CN106362166A - Functions and application of tumor necrosis factor receptor related truss and signal protein in treatment of fatty liver and type II diabetes - Google Patents

Abstract

The invention discloses functions and application of a TRUSS gene in fatty liver and diabetes disease. A TRUSS knockout mouse and a wild type C57 mouse are used as experiment objects; by means of a high-diet diet induced obese mouse model, the result shows that compared with the wild type C57 mouse, the body weight of the TRUSS gene knockout mouse is reduced, and the fasting plasma glucose level of the TRUSS gene knockout mouse is lower than that of a control group WT mouse. By an intraperitoneal injection glucose tolerance test, the result shows that the endurance capacity of the TRUSS gene knockout mouse to glucose is remarkably enhanced. The weight of mouse liver, the ratio of the liver to the body weight, lipid components, glycogen content pathological staining results and the like show that the fatty liver disease of a high fat diet TRUSS-KO mouse is significantly reduced, lipid accumulation is remarkably reduced, and the liver damage degree is significantly reduced. Therefore, TRUSS can be used as a target of screening a medicine for treating the fat liver and/or the type II diabetes; an inhibitor of the TRUSS can be used for preparing a medicine for treating the fat liver and/or the type II diabetes.

Description

The related general support of Tumor Necrosis Factor Receptors and signal protein in treatment fatty liver and Function and application in patients with type Ⅰ DM

Technical field

The invention belongs to the function of gene and application, particularly to a kind of related general support of Tumor Necrosis Factor Receptors With signal protein gene (tumor necrosis factor receptor-associated ubiquitous Scaffolding and signaling protein, truss) and/or treat in screening prevention, alleviation as drug targets Apply in the medicine of fatty liver and/or patients with type Ⅰ DM.

Background technology

With the raising of human living standard, living-pattern preservation, the sickness rate of diabetes is constantly rising and is being in The feature now globalizing and becoming younger.According to statistics, global diabeticss are more than 300,000,000 people, wherein patients with type Ⅰ DM (type 2diabetes mellitus, t2dm) account for more than 90%, to the year two thousand thirty, number of patients will exceed 400,000,000.It should be noted that working as In front children and adolescents and Young Patients, t2dm early stage sickness rate increases severely, and this also means that the morbidity in following diabetes Crowd will be enlarged by, and difficulty of prevention and cure will greatly increase.Currently existing many drug targets are found and are applied to diabetes to control Treatment field, but due to target spot mechanism problem, much there is hypoglycemia, cardiovascular event, body weight increase in traditional anti-t2dm medicine Deng side effect, which has limited their use.In recent years, for the anti-diabetic of the target spots such as dpp-4, glp-1r and sglt2 New drug shows relatively low side effect risk and good hypoglycemic effect, but sugar still can not fundamentally be treated by these medicines Urine disease.Therefore, people seeking treatment always effect more preferably, the higher antidiabetic medicine of patient's compliance.

Non-alcohol fatty liver (non-alcoholic fatty liver disease, nafld) is one kind no mistake People taken the photograph by amount ethanol, stores up, with hepatic parenchymal cellses steatosis and fat, the clinical pathology syndrome being characterized.Simple fatty liver It is not static constant, if not taking any measure to develop as one pleases, it can progress to non-alcoholic stellato-hepatitis (non-alcoholic steatohepatitis, nash), hepatic fibrosis, liver cirrhosis, or even hepatocarcinoma, develop into liver cirrhosis or The ratio of hepatocarcinoma is respectively 5%～10% and 1%～2%.Additionally, fatty liver also can damage digestive system function, reduce human body Immunity, the function of detoxification that weakens, affect hormone metabolism, have had a strong impact on the healthy of people and quality of life, also give society Bring heavy burden.Because the pathogenesis of nafld are not yet completely clear and definite, and still lack effective treatment meanss, mainly at present To put prevention first.

Because the sickness rate of nafld in recent years increases rapidly and in the trend that becomes younger, it receives extensive concern.With people Growth in the living standard and living-pattern preservation, t2dm merge nafld prevalence just increase year by year.Result of study shows Show, in diabetic population, nafld prevalence may be up to 80%^[1].In some patients, Liver fatty deposition is probably to affect The principal element of its t2dm development^[2].On the other hand, if t2dm controls not good or abundant development, not only promote fatty liver life Become, and so that hepatic injury is increased, or even form non-alcoholic stellato-hepatitis, hepatic fibrosises, liver cirrhosis and hepatocarcinoma^[3]. The patient not as good as t2dm nonjoinder nafld for the ability of the Patients' rights blood glucose of t2dm merging nafld^[4].T2dm merges nafld will Greatly increase the mortality risk leading to due to liver cirrhosis, hepatocarcinoma and cardiovascular complication^[5].At present although controlling hyperlipemia Disease still needs to be probed into the therapeutical effect in nafld patient in t2dm, but the treatment of nafld mainly include for diabetes and The positive control of cardiovascular risk factors.Research shows, in the patient merging t2dm and nafld, only thiazolidinedioneses Medicine pioglitazone shows being obviously improved of liver histological.Therefore, we still suffer from greatly for the diagnoses and treatment of nafld Challenge.It is following that we should formulate special screening criteria and therapeutic scheme to being applied to clinical t2dm and nafld patient, The patient that especially t2dm and nafld merges.

Tumor Necrosis Factor Receptors associated protein (truss) is the tnf- that a molecular weight recently reported is about 91kda R1 associated proteins, expression extensively, but is enriched in heart, liver and testis tissue.Sequence analysis show that truss's comprises residue The c- stub area of 440-797 is the highly enriched region of a leucine, and comprises double leucines and the acid of multiple supposition Property cluster internalization pattern.In addition, truss comprises five (p/s/a/t) x (q/e) e or strusse concensus sequences and traf-2 knot Syntype, the wherein four n- ends being located at truss, one is located at c- end.Research shows that truss can be by raising one kind Ddb1 (damage-specific dna-binding protein 1) cul4 (cullin 4) e3 ubiquitination ligase is combined Body, adjusts the degraded of proto-oncogene myc, plays certain effect in development of cancer^[6]；In addition, truss can be with cell week The special e3 ligase skp2 of phase s phase combines, and leads to the ubiquitination of truss and the degraded of following proteasome mediation^[7].Though So the molecular function for truss has certain understanding, but its effect under physio-pathological condition there is no report, Effect in fatty liver, diabetes for the truss even more needs to be explored.

List of references:

1.fan jg,farrell gc.epidemiology of non-alcoholic fatty liver disease in china.j hepatol.2009；50:204-210

2.loria p,lonardo a,anania f.liver and diabetes.a vicious circle.hepatol res.2013；43:51-64

3.smith bw,adams la.nonalcoholic fatty liver disease and diabetes mellitus:pathogenesis and treatment.nat rev endocrinol.2011；7:456-465

4.williamson rm,price jf,glancy s,perry e,nee ld,hayes pc,frier bm, van look la,johnston gi,reynolds rm,strachan mw.prevalence of and risk factors for hepatic steatosis and nonalcoholic fatty liver disease in people with type 2 diabetes:the edinburgh type 2 diabetes study.diabetes care.2011； 34:1139-1144

5.cusi k.treatment of patients with type 2 diabetes and non-alcoholic fatty liver disease:current approaches and future directions.diabetologia.2016；59:1112-1120

6.choi sh,wright jb,gerber sa,cole md.myc protein is stabilized by suppression of a novel e3 ligase complex in cancer cells.genes dev.2010；24: 1236-1241

7.jamal a,swarnalatha m,sultana s,joshi p,panda sk,kumar v.the g1 phase e3 ubiquitin ligase truss that gets deregulated in human cancers is a novel substrate of the s-phase e3 ubiquitin ligase skp2.cell cycle.2015；14: 2688-2700

Content of the invention

For solving defect and the deficiency of above-mentioned prior art, it is an object of the invention to provide a kind of table of truss gene Reach the mutual relation and fatty liver, patients with type Ⅰ DM between, a target gene for treating fatty liver, patients with type Ⅰ DM is provided The new application of truss, and then truss gene is applied to the treatment of fatty liver, patients with type Ⅰ DM.

The purpose of the present invention is achieved through the following technical solutions:

The present invention, with wild type c57 mice and truss knock out mice as experimental subject, is induced by high fat diet Mice model of obesity (diet induced obesity, dio) study truss gene function, it is found that with wild type wt Mice contrasts, and the body weight of truss knock out mice is significantly lower than the wt mice that feedstuff of the same race is raised, and presentation is lighter obesity State, and the fasting blood glucose level of truss knock out mice is also below matched group wt mice.Pass through lumbar injection further Glucose tolerance test finds that truss knock out mice is remarkably reinforced to the tolerance of glucose.From mouse liver weight And liver/weight ratio and lipid components, glycogen content pathological staining result etc. all illustrate hfd group (high fat diet, height Fat diet) truss-ko mouse adipose liver pathological changes substantially mitigate, accumulation of lipid substantially reduces, and hepatic injury degree substantially mitigates. This shows that truss gene knockout can delay the generation of fatty liver, patients with type Ⅰ DM, and truss gene can promote fatty liver, type The generation of diabetes.

Therefore, truss gene as drug target, can build In vitro cell model or the animal of truss gene overexpression Model, for the medicine of screening prevention, alleviation and/or treatment fatty liver and/or patients with type Ⅰ DM；Truss gene also can conduct Target gene in gene therapy, design and prepare prevention, alleviate and/or treatment fatty liver and/or patients with type Ⅰ DM medicine and/ Or biological reagent, reach prevention, alleviate and/or treat the mesh of fatty liver and/or patients with type Ⅰ DM by technique for gene engineering 's.For example with truss as target gene, design may interfere with double-strand sirna of truss expression, after being chemically synthesized, note Injecting human body makes truss gene silencing treat fatty liver and/or patients with type Ⅰ DM by the method that rna disturbs；Can also set Counting and build the mutant of truss, entering cell after injection, the substrate specificity of competition truss original shape, thus suppress truss's Function, plays therapeutic purposes；Further, it is also possible to truss for shot design micromolecular compound inhibitor, using truss base Because of In vitro cell model or the animal model of overexpression, by screening, find wherein to be capable of the molecule of specificity suppression truss, Thus providing new therapeutic molecules for the treatment of fatty liver and/or patients with type Ⅰ DM.

For the above-mentioned functions of truss, provide truss as drug targets in screening patron saint's liver and glycometabolic medicine Application in thing.

For the above-mentioned functions of truss, provide truss as drug targets in screening prevention, alleviation and/or treatment fat Application in the medicine of liver and/or patients with type Ⅰ DM.

For the above-mentioned functions of truss, the inhibitor providing truss is in preparation prevention, alleviation and/or treatment fatty liver And/or the application in the medicine of patients with type Ⅰ DM.

The medicine of a kind of prevention, alleviation and/or treatment fatty liver and/or patients with type Ⅰ DM, comprises the inhibitor of truss.

The inhibitor of described truss is preferably the rna interference carrier of sirna, truss gene of truss gene, The antibody of truss and other can suppress truss expression inhibitor.

The present invention has such advantages as with respect to prior art and effect:

(1) present invention discover that the New function of truss, that is, truss has the effect deteriorating fatty liver and patients with type Ⅰ DM.

(2) based on truss deteriorating the function in fatty liver and patients with type Ⅰ DM disease, its be develop prevention, alleviate and/ Or the medicine for the treatment of fatty liver and/or patients with type Ⅰ DM provides target.

(3) inhibitor of truss can be used for preparing the medicine of prevention, alleviation and/or treatment fatty liver and/or patients with type Ⅰ DM Thing.

Brief description

Fig. 1 is truss liver specific genes knock-out mice construction strategy figure.

Fig. 2 is the body weight of wt and truss-ko mice, fasting glucose result figure；

A is Mouse Weight result figure, and b is fasting blood glucose level cartogram (*: p ＜ 0.05vs wt nc group, #:p ＜ 0.05vs wt hfd group).

Fig. 3 is that wt and truss-ko mice passes through lumbar injection glucose tolerance result figure；

A is different time points mouse blood sugar level statistic figure after lumbar injection glucose, and b is each group glucose tolerance in mice Area under curve (area under the curve, auc) comparison diagram (*: p ＜ 0.05vs wt nc group, #:p ＜ 0.05vs wt Hfd group).

Fig. 4 is liver weight, the liver weight and mice weight ratio Data-Statistics block diagram of truss-ko and wt mice itself (#:p ＜ 0.05vs wt hfd group).

Fig. 5 is oil red o and the staining for glycogen figure of wt and truss-ko and wt mice.

Specific embodiment

By combination accompanying drawing described further below it will be further appreciated that the features and advantages of the invention.The enforcement being provided Example is only the explanation to the inventive method, and limits remaining content of present invention announcement never in any form.

Animal for research and raising:

Laboratory animal kind, sex, week old and source: c57bl/6 (wt) mice and truss liver specific genes knock out (truss-ko) mice, male, 8 week old.C57bl/6 mice is purchased from Beijing Fukang bio tech ltd of China, truss liver Specific gene knock-out mice (truss-ko) is by truss-floxed mice and by protein promoter control, hepatocyte specificity The cre transgenic mice albumin-cre (purchased from the jackson laboratory, article No. 003574) of expression hybridizes Arrive, construction strategy is shown in Fig. 1.

The structure of liver specificity truss knock out mice:

According to gene information, included respectively using crispr design (network address: http://crispr.mit.edu/) The target practice site of a crispr is respectively designed in son 3 and 4.Target sequence is respectively

Truss-srna1:ggctgagtgtctctacgcaacta agg

Truss-srna2:ggcttgaccccgcctccgttttct tgg

In addition have also been devised one for the donor plasmid (donor vector) that homology is repaired, it includes both sides homology Arm, middle exon 4 and two loxp sequences in the same direction.

1. the structure of targeting vector: respectively corresponding for sgrna1 and sgrna2 two primers are fused into double-strand dna, then It is connected in the puc57-sgrna carrier that restricted enzyme bsai was processed with t4dna ligase.This carrier upstream has one Individual t7 promoter, can be used for follow-up In vitro transcription.

2. conditionality knock out skeleton carrier pbluescript sk (+) structure of -2loxp:

It is respectively synthesized 4 oligomerization single stranded nucleotide sequence:

Loxp1-f:

Agcttgacgtcataacttcgtatagcatacattatagcaatttataccggtgat,

Loxp1-r:

atcaccggtataaattgctataatgtatgctatacgaagttatgacgtca；

Loxp2-f:

Gatcccttaagataacttcgtatagcatacattatagcaatttatacgcgta,

Loxp2-r:

ctagtacgcgtataaattgctataatgtatgctatacgaagttatcttaagg；

Form two double-strands of loxp1 and loxp2 after above-mentioned oligonucleotide sequence annealing.By pbluescript iisk (+) Carrier with connect after hindiii (neb, r0104l) and ecorv (neb, r0195l) double digestion into loxp1 anneal double-strand, then will Be sequenced correct carrier bamhi (neb, r0136l) and spei (neb, r0133l) double digestion, connects double into loxp2 annealing Chain, obtain conditionality knock out skeleton carrier, be named as pbluescript sk (+) -2loxp.

3. the structure of donor vehicle (donor vector): according to design of primers principle, design following primer (table 1) and be used for The amplification left and right homology arm (la and ra) of donor vehicle and exon part (m) of centre.Expand the product obtaining through in table 1 Obtain 3 fragments after shown digestion with restriction enzyme, it is connected into respectively conditionality and knocks out skeleton carrier pbluescript Sk (+) in -2loxp, obtain donor vector.

Table 1 builds primer sequence needed for donor vehicle and corresponding restriction enzyme site

Primer	Primer sequence	Restriction enzyme site
			truss la-f	ccgctcgaggctcagactccagttgaacattta	xhoi
truss la-r	atggacgtcctaaggagcatctctgaagaatct	aatii
			truss m-f	tctaccggtttgcgtagagacactcagggat	agei
truss m-r	cgggatccaaacggaggcggggtcaa	bamhi
			truss ra-f	cgacgcgttcttgggaggtttttatgctg	mlui
truss ra-r	ataagaatgcggccgcgcctgtctgaggaatgtggt	noti

4. the transcription of targeting vector: two parts (cas9 egg of responsible dissection that cripr/cas9 system is comprised White and guiding cas9 albumen navigates to the grna of target site) transcribed respectively.For cas9 albumen, by its expression vector (pst1374-cas9) carry out enzyme action with pmei, to reclaim linearization plasmid after purification as transcription templates, use t7mmessage Mmachine test kit (am1345, ambion) carries out in vitro transcription, obtains the mrna product capping.And with poly (a) Tailing test kit (ambion), to above-mentioned product tailing, obtains ripe mrna product；For sgrna, use megashortscript^tmKit (am1354, ambion company) carries out in vitro transcription.Cas9's and sgrna that transcription is obtained Mrna carries out purification using mirneasy micro kit (qiagen, 217084).

5. the making of truss-floxed conditionality knock-out mice

Above-mentioned ripe mrna product is together injected in mouse fertilized egg with donor plasmid, is transplanted in replace-conceive dams body Cultivated.The mice obtaining is identified.Take out the mice toe after raw a week or tail tissue, extract genome, and lead to Cross the positive head of pcr method screening and build Mus.From the mice determining generation homologous recombination, random choose one is only used as f0 for after carrying out Continuous breeding, final acquisition truss-floxed Mice homozygous.

6. the making of liver specificity truss knock out mice

Above-mentioned truss-floxed mice is copulationed with liver specificity albumin-cre transgenic mice, screening obtains truss^{floxed/floxed}/ albumin-cre mice, after about this mice length to 6 week old, lumbar injection tamoxifen, lure Lead the expression of cre enzyme, two loxp in the same direction of identification of cre enzyme spcificity, and excise sequence between the two and therein one Individual loxp, finally obtains liver cell specificity truss knock out mice.

Laboratory animal feed formula: high lipid food (hfd) is (purchased from Beijing Fukang bio tech ltd of China, article No. D12942): percent of calories: protein: 20%；Carbohydrate: 20%；Fat: 60%, total thermal mass ratio: 5.24kcal/g.Low fat feedstuff (nc) (purchased from Beijing Fukang bio tech ltd of China, article No. d12450b): heat percentage Than: protein: 20%；Carbohydrate: 70%；Fat: 10%, total thermal mass ratio: 3.85kcal/g.

Feeding environment and condition: spf level Experimental Animal Center, room temperature between 22-24 DEG C, humidity between 40-70%, It is 12h that light and shade replaces lighting hours, and free water is ingested.

[embodiment 1] mouse fatty liver, patients with type Ⅰ DM model (diet induced obesity, dio) obtain

(1) laboratory animal packet: from 8 week old, male, wt mice and truss-ko mice, give respectively two kinds special Feedstuff d12942 high lipid food (high fat diet, hfd) and d12450b low fat feedstuff (normal chow, nc) are raised, that is, Wt nc group, ko nc group, wt hfd group, ko hfd group totally 4 groups.

(2) model is by high lipid food induction operating process:

Using wt and ko mice, set up dio model, carry out phenotype correlation analysis, specify truss gene pairss fatty liver, The effect that patients with type Ⅰ DM plays.From 8 week old, male, wt mice and truss-ko mice, give two kinds of special feedstuffs respectively D12942 high lipid food (highfat diet, hfd) and d12450b low fat feedstuff (normal chow, nc) are raised, i.e. wt nc Group, ko nc group, wt hfd group, ko hfd group totally 4 groups.Equal itemized record mice food ration weekly, mice empty body weight and Fasting glucose detected 1 time every 2 weeks.Test the 10th week, carry out lumbar injection glucose experiment (ipgtt), to evaluate mice machine Body is to glucose tolerance.Draw materials in whole end within 12nd week, takes out mouse liver and weighs, then a part is placed in formalin admittedly Fixed or o.c.t frozen section embedding medium (tissue freezing medium) embedding is used as pathological analysis.

[embodiment 2] Mouse Weight, determination of blood glucose level

(1) mice empty body weight, appetite detects

1) body weight detection.

1. fasting: morning 8:00 will treat experiment mice fasting (can't help water), and afternoon, 2:00 started experimental implementation.

2. weigh: weigh the 0th week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 10 weeks and 12 weeks respectively, a plastics keg is placed on dynamic On state electronic balance, pick up mice, put in weighing keg, measure body weight record data.Forage volume detects: waits operation of weighing After the completion of, to mice plus feedstuff, and the forage volume of mice is recorded on dynamic electron balance.

(2) fasting blood glucose level test experience

By the mice being needed to be tested from morning 8:00 to afternoon 2:00 between fasting (can't help water), i.e. fasting opens after 6 hours Beginning experimental implementation.

1. blood glucose meter prepares: checks blood glucose meter (Johnson Co., onetouch) battery, by right-side switch, by reagent paper It is properly placed left side slot, screen display and the numeral of blood sugar test paper bar respective code, subsequently show pattern of bleeding, point out blood glucose Instrument enters state to be measured.

2. fix mice: the right hand grabs rat-tail, and left hand holds one piece of towel, and towel doubling pinches towel with thumb and forefinger Fold position, Mus head and body is wrapped into the towel in palm, and rat-tail root is being fixed by thumb and forefinger.

3. cut tail: eye scissorss are cutting rat-tail rapidly at the 0.1-0.2cm of rat-tail end, treat that drop of blood voluntarily flows out.

4. blood sugar test: blood glucose meter reagent paper edge is touched drop of blood, blood immerses reagent paper, blood glucose meter countdown display in 5 seconds Reading.

The evaluation index of patients with type Ⅰ DM injury severity score mainly includes the levels such as body weight, blood glucose, body weight, change of blood sugar Result, as shown in Fig. 2 wt mice is after giving the raising of hfd feedstuff, started body weight apparently higher than its nc feedstuff group, gives from the 4th week After raising, started the truss-ko Mouse Weight of hfd group with the truss-ko mice hfd feedstuff of 12 weeks and nc feedstuff from the 4th week Significantly lower than the wt Mouse Weight of hfd group, it is continued until the 12nd week (see Fig. 2 a)；Find in hfd group through fasting glucose detection Mice from the 6th week, 8 weeks, 10 weeks, substantially more corresponding nc matched group raises for the fasting blood glucose level of 12 weeks, the truss- of hfd group Ko mice fasting blood glucose level is significantly lower than wt group mice fasting blood glucose level (see Fig. 2 b).Show after showing truss gene knockout Write and have impact on carbohydrate metabolism stable state under hfd raising state for the mice, truss gene can significantly reduce the Sugar metabolism ability of mice, Truss gene can promote high fat to induce the generation of the patients with type Ⅰ DM causing.

[embodiment 3] glucose tolerance test (intraperitoneal glucose tolerance test, ipgtt)

Test the 10th week, carry out lumbar injection glucose experiment (ipgtt), to evaluate mice body to sugared tolerance.

(1) before surveying blood glucose, first measure the empty body weight of mice, calculate the volume injected of glucose according to 10 μ l/g.

(2) it is fasting glucose when 0 minute before first detecting glucose sugar injection, rapidly through lumbar injection Fructus Vitis viniferae after detection finishes Sugar liquid.

(3) lumbar injection operational approach: 1. fix mice；Pick up mice, the little finger of toe of left hand and the nameless tail grabbing mice Bar, another three fingers catch the cervical region of mice, make the head of mice downwards, mouse web portion is fully exposed.2. inserting needle positioning and note Penetrate: from the right hand syringes of abdominal part side inserting needle, hour hands are injected in the most advanced and sophisticated angle at 45 ° with mouse web portion, inserting needle, pumpback Head walks a small distance in subcutaneous abdomen, enters abdominal cavity in abdominal part opposite side, after having injected medicine, slowly through after ventrimeson Extract syringe needle, and slight rotating needle, prevent leakage.

(4) 15 points after lumbar injection, 30 points, 60 points, 120 minutes points cut tail and survey mouse blood sugar value, and remember Record blood glucose numerical value and detection time.

Pass through lumbar injection glucose tolerance test (intraperitoneal glucose further Tolerancetests, ipgtt) to assess the disposal ability to glucose for each group mice, testing the 10th week, by injection After the glucose of 1.0g/kg body weight, the wt mice of hfd group and truss-ko mouse blood sugar level reach in 15 minutes points sharp increase To peak value, elapse over time to injecting latter 60 minutes, two groups of mouse blood sugar levels somewhat decline, but still in higher than fasting blood Sugar level (blood glucose when 0 minute), 2 little constantly recover to fasting blood glucose level, and hfd group truss-ko mouse blood sugar level from The blood sugar level (Fig. 3 a) being constantly in less than wt mice for 0 minute to 2 hours.Relatively each group mouse blood sugar area under curve (area under the curve, auc), finds that the auc of wt mice hfd group is significantly higher than nc group, truss-ko hfd group Auc, significantly less than the auc (Fig. 3 b) of wt hfd group, shows that truss can suppress glycometabolic stable state.[embodiment 4] liver is substantially Outward appearance and liver organization lipid components measure

(1) end liver organization is drawn materials eventually

1), after mouse weights, take off rapidly neck and put to death.Lie on the back fixing mice, and with distilled water by mice chest, abdominal part hair moistens Wet.

2) hit exactly skin with a tweezers clamp mouse web portion, hit exactly along abdominal part and cut off skin to xiphoid-process to head, to tail Skin is cut off at end, successively exposes subcutaneous fascia, muscle etc., opens abdominal cavity, fully exposes each internal organs.

3) quickly find and take off the liver of mice, the liver specimens taken off are placed on sterile gauze, wipe dry liver table Remained blood on face, liver is placed in sterile petri dish, weighs rapidly.

4) paraffin specimen: cut partial liver and be placed in fixation in 10% neutral formalin.Frost specimen: cut part liver Dirty, it is placed in embedding in the tinfoil mould of oct, be placed on cryofixation on dry ice.

2. liver organization is processed and pathological staining related experiment

1) liver dehydration, transparent, waxdip

Cut the embedding inframe that the part lobe of the liver fixing in 10% neutral formalin is organized in labelling, in low discharge stream Water rinses more than 30 minutes.According to below scheme, following procedure is arranged on machine, be 1. dehydrated: 75% ethanol (45 minutes) → 75% ethanol (45 minutes) → 85% ethanol (45 minutes) → 85% ethanol (45 minutes) → 95% ethanol (45 minutes) → 95% Ethanol (45 minutes) → anhydrous alcohol (1 hour) → anhydrous alcohol (1 hour)；2. transparent: dimethylbenzene (1 hour) → dimethylbenzene (1 Hour)；3. soak cured (65 DEG C): paraffin (1 hour) → paraffin (1 hour).After tissue flushing finishes, the embedding of tissue will be comprised Frame is put in machine basketry, starts said procedure.After the completion of said procedure, take out organization embedding frame and send pathology room investing tissue, Cleaning robot is standby simultaneously.

2) liver tissue slices

Using microtome (5 μm of slice thickness).

3) liver organization staining for glycogen

Liver organization paraffin section is put into (5 minutes × 3 times) → 100% wine in 65 DEG C of baking ovens (30 minutes) → dimethylbenzene Smart (1 minute) → 90% ethanol (1 minute) → 70% ethanol (1 minute) → distillation washing → periodic acid (10 minutes) → tap water Wash away the loose colour in section → snow husband's reagent contaminate (10-15 minute) → wash from the beginning several descend → haematoxylin (1 minute) → distillation Loose colour → 70% ethanol once → 90% ethanol once → 100% ethanol (30 seconds × 3 times) → dimethylbenzene in section is removed in washing (2 minutes × 3 times) → when dimethylbenzene is not dry mounting, takes pictures.

4) liver organization oil red o dyeing

1. frozen liver tissues section is air-dried 30 minutes in fume hood, 4% paraformaldehyde fixes 10 minutes.It is placed in double Steam in water and slightly wash 10 minutes, to remove the paraformaldehyde that tissue shows.

2. processed 1 minute with 60% isopropanol.

3. oil red o (company sigma, article No. o0625,0.5 gram/100ml of concentration 100% isopropanol) is used to dye 30 minutes.

4. with 60% isopropyl alcohol 1 minute × 3 times after, until clean background.

5. the light dye nucleus of mayer ' s haematoxylin dye liquor (5) are used.

6. water rinsing, promotees blue, fully washes, be washed to nucleus oil blackeite in dilute lithium carbonate aqueous solution.

7. use glycerin gelatine mounting, take pictures.

As shown in Figure 4, in the truss-ko mice of hfd group, no matter liver weight is also for liver weight and liver weight weight ratio result It is liver weight with mice body weight ratio itself all compared with the wt mice of hfd group low (as Fig. 4).Pass through tissue slice further, enter Row oil o and staining for glycogen, basis of microscopic observation each group mouse liver is organized under high fat diet rearing conditions and there occurs significantly Pathological change.By liver oil red o dyeing it can be observed that under hfd rearing conditions, wt mice and truss-ko mouse liver Tissue all has lipidosiss it can be seen that steatosis, vacuolation the hepatocyte of nc group mice occur and fusion is linked to be lamellar, liver Dirty cellular morphology is almost destroyed completely, and the hepatocyte metamorphosis of truss-ko group mice are relatively slight (on Fig. 5).Pass through Liver glycogen dyes and to detect hepar damnification degree, it can be found that the content in the truss-ko mice hepatic glycogen of hfd group is compared In wt group mice showed increased (under Fig. 5), illustrate that hfd group truss-ko mouse liver degree of injury is light compared with wt group.These knots The fatty liver of fruit explanation truss knock out mice is substantially suppressed.

Show that truss gene pairss promote patients with type Ⅰ DM and fatty liver to have obvious action.Result of the present invention Illustrate that truss gene plays the role of to promote disease progression in fatty liver, patients with type Ⅰ DM disease model.

Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not subject to above-described embodiment Limit, other any spirit without departing from the present invention and the change made under principle, modification, replacement, combine, simplify, All should be equivalent substitute mode, be included within protection scope of the present invention.

sequence listing

<110>Wuhan University

<120>the related general support of the Tumor Necrosis Factor Receptors and signal protein work(in treatment fatty liver and patients with type Ⅰ DM

Can and apply

<160> 12

<170> patentin version 3.3

<210> 1

<211> 26

<212> dna

<213> truss-srna1

<400> 1

ggctgagtgt ctctacgcaa ctaagg 26

<210> 2

<211> 27

<212> dna

<213> truss-srna2

<400> 2

ggcttgaccc cgcctccgtt ttcttgg 27

<210> 3

<211> 54

<212> dna

<213> loxp1-f

<400> 3

agcttgacgt cataacttcg tatagcatac attatagcaa tttataccgg tgat 54

<210> 4

<211> 50

<212> dna

<213> loxp1-r

<400> 4

atcaccggta taaattgcta taatgtatgc tatacgaagt tatgacgtca 50

<210> 5

<211> 52

<212> dna

<213> loxp2-f

<400> 5

gatcccttaa gataacttcg tatagcatac attatagcaa tttatacgcg ta 52

<210> 6

<211> 52

<212> dna

<213> loxp2-r

<400> 6

ctagtacgcg tataaattgc tataatgtat gctatacgaa gttatcttaa gg 52

<210> 7

<211> 33

<212> dna

<213> truss la-f

<400> 7

ccgctcgagg ctcagactcc agttgaacat tta 33

<210> 8

<211> 33

<212> dna

<213> truss la-r

<400> 8

atggacgtcc taaggagcat ctctgaagaa tct 33

<210> 9

<211> 31

<212> dna

<213> truss m-f

<400> 9

tctaccggtt tgcgtagaga cactcaggga t 31

<210> 10

<211> 26

<212> dna

<213> truss m-r

<400> 10

cgggatccaa acggaggcgg ggtcaa 26

<210> 11

<211> 29

<212> dna

<213> truss ra-f

<400> 11

cgacgcgttc ttgggaggtt tttatgctg 29

<210> 12

<211> 36

<212> dna

<213> truss ra-r

<400> 12

ataagaatgc ggccgcgcct gtctgaggaa tgtggt 36

Claims (6)

1. The application in screening the liver protecting and glycometabolic medicine as drug targets of 1.truss gene.
2. 2. according to claim 1 application it is characterised in that: described medicine be suppression truss gene expression medicine； Described application is non-diagnostic and non-treatment.
3. 3.truss gene is as drug targets in screening prevention, alleviation and/or treatment fatty liver, the medicine of patients with type Ⅰ DM Application.
4. 4. according to claim 3 application it is characterised in that: described medicine be suppression truss gene expression medicine； Described application is non-diagnostic and non-treatment.
5. 5. the medicine of a kind of prevention, alleviation and/or treatment fatty liver and/or patients with type Ⅰ DM, the phase is characterised by, comprises truss Inhibitor.
6. 6. medicine according to claim 5 it is characterised in that: the inhibitor of described truss is preferably truss gene The rna interference carrier of sirna, truss gene, the antibody of truss and other can suppress truss expression inhibitor.