CN106377761A - Function and application of monocyte chemoattractant protein-1 inducible protein 1 in treating fatty liver and type-II diabetes - Google Patents

Abstract

The invention discloses a function and application of an MCPIP1 gene in treating fatty liver and type-II diabetes. By utilizing an MCPIP1 gene knockout mouse and a wild-type C57 mouse as experimental subjects and utilizing a fat mouse model induced by high fat diet, results indicate that compared with the wild-type C57 mouse, the MCPIP1 gene knockout mouse expresses obesity and has body weight and fasting blood-glucose level which are higher than those of a control group WT mouse. According to an intraperitoneal injection glucose tolerance experiment, the glucose tolerance of the MCPIP1-KO mouse is found to be obviously weakened; according to relevant enzyme assay results of liver general appearance and weight, a liver/weight ratio and liver functions, the MCPIP1-KO mouse based on high fat diet is obviously severe in fatty liver pathologic change and remarably increased in lipid accumulation. Therefore, the MCPIP1 can serve as a drug target for screening drugs for treating fatty liver and/or type-II diabetes, and an accelerant can be used for preparing a drug for treating fatty liver and/or type-II diabetes.

Description

Monocyte chemoattractant protein-1 inducible protein 1 is in treatment fatty liver and type II diabetes In function and application

Technical field

The invention belongs to the function of gene and application, particularly to a kind of monocyte chemoattractant protein-1 inducible protein 1 gene (monocyte chemotactic protein-1 induced protein1, MCPIP1) is as drug targets in sieve Apply in the medicine of choosing prevention, alleviation and/or treatment fatty liver and/or type II diabetes.

Background technology

NASH (non-alcoholic fatty liver disease, NAFLD) is modal liver Disease, Alcoholic and other clear and definite hepatic injury factors except referring to, so that liver cell is occurred based on steatosis and lipid accumulation Want the chronic hepatic diseases of pathological characters, it is also the liver performance of metabolic syndrome.The same with hypertension, diabetes, fat Liver also becomes one of common chronic disease of contemporary people, becomes the second largest hepatopathy being only second to virus hepatitis, and it can progress to Liver fibrosis, cirrhosis, or even liver cancer, develop into cirrhosis and the ratio of liver cancer is respectively 5%～10% and 1%～2%, sternly Threaten the healthy of people again.

Diabetes are one group of metabolic diseases being characterized with chronic hyperglycemia being caused by multi-pathogenesis, and it is by insulin Caused by hyposecretion and (or) effect defect.Diabetes are broadly divided into IDDM and type II diabetes etc..Wherein, II type Diabetes are the most common, account for the 90%-95% of total diabetic.Currently, global diabetes prevalence, the incidence of disease and Diabetic's quantity steeply rises.And as China's rapid development of economy, life style is westernization and aging population, fertile Fat rate rises, and China's diabetes prevalence also presents a rapidly rising trend

The generation of NAFLD and diabetes have close relationship, and in type ii diabetes patient, about 50-60% occurs NAFLD^[1]. The Adipocyte Factor of adipose tissue release and liver lipids deposition promote hepar damnification, and cause insulin to support further Anti-^[2].On the other hand, if type ii diabetes control not good or abundant development, not only promote fatty liver to generate, and so that liver is damaged Wound increases, or even forms nonalcoholic fatty liver disease, hepatic fibrosis, cirrhosis and hepatocellular carcinoma.Type ii diabetes merge NAFLD will greatly increase the mortality risk leading to due to cirrhosis, hepatocellular carcinoma and cardiovascular complication^[3].At present although controlling Therapeutic action in type ii diabetes are with NAFLD patient for the hyperlipidemia processed still needs to be probed into, but the treatment of NAFLD is mainly wrapped Include the positive control for diabetes and cardiovascular risk factors.Research shows, in the patient merging type ii diabetes and NAFLD In, only Thiazolidinediones Pioglitazone shows being obviously improved of liver histological.

MCPIP1 (monocyte chemotactic protein-1 induced protein1, monocyte chemotactic egg - 1 inducible protein 1 in vain) it is a kind of zinc finger protein being produced through induction by MCP1, belong to a member of MCPIP family^[4].MCPIP1 has There is various biological function, its molecule itself can be as RNase, deubiquitinating enzymes additionally it is possible to adjust thin as transcription factor The several functions of born of the same parents.MCPIP1 can remarkably promote Apoptosis by inducing the activation of the paths such as caspase2/12^[5].Separately Studies have found that, MCPIP1 has the function of adjusting cell differentiation, angiogenesis can be promoted by adjusting transcription factor^[6]. In recent years research find MCPIP1 can as deubiquitinating enzymes or its molecule itself can as scaffolding protein recruit other go general Elementization enzymatic enters the deubiquitination of TRAF6^[7,8].

Bibliography

[1]Smith B W,Adams L A.Nonalcoholic fatty liver disease and diabetes mellitus:pathogenesis and treatment[J].Nat Rev Endocrinol,2011,7(8):456-465.

[2]Milic S,Lulic D,Stimac D.Non-alcoholic fatty liver disease and obesity:biochemical,metabolic and clinical presentations[J].World J Gastroenterol,2014,20(28):9330-9337.

[3]Cusi K.Treatment of patients with type 2 diabetes and non- alcoholic fatty liver disease:Current approaches and future directions.Diabetologia.2016；59:1112-1120

[4]Zhou L,Azfer A,Niu J,et al.Monocyte chemoattractant protein-1 induces a novel transcription factor that causes cardiac myocyte apoptosis and ventricular dysfunction[J].Circ Res,2006,98(9):1177-1185.

[5]Cifuentes R A,Cruz-Tapias P,Rojas-Villarraga A,et al.ZC3H12A (MCPIP1):Molecular characteristics and clinical implications[J].Clinica Chimica Acta,2010,411(23-24):1862-1868.

[6]Lipert B,Wegrzyn P,Sell H,et al.Monocyte chemoattractant protein- induced protein 1 impairs adipogenesis in 3T3-L1 cells[J].Biochimica et Biophysica Acta(BBA)-Molecular Cell Research,2014,1843(4):780-788.

[7]Liang J,Saad Y,Lei T,et al.MCP-induced protein 1 deubiquitinates TRAF proteins and negatively regulates JNK and NF-κB signaling[J].The Journal of Experimental Medicine,2010,207(13):2959-2973.

[8]Wang W,Huang X,Xin H,et al.TRAF Family Member-associated NF-κB Activator(TANK)Inhibits Genotoxic Nuclear Factor κB Activation by Facilitating Deubiquitinase USP10-dependent Deubiquitination of TRAF6 Ligase [J].Journal of Biological Chemistry,2015,290(21):13372-13385.

Content of the invention

For solving defect and the deficiency of above-mentioned prior art, it is an object of the invention to provide a kind of table of MCPIP1 gene Reach the correlation and fatty liver, type II diabetes between, a target gene for treating fatty liver, type II diabetes is provided The new application of MCPIP1, and then MCPIP1 gene is applied to the treatment of fatty liver, type II diabetes.

The purpose of the present invention is achieved through the following technical solutions：

The present invention is little with liver cell specificity MCPIP1 gene knockout (MCPIP1-KO, KO) with wild type (WT) C57 mouse Mouse is experimental subjects, and the Mice model of obesity being induced by high fat diet (diet induced obesity, DIO) is studied The function of MCPIP1 gene, it is found that contrasting with wild type C57 mouse, MCPIP1 knock out mice shows obesity, its Body weight and fasting blood glucose level are above control group WT mouse.Found by lumbar injection glucose tolerance test further MCPIP1 knock out mice substantially weakens to the tolerance of glucose.From mouse liver weight and liver/weight ratio and Liver function related enzyme activity measurement result etc. all illustrates the MCPIP1-KO mouse of HFD group (High fat diet, high fat diet) Fatty liver becomes apparent seriously, and accumulation of lipid dramatically increases.This shows that MCPIP1 gene knockout can aggravate fatty liver, II type glycosuria The generation of disease, MCPIP1 gene can suppress the generation of fatty liver, type II diabetes.

The research of the present inventor demonstrates：In the fatty liver of high fat induction, type II diabetes model, MCPIP1 has suppression System is fat, reduces blood sugar, reduces liver lipids accumulation, liver function protecting, particularly improves the work of fatty liver, type II diabetes With.

Function in fatty liver, type II diabetes for the MCPIP1 gene, be embodied in MCPIP1 have improve fatty liver, The function of type II diabetes.

For MCPIP1, there is the function of improving fatty liver, type II diabetes, MCPIP1 can be used for preventing in preparation, slow The medicine aspect application of solution and/or treatment Fatty Liver Disease.

The medicine of a kind of prevention, alleviation and/or treatment Fatty Liver Disease, comprises MCPIP1.

For the function of improving fatty liver, type II diabetes of MCPIP1, MCPIP1 can be used for preventing, alleviate in preparation And/or the medicine aspect application for the treatment of type II diabetes.

The medicine of a kind of prevention, alleviation and/or treatment diabetes, comprises MCPIP1.

The present invention has such advantages as with respect to prior art and effect：

(1) present invention discover that the New function of MCPIP1 gene, that is, MCPIP1 gene has and can protect fatty liver, II type sugar The effect of the sick disease of urine.

(2) based on MCPIP1 in protection fatty liver, the effect in type II diabetes disease, its can be used for preparation prevention, Alleviate and/or treat the medicine of fatty liver and/or type II diabetes.

Brief description

Fig. 1 is the target practice policy map building liver cell specificity MCPIP1 knock out mice.

Fig. 2 is the body weight of WT and MCPIP1-KO mouse, fasting blood-glucose result figure；

A is Mouse Weight result figure, and B is fasting blood glucose level statistical chart (*：P ＜ 0.05vs WT NC group, * *：P ＜ 0.01vs WT NC group, #：P ＜ 0.05vs WT HFD group, ##：P ＜ 0.01vs WT HFD group).

Fig. 3 is that WT and MCPIP1-KO mouse passes through lumbar injection glucose tolerance result figure；

A is different time points mouse blood sugar level statistic figure after lumbar injection glucose, and B is each group glucose tolerance in mice TG-AUC (area under the curve, AUC) comparison diagram (* *：P ＜ 0.01vs WT NC group, ##：P ＜ 0.01vs WT HFD group).

Fig. 4 is the liver weight result figure of MCPIP1-KO and WT mouse；

A counts block diagram for liver weight, and B is liver weight and mouse weight ratio Data-Statistics block diagram (* * itself：P ＜ 0.01vs WT NC group, ##：P ＜ 0.01vs WT HFD group).

Fig. 5 is the liver function measurement result figure of WT and MCPIP1-KO mouse, takes AST, ALT and ALP respectively to mouse liver function Detected.(**：P ＜ 0.01vs WT NC group, ##：P ＜ 0.01vs WT HFD group).

Specific embodiment

By combination accompanying drawing described further below it will be further appreciated that the features and advantages of the invention.The enforcement being provided Example is only the explanation to the inventive method, and limits remaining content of present invention announcement never in any form.

Animal for research and raising：

Animal used as test kind, sex, week old and source：C57BL/6 mouse (WT) and liver cell specificity MCPIP1 gene Knock out (MCPIP1-KO) mouse, male, 8 week old.C57BL/6 mouse is purchased from Beijing Fukang bio tech ltd of China, and liver is thin Born of the same parents' specificity MCPIP1 knock out mice (MCPIP1-KO) are by MCPIP1-floxed mouse and by protein promoter control, liver The Cre transgenic mice Albumin-Cre of cell specific expression is (purchased from The Jackson Laboratory, article No. 003574) hybridization obtains, and construction strategy is shown in Fig. 1.

The structure of liver specificity MCPIP1 knock out mice：

According to gene information, using CRISPR Design (network address：http://crispr.mit.edu/) including respectively The target practice site of a CRISPR is respectively designed in son 2 and 3.Target sequence is respectively：

MCPIP1-sgRNA 1：ggCACTGGCTCCCCACGTAGAG GGG

MCPIP1-sgRNA 2：gGCCCTTACCTGAGTAACTTA GGG

In addition have also been devised one for the donor plasmid (Donor Vector) that homology is repaired, it includes both sides homology Arm, middle exon 3 and two loxp sequences in the same direction.

1. the structure of targeting vector：Respectively corresponding for sgRNA1 and sgRNA2 two primers are fused into double-stranded DNA, then It is connected in the pUC57-sgRNA carrier that restriction enzyme BsaI was processed with T4 DNA ligase.This carrier upstream has One T7 promoter, can be used for follow-up In vitro transcription.

2. conditionity knock out skeleton carrier pBluescript SK (+) structure of -2loxp：

It is respectively synthesized 4 oligomerization single stranded nucleotide sequence：

loxp1-F：

AGCTTGACGTCATAACTTCGTATAGCATACATTATAGCAATTTATACCGGTGAT,

loxp1-R：

ATCACCGGTATAAATTGCTATAATGTATGCTATACGAAGTTATGACGTCA；

loxp2-F：

GATCCCTTAAGATAACTTCGTATAGCATACATTATAGCAATTTATACGCGTA,

loxp2-R：

CTAGTACGCGTATAAATTGCTATAATGTATGCTATACGAAGTTATCTTAAGG；

Form two double-strands of loxp1 and loxp2 after above-mentioned oligonucleotide sequence annealing.By pBluescript IISK (+) Carrier with connect after HindIII (NEB, R0104L) and EcoRV (NEB, R0195L) double digestion into loxp1 anneal double-strand, then will Be sequenced correct carrier BamHI (NEB, R0136L) and SpeI (NEB, R0133L) double digestion, connects double into loxp2 annealing Chain, obtain conditionity knock out skeleton carrier, be named as pBluescript SK (+) -2loxp.

3. the structure of donor vehicle (Donor Vector)：According to design of primers principle, design following primer (table 1) and be used for The amplification left and right homology arm (LA and RA) of donor vehicle and the extron part (M) of centre.Expand the product obtaining through in table 1 Obtain 3 fragments after shown digestion with restriction enzyme, it is connected into respectively conditionity and knocks out skeleton carrier pBluescript SK (+) in -2loxp, obtain Donor Vector.

Table 1 builds primer sequence needed for donor vehicle and corresponding restriction enzyme site

4. the transcription of targeting vector：Two parts (Cas9 egg of responsible dissection that CRIPR/Cas9 system is comprised White and guiding Cas9 albumen navigates to the gRNA of target site) transcribed respectively.For Cas9 albumen, by its expression vector (pST1374-Cas9) carry out digestion with PmeI, to reclaim linearization plasmid after purification as transcription templates, use T7mMESSAGE MMACHINE kit (AM1345, Ambion) carries out in-vitro transcription, obtains the mRNA product capping.And with Poly (A) Tailing kit (Ambion), to above-mentioned product tailing, obtains ripe mRNA product；For sgRNA, use MEGAshortscript^TMKit (AM1354, Ambion company) carries out in-vitro transcription.Cas9's and sgRNA that transcription is obtained MRNA is purified using miRNeasy Micro Kit (Qiagen, 217084).

5. the making of MCPIP1-floxed conditionity knock-out mice

Above-mentioned ripe mRNA product is together injected in mouse fertilized egg with donor plasmid, is transplanted in replace-conceive dams body Cultivated.The mouse obtaining is identified.Take out the mouse toe after raw a week or tail tissue, extract genome, and lead to Cross the positive head of PCR method screening and build mouse.Select one at random and be only used as F0 for after carrying out from the mouse determining generation homologous recombination Continuous breeding, final acquisition MCPIP1-floxed Mice homozygous.

6. the making of liver cell specificity MCPIP1 knock out mice

Above-mentioned MCPIP1-floxed mouse is mated with liver specificity Albumin-Cre transgenic mice, screening obtains MCPIP1^{floxed/floxed}/ Albumin-Cre mouse, after about this mouse length to 6 week old, lumbar injection Tamoxifen, lure Lead the expression of Cre enzyme, two loxp in the same direction of identification of Cre enzyme spcificity, and excise sequence between the two and therein one Individual loxp, finally obtains liver cell specificity MCPIP1 knock out mice.

Animal used as test feed formula：High lipid food (HFD) is (purchased from Beijing Fukang bio tech ltd of China, article No. D12942)：Percent of calories：Protein:20%；Carbohydrate:20%；Fat:60%, total thermal mass ratio 5.24kcal/g.Low fat feed (NC) (purchased from Beijing Fukang bio tech ltd of China, article No. D12450B)：Heat percentage Than：Protein:20%；Carbohydrate:70%；Fat:10%, total thermal mass ratio:3.85kcal/g.

Feeding environment and condition：SPF level Experimental Animal Center, room temperature between 22-24 DEG C, humidity between 40-70%, It is 12h that light and shade replaces lighting hours, and free water is ingested.

【Embodiment 1】Mouse fatty liver, type II diabetes model (diet induced obesity, DIO) obtain

(1) animal used as test packet：From 8 week old, male, WT mouse and MCPIP1-KO mouse, give respectively two kinds special Feed D12942 high lipid food (High fat diet, HFD) and D12450B low fat feed (Normal chow, NC) are raised, that is, WT NC group, KO NC group, WT HFD group, KO HFD group totally 4 groups.

(2) model induces operating process by high lipid food：

Using WT and KO mouse, set up DIO model, carry out phenotype correlation analysis, specify MCPIP1 gene pairs fatty liver, II The effect that patients with type Ⅰ DM plays.From 8 week old, male, WT mouse and MCPIP1-KO mouse, give two kinds of special feeds respectively D12942 high lipid food (Highfat diet, HFD) and D12450B low fat feed (Normal chow, NC) are raised, i.e. WT NC Group, KO NC group, WT HFD group, KO HFD group totally 4 groups.Mouse empty body weight and fasting blood-glucose detected 1 time every 2 weeks.Real Test the 10th week, carry out lumbar injection glucose experiment (IPGTT), to evaluate mouse body to glucose tolerance, the 12nd week Draw materials in whole end.

【Embodiment 2】Mouse Weight, determination of blood glucose level

(1) mouse empty body weight, appetite detects

1) body weight detection.

1. fasting：The morning 8:00 will treat experiment mice fasting (can't help water), afternoon 2:00 beginning experimental implementation.

2. weigh：Weighed at the 0th week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 10 weeks, 12 weeks respectively, a plastics keg is placed on dynamically On electronic balance, pick up mouse, put in weighing keg, measure body weight record data.Forage volume detects：Wait to weigh and operated Cheng Hou, to mouse plus feed, and records the forage volume of mouse on dynamic electron balance.

(2) fasting blood glucose level test experience

By the mouse being needed to be tested from the morning 8:00 to afternoon 2:00 fasting (can't help water), i.e. fasting was opened after 6 hours Beginning experimental implementation.

1. blood glucose meter prepares：Check blood glucose meter (Johnson Co., ONETOUCH) battery, by right-side switch, by test paper It is properly placed left side slot, screen display and the numeral of blood sugar test paper bar respective code, subsequently show pattern of bleeding, point out blood sugar Instrument enters state to be measured.

2. fix mouse：The right hand grabs rat-tail, and left hand holds one piece of towel, and towel doubling pinches towel with thumb and forefinger Fold position, mouse head and body is wrapped into the towel in palm, and rat-tail root is being fixed by thumb and forefinger.

3. cut tail：Eye scissors is cutting rat-tail rapidly at the 0.1-0.2cm of rat-tail end, treats that drop of blood voluntarily flows out.

4. blood sugar test：Blood glucose meter test paper edge is touched drop of blood, blood immerses test paper, blood glucose meter countdown display in 5 seconds Reading.

The evaluation index of type II diabetes injury severity score mainly includes the levels such as body weight, blood sugar, body weight, change of blood sugar Result, as shown in Fig. 2 WT mouse is after giving the raising of HFD feed, started body weight apparently higher than its NC feed group, gives from the 2nd week After raising with the MCPIP1-KO mouse HFD feed of 12 weeks and NC feed, at the 4th week and the 12nd week, the MCPIP1-KO of HFD group was little Mouse body weight is apparently higher than the WT Mouse Weight (see Fig. 2A) of HFD group；Detect through fasting blood-glucose find WT mouse in HFD group from the 2nd Substantially more corresponding NC control group raises the fasting blood glucose level in week, and the MCPIP1-KO mouse fasting blood glucose level of HFD group is also obvious Higher than WT group mouse fasting blood glucose level (see Fig. 2 B).Significantly affects mouse after showing MCPIP1 gene knockout to raise in HFD Glycometabolism stable state under state, MCPIP1 gene can significantly improve the Sugar metabolism ability of mouse, shows MCPIP1 gene in high fat Induce in the type II diabetes causing and play an important role.

【Embodiment 3】Glucose tolerance test (intraperitoneal glucose tolerance test, IPGTT)

Test the 10th week, carry out lumbar injection glucose experiment (IPGTT), to evaluate mouse body to sugared tolerance.

(1) before surveying blood sugar, first measure the empty body weight of mouse, calculate the volume injected of glucose according to 10 μ L/g.

(2) it is fasting blood-glucose when 0 minute before first detecting glucose sugar injection, rapidly through lumbar injection grape after detection finishes Liquid glucose.

(3) lumbar injection method of operating：1. fix mouse；Pick up mouse, the little finger of toe of left hand and the nameless tail grabbing mouse Bar, another three fingers catch the neck of mouse, make the head of mouse downwards, mouse web portion is fully exposed.2. inserting needle positioning and note Penetrate：From the right hand syringes of belly side inserting needle, hour hands are injected in the most advanced and sophisticated angle at 45 ° with mouse web portion, inserting needle, pumpback Head walks a small distance in subcutaneous abdomen, enters abdominal cavity in belly opposite side, after having injected medicine, slowly through after ventrimeson Extract syringe needle, and slight rotating needle, prevent leakage.

(4) 15 points after lumbar injection, 30 points, 60 points, 120 minutes points cut tail and survey mouse blood sugar value, and remember Record blood sugar numerical value and detection time.

Pass through lumbar injection glucose tolerance test (intraperitoneal glucose further Tolerancetests, IPGTT) to assess the disposal ability to glucose for each group mouse, testing the 10th week, by injection After the glucose of 1.0g/kg body weight, the WT mouse of HFD group and MCPIP1-KO mouse blood sugar level increase severely in 15 minutes points Reach peak value, elapse over time to injecting latter 30 minutes, two groups of mouse blood sugar levels somewhat decline, but remain above fasting blood-glucose Level (blood sugar when 0 minute), 2 little constantly recover to fasting blood glucose level, and MCPIP1-KO mouse blood sugar level was from 0 minute The state of the blood sugar level (Fig. 3 A) being constantly in higher than WT mouse to 2 hours.Relatively each group mouse blood sugar TG-AUC (area under the curve, AUC), finds that the AUC of WT mouse HFD group is significantly higher than NC group, MCPIP1-KO HFD group AUC is noticeably greater than the AUC (Fig. 3 B) of WT HFD group, shows that MCPIP1 has powerful ability of regulation and control to maintenance glycometabolism stable state.

【Embodiment 4】Liver weight and liver functional testing

(1) end liver organization is drawn materials eventually

1), after mouse weights, take off rapidly neck and put to death.Lie on the back fixing mouse, and with distilled water by mouse chest, belly hair moistens Wet.

2) hit exactly skin with a tweezers clamp mouse web portion, hit exactly along belly and cut off skin to xiphoid-process to head, to tail Skin is cut off at end, successively exposes subcutaneous fascia, muscle etc., opens abdominal cavity, fully exposes each internal organs.

3) quickly find and take off the liver of mouse, the liver specimens taken off are placed on sterile gauze, wipe dry liver table Remained blood on face, liver is placed in sterile petri dish, weighs rapidly.

(2) liver functional testing

1) open computer labman software, printer, be then turned on Biochemical Analyzer；

2) select and clean detection probe, cuvette etc. it is ensured that probe is unobstructed, the attachment of cuvette free from admixture, light absorption value exists The term of reference setting；

3) serum specimen to be detected is found out from -80 DEG C of refrigerators；Melt multiple at room temperature for serum to be detected to liquid State, prepares detection；

4) whether enough Testing index reagent needed for checking on labman software, set Testing index and detection ordering Deng；

5) add blood serum sample 50 μ l to be checked, start to detect；

6) to be detected finish after record detection numerical value.

Liver weight and liver weight with Mouse Weight ratio result as shown in Figure 4, in the MCPIP1-KO mouse of HFD group No matter liver weight or liver weight is all high (as Fig. 4) compared with the WT mouse of HFD group with mouse body weight ratio itself.Liver further Function detection shows, HFD group mouse liver function is substantially poor compared with NC group, and the three of MCPIP1-KO mouse kinds of liver enzyme ((millet straw turns ammonia to AST Enzyme), ASLT (glutamic-pyruvic transaminase), ALP (alkaline phosphatase)) all compared with the WT mouse of HFD group higher (as Fig. 5).These results are said The fatty liver of bright MCPIP1 knock out mice substantially deteriorates.

The type II diabetes that the above results display MCPIP1-KO mouse occurs under the induction of HFD and fatty live lesions show Work increases.These results show that MCPIP1 gene pairs improves type II diabetes and fatty liver has obvious action.The present invention ties Fruit explanation MCPIP1 gene has important protective effect in fatty liver, type II diabetes disease model.

Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not subject to above-described embodiment Limit, other any Spirit Essences without departing from the present invention and the change made under principle, modification, replacement, combine, simplify, All should be equivalent substitute mode, be included within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhan University

<120>Function and application in treatment fatty liver and type II diabetes for the monocyte chemoattractant protein-1 inducible protein 1

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 25

<212> DNA

<213> MCPIP1-sRNA 1

<400> 1

ggcactggct ccccacgtag agggg 25

<210> 2

<211> 24

<212> DNA

<213> MCPIP1-sRNA 2

<400> 2

ggcccttacc tgagtaactt aggg 24

<210> 3

<211> 54

<212> DNA

<213> loxp1-F

<400> 3

agcttgacgt cataacttcg tatagcatac attatagcaa tttataccgg tgat 54

<210> 4

<211> 50

<212> DNA

<213> loxp1-R

<400> 4

atcaccggta taaattgcta taatgtatgc tatacgaagt tatgacgtca 50

<210> 5

<211> 52

<212> DNA

<213> loxp2-F

<400> 5

gatcccttaa gataacttcg tatagcatac attatagcaa tttatacgcg ta 52

<210> 6

<211> 52

<212> DNA

<213> loxp2-R

<400> 6

ctagtacgcg tataaattgc tataatgtat gctatacgaa gttatcttaa gg 52

<210> 7

<211> 29

<212> DNA

<213> MCPIP1 LA-F

<400> 7

ccgctcgagc ttctggtttt gcttgctga 29

<210> 8

<211> 36

<212> DNA

<213> MCPIP1 LA-R

<400> 8

atggacgtcg agggggaggg tcgggccatt tgcaac 36

<210> 9

<211> 27

<212> DNA

<213> MCPIP1 M-F

<400> 9

tctaccggtt acgtggggag ccagtgt 27

<210> 10

<211> 29

<212> DNA

<213> MCPIP1 M-R

<400> 10

ccggaattct tagggccaag ccctttacc 29

<210> 11

<211> 31

<212> DNA

<213> MCPIP1 RA-F

<400> 11

cgacgcgtgt tactcaggta agggcttcaa g 31

<210> 12

<211> 36

<212> DNA

<213> MCPIP1 RA-R

<400> 12

ataagaatgc ggccgcagag agccacctag gaacga 36

Claims (6)

1. The application in screening protection liver and glycometabolic medicine as drug targets of 1.MCPIP1 gene.
2. 2. according to claim 1 application it is characterised in that：Described medicine is the medicine promoting MCPIP1 gene expression Thing；Described application is non-diagnostic and non-treatment.
3. Application in preparation protection liver and glycometabolic medicine for the 3.MCPIP1.
4. 4.MCPIP1 gene is as drug targets in screening prevention, alleviation and/or treatment fatty liver, the medicine of type II diabetes Application.
5. 5. according to claim 4 application it is characterised in that：Described medicine is the medicine promoting MCPIP1 gene expression Thing；Described application is non-diagnostic and non-treatment.
6. Application in preparation prevention, alleviation and/or treatment fatty liver, the medicine of type II diabetes for the 6.MCPIP1.