO) mouse, male, 8 week old.C57BL/6 mouse is purchased from Beijing Fukang bio tech ltd of China, and RGS6 liver is special Specific gene knock-out mice (RGS6-KO) is specific expressed with by protein promoter control, liver cell by RGS6-floxed mouse Cre transgenic mice Albumin-Cre (purchased from The Jackson Laboratory, article No. 003574) hybridization obtain.

The structure of liver specificity RGS6 knock out mice：

According to gene information, using CRISPR Design (network address：http://crispr.mit.edu/) including respectively The target practice site of a CRISPR is respectively designed in son 4 and 5.Target sequence is respectively：

RGS6-sRNA 1：GGTCACAGCATCATGCTGTAGGCGA TGG

RGS6-sRNA 2：ggAGTGGACACCACCCGTCTTACAA AGG

In addition have also been devised one for the donor plasmid (Donor Vector) that homology is repaired, it includes both sides homology Arm, middle extron 5 and two loxp sequences in the same direction, construction strategy is shown in Fig. 1.

1. the structure of targeting vector：Respectively corresponding for sgRNA1 and sgRNA2 two primers are fused into double-stranded DNA, then It is connected in the pUC57-sgRNA carrier that restriction enzyme BsaI was processed with T4DNA ligase.This carrier upstream has one Individual T7 promoter, can be used for follow-up In vitro transcription.

2. the structure of donor vehicle (Donor Vector)：According to design of primers principle, design following primer (table 1) and be used for The amplification left and right homology arm (LA and RA) of donor vehicle and the extron part (M) of centre.Expand the product obtaining through in table 1 Obtain 3 fragments after shown digestion with restriction enzyme, it is connected into respectively conditionity and knocks out skeleton carrier pBluescript SK (+) in -2loxp, obtain Donor Vector.

Table 1 builds primer sequence needed for donor vehicle and corresponding restriction enzyme site

3. the transcription of targeting vector：Two parts (Cas9 egg of responsible dissection that CRIPR/Cas9 system is comprised White and guiding Cas9 albumen navigates to the gRNA of target site) transcribed respectively.For Cas9 albumen, by its expression vector (pST1374-Cas9) carry out digestion with PmeI, to reclaim linearization plasmid after purification as transcription templates, use T7mMESSAGE MMACHINE kit (AM1345, Ambion) carries out in-vitro transcription, obtains the mRNA product capping.And with Poly (A) Tailing kit (Ambion), to above-mentioned product tailing, obtains ripe mRNA product；For sgRNA, use MEGAshortscript^TMKit (AM1354, Ambion company) carries out in-vitro transcription.Cas9's and sgRNA that transcription is obtained MRNA is purified using miRNeasy Micro Kit (Qiagen, 217084).

4. the making of RGS6-floxed conditionity knock-out mice

Above-mentioned ripe mRNA product is together injected in mouse fertilized egg with donor plasmid, is transplanted in replace-conceive dams body Cultivated.The mouse obtaining is identified.Take out the mouse toe after raw a week or tail tissue, extract genome, and lead to Cross the positive head of PCR method screening and build mouse.Select one at random and be only used as F0 for after carrying out from the mouse determining generation homologous recombination Continuous breeding, final acquisition RGS6-floxed Mice homozygous.

5. the making of liver specificity RGS6 knock out mice

Above-mentioned RGS6-floxed mouse is mated with liver specificity Albumin-Cre transgenic mice, screening obtains RGS6^{floxed/floxed}/ Albumin-Cre mouse, after about this mouse length to 6 week old, lumbar injection Tamoxifen, induction The expression of Cre enzyme, two loxp in the same direction of identification of Cre enzyme spcificity, and excise sequence between the two and one of Loxp, finally obtains liver cell specificity RGS6 knock out mice.

Animal used as test feed formula：High lipid food (HFD) is (purchased from Beijing Fukang bio tech ltd of China, article No. D12942)：Percent of calories：Protein:20%；Carbohydrate:20%；Fat:60%, total thermal mass ratio: 5.24kcal/g.Low fat feed (NC) (purchased from Beijing Fukang bio tech ltd of China, article No. D12450B)：Heat percentage Than：Protein:20%；Carbohydrate:70%；Fat:10%, total thermal mass ratio:3.85kcal/g.

Feeding environment and condition：SPF level Experimental Animal Center, room temperature between 22-24 DEG C, humidity between 40-70%, It is 12h that light and shade replaces lighting hours, and free water is ingested.

【Embodiment 1】Mouse fatty liver, type II diabetes model (diet induced obesity, DIO) obtain

(1) animal used as test packet：From 8 week old, male, WT mouse and RGS6-KO mouse, give two kinds respectively and special raise Material D12942 high lipid food (High fat diet, HFD) and D12450B low fat feed (Normal chow, NC) are raised, i.e. WT NC group, KO NC group, WT HFD group, KO HFD group totally 4 groups.

(2) model induces operating process by high lipid food：

Using WT and KO mouse, set up DIO model, carry out phenotype correlation analysis, specify RGS6 gene pairs fatty liver, II type The effect that diabetes play.From 8 week old, male, WT mouse and RGS6-KO mouse, give two kinds of special feeds respectively D12942 high lipid food (Highfat diet, HFD) and D12450B low fat feed (Normal chow, NC) are raised, i.e. WT NC Group, KO NC group, WT HFD group, KO HFD group totally 4 groups.Weekly all in detail record mouse food ration, mouse empty body weight and Fasting blood-glucose detected 1 time every 4 weeks.Test the 14th week, carry out lumbar injection glucose experiment (IPGTT), to evaluate mouse machine Body is to glucose tolerance.Draw materials in whole end within 16th week.

【Embodiment 2】Mouse Weight, determination of blood glucose level

(1) mouse empty body weight, appetite detects

1) body weight detection.

1. fasting：The morning 8:00 will treat experiment mice fasting (can't help water), afternoon 2:00 beginning experimental implementation.

2. weigh：Weighed at the 0th week, 4 weeks, 8 weeks, 12 weeks respectively, a plastics keg is placed on dynamic electron balance, grabs Play mouse, put in weighing keg, measure body weight record data.Forage volume detects：Wait to weigh after the completion of operation, to mouse plus Feed, and the forage volume of mouse is recorded on dynamic electron balance.

(2) fasting blood glucose level test experience

By the mouse being needed to be tested from the morning 8:00 to afternoon 2:00 fasting (can't help water), i.e. fasting was opened after 6 hours Beginning experimental implementation.

1. blood glucose meter prepares：Check blood glucose meter (Johnson Co., ONETOUCH) battery, by right-side switch, by test paper It is properly placed left side slot, screen display and the numeral of blood sugar test paper bar respective code, subsequently show pattern of bleeding, point out blood sugar Instrument enters state to be measured.

2. fix mouse：The right hand grabs rat-tail, and left hand holds one piece of towel, and towel doubling pinches towel with thumb and forefinger Fold position, mouse head and body is wrapped into the towel in palm, and rat-tail root is being fixed by thumb and forefinger.

3. cut tail：Eye scissors is cutting rat-tail rapidly at the 0.1-0.2cm of rat-tail end, treats that drop of blood voluntarily flows out.

4. blood sugar test：Blood glucose meter test paper edge is touched drop of blood, blood immerses test paper, blood glucose meter countdown display in 5 seconds Reading.

The evaluation index of type II diabetes injury severity score mainly includes the levels such as body weight, blood sugar, body weight, change of blood sugar After result is as shown in figure 1, give the RGS6-KO mouse HFD feed of 12 weeks and the raising of NC feed, started HFD group from the 2nd week RGS6-KO Mouse Weight is significantly lower than the WT Mouse Weight of HFD group, is continued until the 12nd week (see Fig. 2A)；Through fasting blood-glucose Detection finds mouse in HFD group from the fasting blood glucose level of the 4th week substantially more corresponding NC control group rising, the RGS6- of HFD group KO mouse fasting blood glucose level is also significantly lower than WT group mouse fasting blood glucose level (see Fig. 2 B).Show after showing RGS6 gene knockout Write and have impact on glycometabolism stable state under HFD raising state for the mouse, RGS6 gene can significantly reduce the Sugar metabolism ability of mouse, table Bright RGS6 gene plays an important role in the type II diabetes that the induction of high fat causes.

【Embodiment 3】Glucose tolerance test (intraperitoneal glucose tolerance test, IPGTT)

Test the 12nd week, carry out lumbar injection glucose experiment (IPGTT), to evaluate mouse body to sugared tolerance.

(1) before surveying blood sugar, first measure the empty body weight of mouse, calculate the volume injected of glucose according to 10 μ L/g.

(2) it is fasting blood-glucose when 0 minute before first detecting glucose sugar injection, rapidly through lumbar injection grape after detection finishes Liquid glucose.

(3) lumbar injection method of operating：1. fix mouse；Pick up mouse, the little finger of toe of left hand and the nameless tail grabbing mouse Bar, another three fingers catch the neck of mouse, make the head of mouse downwards, mouse web portion is fully exposed.2. inserting needle positioning and note Penetrate：From the right hand syringes of belly side inserting needle, hour hands are injected in the most advanced and sophisticated angle at 45 ° with mouse web portion, inserting needle, pumpback Head walks a small distance in subcutaneous abdomen, enters abdominal cavity in belly opposite side, after having injected medicine, slowly through after ventrimeson Extract syringe needle, and slight rotating needle, prevent leakage.

(4) 15 points after lumbar injection, 30 points, 60 points, 120 minutes points cut tail and survey mouse blood sugar value, and remember Record blood sugar numerical value and detection time.

Pass through lumbar injection glucose tolerance test (intraperitoneal glucose further Tolerancetests, IPGTT) to assess the disposal ability to glucose for each group mouse, testing the 12nd week, by injection After the glucose of 1.0g/kg body weight, the WT mouse of HFD group and RGS6-KO mouse blood sugar level reach in 15 minutes points sharp increase To peak value, elapse over time to injecting latter 30 minutes, KO group mouse blood sugar level somewhat declines, WT group mouse blood after 60 minutes Sugar level begins to decline, but the two is still in higher than fasting blood glucose level (blood sugar when 0 minute), little constantly recovers on an empty stomach 2 Blood sugar level, and the blood sugar level (figure that RGS6-KO mouse blood sugar level was constantly in less than WT mouse from 0 minute to 2 hours 3A).Relatively each group mouse blood sugar TG-AUC (area under the curve, AUC), finds the AUC of WT mouse HFD group It is significantly higher than NC group, the AUC of RGS6-KO HFD group, significantly less than the AUC (Fig. 3 B) of WT HFD group, shows RGS6 to maintenance sugar generation Thank to stable state and there is powerful ability of regulation and control.

【Embodiment 4】Liver general appearance and liver organization lipid components measure

(1) end liver organization is drawn materials eventually

1), after mouse weights, take off rapidly neck and put to death.Lie on the back fixing mouse, and with distilled water by mouse chest, belly hair moistens Wet.

2) hit exactly skin with a tweezers clamp mouse web portion, hit exactly along belly and cut off skin to xiphoid-process to head, to tail Skin is cut off at end, successively exposes subcutaneous fascia, muscle etc., opens abdominal cavity, fully exposes each internal organs.

3) quickly find and take off the liver of mouse, the liver specimens taken off are placed on sterile gauze, wipe dry liver table Remained blood on face, liver is placed in sterile petri dish, takes pictures rapidly, weigh.

(2) liver functional testing

1) open computer labman software, printer, be then turned on Biochemical Analyzer；

2) select and clean detection probe, cuvette etc. it is ensured that probe is unobstructed, the attachment of cuvette free from admixture, light absorption value exists The term of reference setting；

3) serum specimen to be detected is found out from -80 DEG C of refrigerators；Melt multiple at room temperature for serum to be detected to liquid State, prepares detection；

4) whether enough Testing index reagent needed for checking on labman software, set Testing index and detection ordering Deng；

5) add blood serum sample 50 μ l to be checked, start to detect；

6) to be detected finish after record detection numerical value.

Liver weight and liver weight with Mouse Weight ratio result as shown in Figure 4, HFD group RGS6-KO mouse no By liver weight or liver weight with mouse body weight ratio itself all compared with the WT mouse of HFD group low (as Fig. 4).Liver function further Can detection show, HFD group mouse liver function substantially relatively NC group is poor, and the three of RGS6-KO mouse kinds of liver enzyme (AST (glutamic-oxalacetic transaminease), ASLT (glutamic-pyruvic transaminase), ALP (alkaline phosphatase)) all compared with the WT mouse of HFD group lower (as Fig. 5).These result explanations The fatty liver of RGS6 knock out mice is clearly better.

The above results display RGS6-KO the mouse type II diabetes occurring and fatty live lesions under the induction of HFD are notable Mitigate.These results show that RGS6 gene pairs increases type II diabetes and fatty liver has obvious action.Result of the present invention is said Bright RGS6 gene has important facilitation in fatty liver, type II diabetes disease model.

Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not subject to above-described embodiment Limit, other any Spirit Essences without departing from the present invention and the change made under principle, modification, replacement, combine, simplify, All should be equivalent substitute mode, be included within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhan University

<120>The G-protein Signal Regulation factor 6 and its inhibitor function and application in treatment fatty liver and type II diabetes

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 28

<212> DNA

<213> RGS6-sRNA1

<400> 1

ggtcacagca tcatgctgta ggcgatgg 28

<210> 2

<211> 28

<212> DNA

<213> RGS6-sRNA2

<400> 2

ggagtggaca ccacccgtct tacaaagg 28

<210> 3

<211> 50

<212> DNA

<213> RGS6 LA-F

<400> 3

tcgagtgccc accatgagca gagggagtca tcatcggtgc catcggacgt 50

<210> 4

<211> 42

<212> DNA

<213> RGS6 LA-R

<400> 4

ccgatggcac cgatgatgac tccctctgct catggtgggc ac 42

<210> 5

<211> 30

<212> DNA

<213> RGS6 M-F

<400> 5

ccggaattcc ctacagcatg atgctgtgac 30

<210> 6

<211> 28

<212> DNA

<213> RGS6 M-R

<400> 6

cgggatccta agacgggtgg tgtccact 28

<210> 7

<211> 47

<212> DNA

<213> RGS6 RA-F

<400> 7

cgcgtcaaag gagagctggg gcactcagag aatggcctcg gctttgc 47

<210> 8

<211> 47

<212> DNA

<213> RGS6 RA-R

<400> 8

ggccgcaaag ccgaggccat tctctgagtg ccccagctct cctttga 47

Claims

The application in screening protection liver and glycometabolic medicine as drug targets of 1.RGS6 gene.
2. according to claim 1 application it is characterised in that：Described medicine is the medicine of suppression RGS6 gene expression； Described application is non-diagnostic and non-treatment.
3.RGS6 gene is as drug targets in screening prevention, alleviation and/or treatment fatty liver, the medicine of type II diabetes Application.
4. according to claim 3 application it is characterised in that：Described medicine is the medicine of suppression RGS6 gene expression； Described application is non-diagnostic and non-treatment.
5. the medicine of a kind of prevention, alleviation and/or treatment fatty liver and/or type II diabetes, the phase is characterised by, comprises RGS6's Inhibitor.
6. medicine according to claim 5 it is characterised in that：The inhibitor of described RGS6 is preferably RGS6 gene The rna interference vector of siRNA, RGS6 gene, the antibody of RGS6 and other can suppress RGS6 expression inhibitor.