CN103520724B - The new purposes of the inhibitor of HSD17B13 albumen or its encoding gene - Google Patents
The new purposes of the inhibitor of HSD17B13 albumen or its encoding gene Download PDFInfo
- Publication number
- CN103520724B CN103520724B CN201310503889.0A CN201310503889A CN103520724B CN 103520724 B CN103520724 B CN 103520724B CN 201310503889 A CN201310503889 A CN 201310503889A CN 103520724 B CN103520724 B CN 103520724B
- Authority
- CN
- China
- Prior art keywords
- hsd17b13
- albumen
- sequence
- liver
- encoding gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses the new purposes of the inhibitor of HSD17B13 albumen or its encoding gene. The inhibitor that new purposes provided by the present invention is specially HSD17B13 albumen or its encoding gene prevents and/or treats the application in the product of fatty liver in preparation. Experimental results show that, the recombined adhenovirus immunity C57 wild-type mice of HSD17B13 gene is carried in use, can be observed mouse liver obvious fatty variation has occurred, and the dyeing of the oil red of this liver section demonstrates a large amount of fat and builds up, and triglycerides and cholesterol level in liver organization significantly increase. This shows that HSD17B13 may participate in the forming process of fatty liver. The present invention is significant for preventing and/or treating fatty liver.
Description
Technical field
The invention belongs to biomedicine field, relate to the new purposes of the inhibitor of HSD17B13 albumen or its encoding gene,The inhibitor that is particularly related to HSD17B13 albumen or its encoding gene preparation prevent and/or treat in the product of fatty liver shouldWith.
Background technology
HSD17B13 is a steroid dehydrogenase, belongs to 17 β-HSD family, is cloned out by 2007. PeopleHSD17B13 gene is positioned 4q22 chromosome on chromosome, contains seven extrons, and coding is containing 300 amino acid whose eggsIn vain. 17 β-HSD belongs to a subfamily of SDR, and SDR is a very huge family, participates in mammiferous reproduction, sends outA series of physiology and the physiological pathology process such as educate, fat. 17 β-HSD subfamily one has 14 members, and other member mainly participates inThe activation of sex hormone and deactivation, the reproduction tumours such as its abnormal and prostate cancer and breast cancer are closely related, and the merit of HSD17B13Can there is no at present any report.
Fatty liver, refers to the pathology of fatty overheap in the liver cell causing due to a variety of causes. When fat content surpassesWhile crossing liver weight in wet base 5% (being normally 1～2%), or in histology, fat becomes and is called fatty liver while exceeding 30% liver parenchyma. Fatty liverMain pathology physiologic character is that liver cell lactones drips gathering, the mitochondria of ballooning degeneration of liver cells and swelling. Insulin supportsAnti-, internal organ lipidosis, inflammation and mitochondria dysfunction are pathologic process important in fatty liver evolution. China is currentThe incidence of disease of fatty liver has exceeded 18%, and fatty liver has become the Etiological of various chronic hepatic diseases, is also hidden source property liverThe head of sclerosis is because of, and its rejuvenation trend of falling ill.
The clinical medicine that there is no effective treatment fatty liver at present. In clinical treatment, still to remove the cause of disease, active treatmentProtopathy and adhere to that reasonable diet system is main, and medicine only helps out. Common drug is mainly for reducing blood lipid, liver cellThe aspects such as protection, lack the effective treatment means that directly act on liver lipidosis.
Summary of the invention
The object of this invention is to provide the new purposes of the inhibitor of a kind of HSD17B13 albumen or its encoding gene.
The new purposes of the inhibitor of HSD17B13 albumen provided by the present invention or its encoding gene, is specially HSD17B13The inhibitor of albumen or its encoding gene prevents and/or treats the application in the product of fatty liver in preparation.
Further, the inhibitor of described HSD17B13 albumen or its encoding gene is in the application being prepared as follows in arbitrary productAlso belong to protection scope of the present invention:
(I) product of triglyceride content in reduction sickened body liver organization;
(II) product of cholesterol level in reduction sickened body liver organization.
A further object of the present invention is to provide a kind of product.
The active component of product provided by the present invention is the inhibitor of described HSD17B13 albumen or its encoding gene; InstituteState product and there is at least one in following purposes:
(a) prevent and/or treat fatty liver;
(b) reduce triglyceride content in sickened body liver organization;
(c) reduce cholesterol level in sickened body liver organization.
The above sickened body can be the body with fatty liver clinical symptoms, as is diagnosed as the patient of fatty liver.
The above product specifically can be medicine.
In the present invention, the inhibitor of described HSD17B13 albumen or its encoding gene, can be divided into following two large classes:
One, can suppress the expression of the encoding gene of described HSD17B13 albumen, thereby reduces described HSD17B13 eggWhite expression; Its two, can with described HSD17B13 protein combination, promote lipid thereby reduce described HSD17B13 albumenThe activity generating.
Further, the inhibitor of described HSD17B13 albumen or its encoding gene, specifically can be small RNA, antisense widowOne or more in nucleotides, antibody and active organic compounds.
More concrete, described small RNA can be used alone, and also can coordinate and make with other active component or auxiliary materialMedicine. Described ASON is that length is the single-stranded structure of 14-30bp, and described ASON with described inThe nucleotide sequence matching in the encoding gene of HSD17B13 albumen has more than 90% homogeneity. Described antibody, can beMonoclonal antibody or polyclonal antibody.
Described HSD17B13 albumen or its encoding gene be in the application building in fatty liver model, or for the preparation ofApplication in the product of structure fatty liver model also belongs to protection scope of the present invention.
Described fatty liver model refers to that compared with intact animal in liver organization, triglyceride content improves and/or liverIn dirty tissue, cholesterol level improves
The present invention utilizes described HSD17B13 albumen or its encoding gene to build fat and an object is to provide oneThe method of liver animal model.
The side that utilizes described HSD17B13 albumen or its encoding gene to build fatty liver model provided by the present inventionMethod, specifically can comprise the steps: in object animal, to import described HSD17B13 albumen or its encoding gene, obtains having fatThe transgenic animals of fat liver clinical symptoms.
In described method, described fatty liver clinical symptoms are embodied in as follows: 1) oil red O stain shows liver lactonesDrip obviously and increase; 2) in liver organization, triglyceride content raises; 3) in liver organization, cholesterol level raises. Above 1) institute inThe increase of stating, and 2) and 3) in described rising be all with the corresponding index of the described object animal without modeling as a reference.
In the present invention, described HSD17B13 albumen or its encoding gene are to import by the form of recombinant adenoviral vectorIn described object animal; Described recombinant adenoviral vector is the recombined adhenovirus of expressing described HSD17B13 albumen.
In described method, to import in described object animal described HSD17B13 albumen or its encoding gene for: by instituteState recombinant adenoviral vector according to object the weight of animals 4 × 10 described in every kg10The consumption immunity of pfu (as intravenous injection, concrete asTail vein injection) described object animal. It is a kind of for building fatty liver model that the present invention is that another object is to provideCover medicine.
Provided by the present invention for building the cover medicine of fatty liver model, specifically can comprise recombinant adenoviral vector andMedication instruction book; Described recombinant adenoviral vector is the recombined adhenovirus of expressing described HSD17B13 albumen; Described medication instructionBook is described below content: by described recombinant adenoviral vector according to object the weight of animals 4 × 10 described in every kg10The consumption of pfu is quietArteries and veins is injected described object animal.
In above-described application or product or method or cover medicine, described HSD17B13 albumen is specially by sequence tableThe albumen of the composition of amino acid sequence shown in sequence 1.
Further, the encoding gene of described HSD17B13 albumen is arbitrary described DNA molecular in following (1) to (4):
(1) coded sequence is the DNA molecular of the 25-927 position of sequence 2 in sequence table;
(2) DNA molecular shown in sequence 2 in sequence table;
(3) DNA molecule hybridize limiting with (1) or (2) under stringent condition and the described HSD17B13 albumen of encodingDNA molecular;
(4) there is 90% above homology and the described HSD17B13 albumen of encoding with the DNA molecular of the arbitrary restriction in (1)-(3)DNA molecular.
In the present invention, above all described recombined adhenovirus all utilize AdEasy system to be packaged to be, concrete, can be according to comprising the steps:
A1) encoding gene of described HSD17B13 albumen is inserted into the MCS Not of pAdTrack-CMV plasmidI, obtains recombinant shuttle plasmid pAdTrack-CMV-HSD17B13;
A2) cut described recombinant plasmid pAdTrack-CMV-HSD17B13 with restriction enzyme PmeI enzyme, obtain linearityChange plasmid 1;
A3) by described linearization plasmid 1 and skeleton plasmid pAdEasy-1 cotransformation E.coli BJ5183, recombinatedEscherichia coli;
A4) from described recombination bacillus coli, extract homologous recombination plasmid pAdEasy-HSD17B13;
Described homologous recombination plasmid pAdEasy-HSD17B13 is described recombinant shuttle plasmid pAdTrack-CMV-The restructuring matter that HSD17B13 and described skeleton plasmid pAdEasy-1 obtain after recombinating by two homology arms that carry separatelyGrain;
A5) cut described homologous recombination plasmid pAdEasy-HSD17B13 with restriction enzyme PacI enzyme, obtain linearisationPlasmid 2;
A6) with described linearization plasmid 2 transfection mammalian cells (as HEK293 cell), cultivation of recombinant cells, obtainsDescribed recombined adhenovirus.
In the present invention, described object animal can be mouse.
In the present invention, described object animal is specially C57BL/6 mouse, and that more concrete is male C57BL/6 in 8 week ageMouse.
Even so, the method for structure fatty liver model provided by the present invention also can be described as structure and has simultaneouslyThe animal model of following proterties:
Compared with described object animal without modeling, 1) oil red O stain shows that liver lactones drips obvious increase; 2) liverIn tissue, triglyceride content raises; 3) in liver organization, cholesterol level raises.
Experiment showed, and use the recombined adhenovirus immunity C57 wild-type mice that carries HSD17B13 gene, can be observedThere is obvious fat and become in mouse liver, and the dyeing of the oil red of this liver section demonstrates a large amount of fat accumulations, liverTriglycerides and cholesterol level in tissue significantly increase. This shows that HSD17B13 may participate in the shape of fatty liverOne-tenth process. Therefore, HSD17B13 gene may be the key factor that prevents and/or treats fatty liver.
Brief description of the drawings
Fig. 1 is the SDS-PAGE result that normal person and fatty liver patient's liver fat drips GAP-associated protein GAP. Wherein, swimming lane M isMolecular weight of albumen standard; Swimming lane 1 is normal person; Swimming lane 2 is fatty liver patient.
Fig. 2 be normal person and fatty liver patient liver organization separate fat drip process in HSD17B13 egg in different componentWhite westernblot result. Wherein, LD is that fat drips albumen; TM is total film; Cyto is plasmosin; PNS is stoning supernatantLiquid.
Fig. 3 is the oil red O stain knot of the liver tissue slices of type ii diabetes mouse (db/db) and control mice (db/m)Really (200 ×).
Fig. 4 is HSD17B13 albumen in the liver of type ii diabetes mouse (db/db) and control mice (db/m)Westernblot picture and quantitative analysis. Wherein, A is westernblot picture; B is the relative quantification of HSD17B13 albumenAnalysis result, taking the expression of HSD17B13 albumen in control mice (db/m) liver as 1.
Fig. 5 is in high fat mouse (high lipid food of feeding, HF) and control mice (the normal feed of feeding, Con) liverWesternblot picture and the quantitative analysis of HSD17B13 albumen. Wherein, A is westernblot picture; B is HSD17B13The relative quantitative assay result of albumen, with the expression of HSD17B13 albumen in control mice (the normal feed of feeding, Con) liverBe 1.
Fig. 6 is westernblot qualification result and the RT-PCR testing result of recombined adhenovirus Ad-HSD17B13. ItsIn, A is westernblot picture; B is the relative quantitative assay result (RT-PCR) of HSD17B13 gene level, with 2MOI glandInfection group and viral infection group HSD17B13 gene expression dose is 1 than upper β-actin.
Fig. 7 is the qualification result of contrast recombined adhenovirus Ad-GFP.
Fig. 8 has been immune recombined adhenovirus Ad-HSD17B13 or mouse liver form and the group of contrast adenovirus Ad-GFPKnit section oil red O stain result. Wherein, A is liver form, and B is histotomy oil red O stain result.
Fig. 9 has been immune recombined adhenovirus Ad-HSD17B13 mouse (experimental group) or the mouse of contrast adenovirus Ad-GFPExpression testing result (the RT of HSD17B13mRNA in (control group) liver-PCR), with the expression of HSD17B13mRNA than upperAs the expression of the β-actin of internal reference, people HSD17B13/ β-actin is as index.
Figure 10 has been immune recombined adhenovirus Ad-HSD17B13 mouse (experimental group) or the mouse of contrast adenovirus Ad-GFPThe detection of expression result (westernblot) of HSD17B13 albumen in (control group) liver. Wherein, A is westernblot figureSheet, G3 represents to give the 3rd day (control group) after Ad-GFP, and B3 represents to give the 3rd day (experimental group) after Ad-HSD17B13; B isThe relative quantitative assay result of HSD17B13 albumen, taking the expression of HSD17B13 albumen in the liver of control group mice as 1.
Figure 11 has been immune recombined adhenovirus Ad-HSD17B13 mouse (experimental group) or the mouse of contrast adenovirus Ad-GFPThe measurement result of triglycerides in (control group) serum and liver (TG) and cholesterol (CHO) content.
Detailed description of the invention
The experimental technique using in following embodiment if no special instructions, is conventional method.
Material, reagent etc. used in following embodiment, if no special instructions, all can obtain from commercial channels.
AdEasy packaging system plasmid: shuttle plasmid pShuttle-CMV(is purchased from Stra-tagene company, #240007)With skeleton plasmid pAdEasy-1(purchased from Merck company, T240005). These two plasmids all contain can there is two of homologous recombinationIndividual homology arm.
HEK293 cell: purchased from ATCCCRL-1573.
C57BL/6 mouse; Male, 8 week age, purchased from Beijing Vital River Experimental Animals Technology Co., Ltd..
PacI restriction endonuclease is purchased from Merck company, R0547S; Pme I restriction endonuclease is purchased from NEB company, R0560S.
Embodiment 1, normal person and fatty liver patient's fat drips the Study on Different Proteomics of GAP-associated protein GAP
In the present embodiment, in vitro liver tissue samples is from normal person and fatty liver patient. Wherein, normal person's liverTissue samples comes from for healthy volunteer (not having a liver complaint and other diseases); Fatty liver patient's liver organization sample fromThe patient who is fatty liver in clinical definite, is provided by Peking University First Hospital.
One, liver fat drips purifying
1. liver organization sample is immersed in 4 DEG C of PBS of precooling, carefully removes coating and connective tissue with little scissors,Be cut into 1mm × 1mm × 1mm fritter, be transferred in 10ml precooling hypotonic medium A.
The hypotonic A liquid of precooling: 20mM glycine, 250mM sucrose, pH7.8, distilled water preparation. Each concentration is respective componentsFinal concentration.
2. carry out homogenate 20 times with glass homogenizer.
3. cross 200 eye mesh screens, collect single cell suspension.
4. with nitrogen pump smudge cells (500PSI, 15min, ice bath), collect 10ml sample.
5. low-speed centrifugal stoning (3000rpm, 4 DEG C centrifugal 10 minutes).
6. centrifugal rear sample divides three layers, and the superiors are cell fragment, and intermediate layer is stoning supernatant, is precipitated as nucleus. WithPipettor carefully pipettes intermediate layer and is placed in new 50ml centrifuge tube, as because of carelessness precipitation picked up, and can repeating step 5.
7. remove core supernatant (PNS). Get 200 μ l supernatants simultaneously in 1.5mlEP pipe, be labeled as PNS, for subsequent use.
8. prepare SW40 pipe, get 9mlPNS(approximately from mouth of pipe 3cm) add SW40 pipe, more slowly add by wall with 1ml rifle2mlB liquid (SW40 pipe is filled it up with).
B liquid: 20mMHEPES(HEPES), 100mM potassium chloride, 2mM magnesium chloride, pH7.4, distilled water is joinedSystem. Each concentration is the final concentration of respective components.
9. ultracentrifugation. Balance trim, puts into hanging basket, 10000rpm, and 1h, 4 DEG C are centrifugal.
10. after centrifugal, fat drips the top at gradient solution, is condensed into a leukorrhea, and precipitation belowFor total film;
11. use 200 μ l rifles carefully drip the superiors' fat and are transferred to 1.5mlEP pipe (each SW40 pipe approximately can sucking-off 300 μL). Manage and carefully siphon away B liquid with 1ml, get 200 μ lB liquid lower floor liquid, be plasmosin (cytosol), to 1.5mlEP pipe,Be labeled as Cyto. Remove supernatant, will precipitate with 200 μ lB liquid resuspendedly to 1.5mlEP pipe, vortex, is total film, is labeled as TM.
12. use B liquid) washing fat drip three times, with 200 μ lB liquid resuspended to 1.5mlEP manage, be labeled as LD.
13. extracting albumen. In each EP pipe (being labeled as totally four EP pipes of PNS, Cyto, TM and LD), add 300 μ lChloroform, thrum mixes, and adds 1ml acetone, and thrum mixes, centrifugal 15 minutes of 14000rpm.
14. now supernatant liquid be the lipid being dissolved in organic solvent, white precipitate is fat and drips albumen, upper strata is organicSolvent is collected with glass container ,-80 DEG C of preservations, and the placement of uncapping of remaining room temperature, treats organic solvent volatilization, adds one according to protein contentQuantitative sample-loading buffer.
15. 100 DEG C of protein samples sex change 5 minutes, for subsequent detection.
Two, Study on Different Proteomics
1. silver dyes
1. loading: preparation 1.0mm10%SDS-PAGE glue. By the fat after normal liver and fatty liver purifying drip albumen (withOn be labeled as the sample of LD) carry out loading, applied sample amount is 5 μ g, 20mA constant current is run to indicator from offset plate lower edge 0.5cm.
2. fixing: with containing 10%(volume fraction) glacial acetic acid and 40%(volume fraction) fixer of ethanol fixes 30 minutes.
3. sensitization: sensitization 30 minutes in sensitization liquid, wash each 3 minutes 3 times. Wherein, sensitization formula of liquid is as follows:In 100ml solution, contain volume fraction 30% ethanol, 0.314g sodium thiosulfate, 11.28g sodium acetate trihydrate.
4. silver dyes: in silver-colored dye liquor, silver dyes 20 minutes, washes one time. Wherein, silver-colored formula for dye liquor is as follows: in 100ml solutionContaining 0.25g silver nitrate and 40 μ l volume fraction 37% formaldehyde.
5. colour developing: develop the color with nitrite ion, change nitrite ion therebetween twice. Wherein, nitrite ion formula is as follows: 10g carbonic acidSodium, 40 μ l volume fraction 37% formaldehyde, add water to 200mL.
6. stop: when development contrast arrives the best by the time time, with stop buffer termination dyeing. Wherein, stop buffer formulaAs follows: 1.28gEDTA adds water to 100mL.
As shown in Figure 1, as can be seen from the figure, compared with Normal Human Liver, fatty liver fat drips SDS-PAGE coloration resultProtein sample has a band significantly raising in 33KDa position.
2. pair differential band is cut glue sample preparation (enzymolysis in glue)
1. by selected gel band (normal person and Patients with Fatty Liver liver organization sample are at the band of 33KDa position)Cut with knife blade, be placed in EP pipe, and record strip reel number and corresponding position, band is cut into 3-4mm3Size.
2. use the destainer (K that concentration is 30mM3Fe(CN)6The aqueous solution and concentration are the Na of 100mM2S2O3The aqueous solution according toThe ratio of volume ratio 1:1 is mixed) decolouring, after silver color is taken off, then the NH that is 25mM by concentration4HCO3The aqueous solution is washed transparent.
3. add acetonitrile (ACN) 200 μ l and dewater to micelle and bleach completely, blot, vacuum is drained 5 minutes.
4. add the dithiothreitol (DTT) that concentration is 10mM (DTT) aqueous solution 50 μ l, 56 DEG C of water-baths 1 hour.
5. after cool to room temperature, blot, add fast the iodo-acetamide that concentration is 55mM (IAM) aqueous solution 50 μ l, be placed in darkLocate 45 minutes.
6. the NH that is 25mM by concentration successively4HCO3Acetonitrile solution and acetonitrile that the aqueous solution, volume fraction are 50% are washed, secondTill nitrile is dewatered to micelle and bleaches completely, blot, vacuum is drained 5 minutes;
7. be that the enzymolysis liquid (promega, V5111 are dissolved in the carbonic hydroammonium of 25mM) of 0.1 μ g/ μ l is with dense by concentrationDegree is the NH of 25mM4HCO320 times of aqueous solution dilutions, every EP manages enzyme-added liquid measure and is as the criterion with complete wetting micelle, once centrifugal a little,Allow enzyme liquid fully contact with micelle, place on ice 30 minutes, treat that solution is absorbed by blob of viscose completely, siphon away unnecessary enzyme liquid, enrichingDegree is the NH of 25mM4HCO3The aqueous solution 30～45 μ l, are placed in 37 DEG C of water-baths, and digestion is spent the night.
8. use 5%(volume fraction) aqueous formic acid cessation reaction, make pH value of solution < 4, vibration mixes, centrifugal. Vacuum drying,Add 0.1%(volume fraction) aqueous formic acid 20 μ l dissolving polypeptide, upper machine carries out Mass Spectrometer Method.
Instrument be LTQ linear ion trap mass spectrometer (purchased from ThermoFishierScientific, Waltham,MA) people's that the mass spectrometric data, obtaining is announced with NCBI database is retrieved. The related software using isSEQUESTalgorithm (Ver.2.8), and ThermoElectronBioWorks (Rev.3.3.1), relevant parameter is establishedPut as follows: XCorrg1.5 (+1ions), 2.0 (+2ions), 2.5 (+3ions); DeltaCNg0.08; Spg500;Rspe5。
Result is as shown in table 1, visible, and compared with Normal Human Liver, it is aobvious in 33KDa position that fatty liver fat drips protein sampleThe band that work raises is probably that HSD17B13(abundance is the highest).
Table 1 silver dyes glue and cuts band recovery mass spectrum result
| Gene title | Molecular weight | Gene information numbering | Peptide hop count | |
| 1 | HSD17B13 | 29604.7 | 210032112 | 50 |
| 2 | HSD17B11 | 32935.6 | 142976729 | 13 |
| 3 | Retinol dehydrogenase 16 | 35673.2 | 150247226 | 8 |
Three, westernblot checking
The SDS-PAGE glue of preparation 10%, (protects four samples (PNS, cyto, TM and the LD) loading after step 1 purifyingCard Tot Prot equates), carry out electrophoresis, transferring film, primary antibodie adopts the anti-HSD17B13 antibody in rabbit source (purchased from abcam company, to produceProduct catalog number (Cat.No.) is ab122036), according to 1:1000(volume ratio) hatch, 4 DEG C are spent the night, the goat of two anti-employing HRP couplingsAnti-rabbit antibody (purchased from santacruz, sc2006), incubated at room 1 hour, washes film, luminous detection.
As shown in Figure 2, as can be seen from the figure, fatty liver fat drips component HSD17B13 albumen table to westernblot resultReach remarkable rise, prompting HSD17B13 albumen may play an important role in liver glycolipid metabolism regulates.
The detection of expression of HSD17B13 albumen in embodiment 2, type ii diabetes mouse and high fat mouse liver tissue
In HSD17B13 protein expression and liver organization, between lipidosis, there is positive relationship in order further to confirm, thisThe inventor of invention is to showing the lipid in type ii diabetes mouse and the high fat mouse liver tissue of fatty liver clinical symptomsThe expression of deposition conditions and HSD17B13 albumen detects.
One, the detection of expression of HSD17B13 albumen in type ii diabetes mouse liver tissue
Type ii diabetes mouse (db/db): genetic background is C57BL/KsJ, in the model organism research of south, ShanghaiThe heart. This mouse shows fatty liver clinical symptoms.
Control mice (db/m): genetic background is C57BL/KsJ, purchased from Shanghai Southern Biological Research Center. This is littleThe fat-free liver clinical symptoms performance of mouse.
Difference and relation between two kinds of mouse of db/db and db/m: within 1966, U.S. Jackson laboratory is in C57BL/Ks(db/db) Strains of Mouse is found diabetes mutators (db), and it is to be positioned at No. 4 chromosomal leptin receptor (Leptin of mouseReceptor) due to gene is undergone mutation. Db/db mouse main manifestations is hypothalamus defect, and it can not produce full sense, to fullSense material (leptin) lacks reaction, thereby anabolism is greater than catabolism, causes fatty accumulation and obesity develops into graduallySerious diabetes are with obvious hyperglycemia. This mouse has the clinical symptoms similar with mankind's diabetes B, many drinks,The syndromes such as many foods, diuresis, obesity, hyperglycaemia, hyperinsulinemia, insulin resistance, fat metabolic disorder, dm/m does not go outExisting metabolic disorder is the conventional contrast of db/db.
Get the liver organization sample of type ii diabetes mouse (db/db) and control mice (db/m), make on the one hand tissueSection, with oil red, O(dyes fat) dyeing, intuitively observe lipidosis situation; On the other hand, carry out westernblot and detect liverThe expression of HSD17B13 albumen in dirty tissue. Concrete operations are as follows:
1, histotomy oil red O stain
Concrete operation is as follows:
(1) histotomy is fixed 10 minutes with 4% paraformaldehyde; (2) distillation washing; (3) 60% isopropyl alcohols embathe; (4) oilRed O dye liquor 10 minutes; (5) 60% isopropyl alcohol color separations are colourless to background; (6) distillation washing; (7) Mayer haematoxylin redyeing; (8)Washing (oil blackeite) from the beginning 1～3 minute; (9) distillation washing; (10) glycerin gelatine mounting. (11) to be dissolved in 100ml different for oil red O0.5gPropyl alcohol.
Result as shown in Figure 3. As can be seen from the figure, db/db mouse liver occurs that obvious lipidosis is (red for to be dyedOn fat drip, visible large area is dyed to red region).
2、westernblot
First, prepare loading albumen with reference to preparing the method that liver fat drips (LD) in embodiment 1 step 1; Dying with reference to realityThe method of executing in example 1 step 3 is carried out westernblot, and antibody used is that the primary antibodie and two in embodiment 1 resists, wherein conductThe anti-HSD17B13 antibody (purchased from abcam company, catalog number is ab122036) in the rabbit source of primary antibodie can be identified simultaneouslyPeople HSD17B13 and mouse HSD17B13.
Taking elF5 as internal reference, primary antibodie is that (purchased from santacruz, catalog number is sc-to the anti-elF5 antibody in rabbit source simultaneously292173), two goat anti-rabbit antibodies (purchased from santacruz, sc2006) that resist for HRP coupling.
Gained westernblot collection of illustrative plates is carried out to gray analysis with mapping software I MAGEJ, with the gray scale of HSD17B13Value is than the gray value of the upper elF5 as internal reference, and mouse HSD17B13/elF5, as index, is then normalized control groupProcess, average by the ratio of the each sample of control group, then using each sample than upper this mean value as last relative quantificationAs a result, do block diagram with Graphpad5.0.
Westernblot collection of illustrative plates as shown in A in Fig. 4, as can be seen from the figure, type ii diabetes mouse (db/db) liverIn tissue, the object Band signal of HSD17B13 albumen is obviously stronger than the object Band signal of control mice (db/m). FurtherQuantitative analysis results as shown in B in Fig. 4, as can be seen from the figure, in type ii diabetes mouse (db/db) liver organizationThe expression of HSD17B13 albumen is nearly 2 times of control mice (db/m).
Two, the detection of expression of HSD17B13 albumen in high fat mouse liver tissue
1, the preparation of high fat mouse model
The high lipid food of feeding MD45% to SPF level male C57BL/6 mouse in 4 week age (body weight 20-22g), obtains high fat littleRat animal model. Feed formula and concrete operations reference " Zhou Yunfeng, Li Sha, Su Wen etc. the high fat purifying of different fat contents is joinedThe impact that side's feed occurs large and small mouse metabolic syndrome. preclinical medicine is with when participating in the cintest, 2012 (3): 273-277. " literary composition carries out.
Simultaneously taking SPF level male C57BL/6 mouse in 4 weeks age (body weight 20-22g) mouse of the normal feed of feeding as contrasting.
2、westernblot
First, prepare loading albumen with reference to preparing the method that liver fat drips (LD) in embodiment 1 step 1; Dying with reference to realityThe method of executing in example 1 step 3 is carried out westernblot, and antibody used is that the primary antibodie and two in embodiment 1 resists, wherein conductThe anti-HSD17B13 antibody (purchased from abcam company, catalog number is ab122036) in the rabbit source of primary antibodie can be identified simultaneouslyPeople HSD17B13 and mouse HSD17B13.
Taking elF5 as internal reference, primary antibodie is that (purchased from santacruz, catalog number is sc-to the anti-elF5 antibody in rabbit source simultaneously292173), two goat anti-rabbit antibodies (purchased from santacruz, sc2006) that resist for HRP coupling.
Gained westernblot collection of illustrative plates is carried out to gray analysis with mapping software I MAGEJ, with the gray scale of HSD17B13Value is than the gray value of the upper elF5 as internal reference, and mouse HSD17B13/elF5, as index, is then normalized control groupProcess, average by the ratio of the each sample of control group, then using each sample than upper this mean value as last relative quantificationAs a result, do block diagram with Graphpad5.0.
Westernblot collection of illustrative plates as shown in A in Fig. 5, as can be seen from the figure, in high fat mouse liver tissueThe object Band signal of HSD17B13 albumen is obviously stronger than the object Band signal of control mice (the normal feed of feeding). Enter oneThe quantitative analysis results of step as shown in B in Fig. 5, as can be seen from the figure, HSD17B13 albumen in high fat mouse liver tissueExpression is more than 2 times of control mice (the normal feed of feeding).
The recombined adhenovirus of embodiment 3, construction expression HSD17B13 albumen
The present embodiment will utilize the recombined adhenovirus of AdEasy system packaging expression HSD17B13 albumen, specific as follows:
One, the preparation of HSD17B13 recombined adhenovirus (Ad-HSD17B13)
1, the clone of HSD17B13 full length sequence
The amino acid sequence of HSD17B13 albumen is shown in the sequence 1 of sequence table, and its coded sequence is if the sequence 2 of sequence table is from 5 'Shown in the nucleotides of end 25-927 position. HSD17B13 gene shown in analytical sequence 2, establishes at its both sides, code area near zoneMeter primer, and add His label at downstream primer, final primer sequence is as follows:
(the 3-24 position of this sequence is of sequence 2 to upstream primer: 5 '-GCATGAACATCATCCTAGAAATCC-3 '25-46 position);
Downstream primer: 5 '-GCTCAATGGTGATGGTGATGATGTTTCATTTTGATTTTGT-3 ' (underscore place isThe reverse complementary sequence of the 908-924 position of sequence 2).
(also can be with manually synthetic sequence taking in vitro people's liver (taking from Peking University First Hospital) cDNA as templateIn table, DNA fragmentation shown in sequence 2 is template), adopt above-mentioned primer, carry out RT-PCR with high-fidelity pfuDNA polymerase. PCRAmplified production carries out agarose electrophoresis, reclaims the band of 900bp left and right. Products therefrom is checked order, show that its sequence is for " GC25-924 position+the CATCATCACCATCACCATTGAGC of+sequence 2 ".
2, the structure of recombinant shuttle plasmid
1. use T4 ligase by step 1 gained amplified fragments with pEASY-T3(purchased from Quan Shi King Company) be connected,Transform amplification to connecting product, extract the recombinant plasmid that TA clone obtains, called after pEASY-HSD17B13; Through checking order heavilyGroup plasmid pEASY-HSD17B13 inserts the " 25-924 position+CATCATCACCATC of GC+ sequence 2 in pEASY-T3ACCATTGAGC " after the recombinant plasmid that obtains.
2. cut recombinant plasmid pEASY-HSD17B13 with restriction enzyme NotI enzyme, (size is about to reclaim object fragment910bp), it is connected with the carrier framework of the same pAdTrack-CMV plasmid of cutting through NotI enzyme, obtains recombinant plasmid,Called after pAdTrack-CMV-HSD17B13(claims again recombinant shuttle plasmid). Through order-checking, recombinant plasmid pAdTrack-CMV-HSD17B13 inserts " GGGAATTCGATTGGATCGCCCTT at the restriction enzyme site NotI place of pAdTrack-CMV plasmid+ GC+ sequence 2 is from 5 ' end 25-924 position nucleotides+CATCATCACCATCACCATTGAGC+AAGGGCGATCCCAATCACTAGTGAATTC " after the recombinant plasmid that obtains.
3, the preparation of recombined adhenovirus
(1) cotransformation
1. the recombinant plasmid pAdTrack-CMV-HSD17B13 building by Pme I endonuclease digestion step 2, solidifying with agaroseGel electrophoresis is identified linearizing efficiency, and by its recovery.
2. by g) linearizing pAdTrack-CMV-HSD17B13, the about 100ng of 1 μ l(of 1-5 μ l(approximately 1 μ) viral skeleton matterGrain pAdEasy-1 and 40 μ l E.coli BJ5183 (purchased from Merck company, ST200157) electricity turn competence and mix, cold on iceBut.
3. mixture is added to electric revolving cup, electric shock (1250-1500V/mm, 5ms).
4. electric shock finishes to take out sample, add 1mlLB culture medium (1L formula: tryptone 10g, yeast extract 5g,NaCl10g, pH7.0, distilled water preparation), 37 DEG C of low-speed oscillation 40min, (every milliliter of culture medium is containing 25-to be then coated with LB flat board50mg kanamycins), cultivate 16-20hr for 37 DEG C.
5. the bacterium colony (selecting minimum bacterium colony) growing on picking flat board next day, is inoculated in (every milliliter of 3mlLB culture mediumCulture medium is containing 25-50mg kanamycins), cultivate 10-15hr for 37 DEG C.
6. alkali cracking method is extracted plasmid, 0.8% agarose gel electrophoresis screening, the positive colony that large plasmid is candidate.
7. candidate's positive colony is carried out to PacI single endonuclease digestion, then carry out 0.8% agarose gel electrophoresis, show oneThe positive clone of large fragment (about 30kb) and small fragment (approximately 3.0 or 4.5kb).
8. get 1-5 μ l positive colony and transform bacillus coli DH 5 alpha (purchased from Merck company, D0351), amplification recombinant bacterium is also pureChange plasmid, obtain recombinant virus plasmid, by its called after pAdEasy-HSD17B13. Recombinant virus plasmid pAdEasy-HSD17B13 is that recombinant shuttle plasmid pAdTrack-CMV-HSD17B13 and skeleton plasmid pAdEasy-1 pass through two homology armsThe plasmid obtaining after recombinating.
(2) recombinant virus plasmid infects HEK293 cell
1. HEK293 cell is cultivated: infected before 24 hours inoculation 2 × 106Individual HEK293 cell is in 25cm2Blake bottle, makes rawThe about 50-70% of long density.
2. use the recombinant virus plasmid pAdEasy-HSD17B13 of restriction enzyme PacI single endonuclease digestion step (1) purifying(approximately 4 μ gDNA), after total Linearization, ethanol precipitation, then use 20 μ lddH2O dissolves.
The linearisation recombinant virus plasmid 3. 2. step being obtained and liposome (Lipofectamine2000, purchased fromInvitrogen company, 11668-027) be diluted in respectively 500 μ l serum free mediums and mix again, be placed in 15-under room temperature30min, obtains Lipofectamine-DNA mixture.
4. with serum free medium washing step blake bottle 1. gently, separately add 2.5ml serum free medium, 37 DEG C of placements10min。
5. the Lipofectamine-DNA mixture 3. step being obtained adds step blake bottle 4., and 37 DEG C of incubators are putPut 4hr.
6. abandon Lipofectamine-DNA mixed liquor, separately add 6mlDMEM complete medium (containing volume fraction 10%FCS), 37 DEG C of incubators are cultivated; Observation of cell growing state in incubation, can be observed cytopathy and occurs, now after approximately 2 weeksCarry out following steps 4 or step 6.
4, the amplification of recombined adhenovirus Ad-HSD17B13
1. collecting cell precipitates, and adds the PBS suspendible of 2ml sterilizing, frozen-thawed cell, centrifugal rear collection supernatant (viral supernatant)Be stored in-80 DEG C.
②75cm2In blake bottle, inoculate HEK293 cell, reach 90% to density, add appropriate viral supernatant infection cell;After 3-4d, it is round that cell almost becomes, and have a semicell floating, collects all cells. About 500g rotating speed is centrifugal, abandons supernatant.
3. with the resuspended precipitation of sterilizing PBS, multigelation 4 times; At 4 DEG C, the centrifugal 5min of 7000g, obtains virolysis supernatantLiquid; Viral purification at least needs 30 bottles of 75cm2The supernatant of blake bottle cell.
4. CsCl continuous gradient centrifugal purification: weigh 4.4gCsCl in 50ml centrifuge tube, add 8ml virolysis supernatantLiquid, mixes, and volume is about 10ml; Be transferred to 12ml ultracentrifugation pipe (for SW41 rotary head), cover about 2ml mineral oil; FlatAfter weighing apparatus, the centrifugal 18-24hr of 32000rpm at 4 DEG C, with syringe pump centrifugal go out the disease of density between 1.30-1.40g/mlPoison band (milky virus band).
5. virus dialysis is desalted: configuration dislysate (formula: 10mMTrispH8.0,2mMMgCl2, 5% (w/v) sugarcaneSugar), sterilization treatment; By the virus-4 pumping out DEG C dialysis, change 3 times dislysate, can substantially remove CsCl, obtain object virusLiquid (Ad-HSD17B13), is stored in-80 DEG C.
5, virus titer is measured (TCID50)
The virus as follows step 4 being obtained is preserved liquid Ad-HSD17B13 and is carried out titer determination, and experiment repeats threeInferior, results averaged.
(1) cell is prepared
1. collect one bottle of HEK293 cell, counting.
2. preparing 20ml density with the DMEM culture medium that contains 2% serum is 105The cell of/ml.
The ③Yong 12 road volley of rifle fires every hole in 2 96 orifice plates adds 100 μ l cell suspensions.
(2) carry out virus titer mensuration (TCID50)
1. the DMEM culture medium that adds 0.9ml to contain 2% serum in the 1st pipe, all the other add 1.8ml. In the 1st pipe, add again0.1ml virus is preserved liquid.
2. inhale and make a call to 5 times and mix up and down.
3. use new rifle head instead, from the 1st pipe, draw 0.2ml and add in the 2nd pipe. Repeatedly be diluted to high dilution.
4. last 8 dilutions add 96 orifice plates, every hole 0.1ml, each dilution factor 10 holes, the 2 negative contrasts in hole. NegativeThe DMEM culture medium monitoring cell survival situation that adds 0.1ml to contain 2% serum in control wells. When application of sample, open from high dilutionBegin.
5. after 10 days, under inverted microscope, observe, calculate the hole count that occurs CPE in each row. As long as have a point or oneA little cells occur that CPE is positive, if cannot determine, can with negative control comparison.
6. calculate in each row and occur positive hole count.
If good without any CPE and Growth of Cells in negative control, the positive and high dilution of minimum dilution factor 100%100% feminine gender, this test is effectively.
7. titre can accurately calculate by KARBER statistic law: for the dilution of 100 μ l, titre computing formula is as follows: T=101+d（s-0.5）
In formula, d=log10Dilution factor=1(is for the dilution factor of 10 times);
The positive ratio sum of s=(since the 1st 10 times of dilution factors).
Result shows: the titre that the virus that step 4 obtains is preserved liquid Ad-HSD17B13 is 1011.2TCID50/ml。
(3) TCID50/ml is converted to PFU/ml
The titre d=log10 value measuring due to TCID50 method is higher by 0.7 than standard Plaque Technique Detected, so can incite somebody to action according to following formulaTCID50/ml is converted to PFU/ml:
T=1×10aTCID50/ml=1×10(a-0.7)PFU/ml
Should differ≤0.7 log10 value (10 of the titre value that double repeated experiment obtains0.7）。
Through conversion, result shows: the titre that the virus that step 4 obtains is preserved liquid Ad-HSD17B13 is 3.2 × 1010PFU/ml。
6, the qualification to recombined adhenovirus Ad-HSD17B13
（1）westernblot
Preparation 10% SDS-PAGE glue, gets respectively 2,10,20,40, the HEK293 cell of 100MOI adenovirus infection, 36hAfter, collecting cell, the cell protein after cracking carries out electrophoresis, transferring film, primary antibodie adopt rabbit source anti-HSD17B13 antibody (purchased fromAbcam company, catalog number is ab122036), according to 1:1000(volume ratio) hatch, 4 DEG C are spent the night, two anti-employingsThe goat anti-rabbit antibodies (purchased from santacruz, sc2006) of HRP coupling, incubated at room 1 hour, washes film, luminous detection. SimultaneouslyUsing contrast adenovirus (Ad-GFP) as negative control, the preparation method of contrast adenovirus (Ad-GFP) sees below.
Taking elF5 as internal reference, primary antibodie is that (purchased from santacruz, catalog number is sc-to the anti-elF5 antibody in rabbit source simultaneously292173), two goat anti-rabbit antibodies (purchased from santacruz, sc2006) that resist for HRP coupling.
Westernblot result is as shown in A in Fig. 6, and as can be seen from the figure, recombined adhenovirus Ad-HSD17B13 is successfulExpress HSD17B13 albumen.
（2）RT-PCR
Get respectively 2,10,20,40, the HEK293 cell of 100MOI adenovirus infection, after 36h, collecting cell, extracts totalRNA. Utilize the reverse transcription kit purchased from Fermentas company of the U.S., carry out to specifications reverse transcription and become cDNA. Then,Expression according to carrying out as follows PCR in real time detection HSD17B13mRNA:
Instrument AgilentTechnologies, MX3000P.
Loop parameter is: 95 DEG C 5 minutes; 95 DEG C 30 seconds, 59 DEG C 30 seconds, 72 DEG C 30 seconds, 35 circulations; 72 DEG C 7 minutes.
People HSD17B13 primer sequence is as follows:
Upstream: 5 '-ATCCAGCCGATCTTCTCAGC-3 ' (the 398-417 position of sequence 2);
Downstream: 5 '-TTCCCAAGGCCTGAAGTTCT-3 ' (reverse complementary sequence of the 627-646 position of sequence 2);
Taking people β-actin as internal reference, its primer sequence is as follows:
Upstream: 5 '-GGGAAATCGTGCGTGACATT-3 ';
Downstream: 5 '-GGAAGGAAGGCTGGAAGAGT-3 '.
HSD17B13 gene real-time quantitative analysis result is as shown in B in Fig. 6. With 2MOI adenovirus infection group HSD17B13 baseBecause expression is 1 than upper β-actin.
Two, the preparation of contrast adenovirus (Ad-GFP)
1, cotransformation
With having GFP on this carrier of pAdTrack-CMV() replace pAdTrack-CMV-HSD17B13, other is with in step 13(1). To obtain contrasting recombinant virus plasmid, by its called after pAdEasy-GFP. Contrast recombinant virus plasmid pAdEasy-GFPThe matter obtaining after recombinating by two homology arms for recombinant shuttle plasmid pAdTrack-CMV and skeleton plasmid pAdEasy-1Grain.
2, contrast recombinant virus plasmid infects HEK293 cell
With contrast recombinant virus plasmid, pAdEasy-GFP replaces recombinant virus plasmid pAdEasy-HSD17B13, and other is same3(2 in step 1).
3, the amplification of contrast recombined adhenovirus
The nutrient solution preparation contrast virus liquid obtaining by step 2, method is with 4 of step 1. By sick the contrast restructuring obtainingPoison called after Ad-GFP. And carry out titer determination according to 5 method in step 1.
4, the qualification of contrast recombined adhenovirus
The fluoroscopic examination result of contrast recombined adhenovirus Ad-GFP as shown in Figure 7,, is observed after 11 days in packaging in cellTo obvious green fluorescence, illustrate and pack successfully.
Embodiment 4, the recombined adhenovirus Ad-HSD17B13 immune mouse that utilizes embodiment 3 to build
One, grouping administration
By C57BL/6(body weight 25g in male 8 week age) mouse divides two groups, and 5 every group, administration is as follows respectively:
Control group: the Ad-GFP virus liquid after tail vein injection 100 μ l normal saline dilutions is (containing 1.0 × 109pfu）。
Experimental group: Ad-HSD17B13 virus liquid after tail vein injection 100 μ l normal saline dilutions (containing 1.0 ×109pfu）。
Amounting to virus immunity amount is: 4 × 107Pfu virus/g Mouse Weight.
Two, immune effect detects
After immunity finishes the 3rd day, each group of mouse carried out to the detection of following several respects:
1, liver morphologic observation
Respectively the liver form of control group and experimental mice is observed, result shows experimental mice liver volumeSlightly increase, coating anxiety is smooth, edge rust, and tangent plane outgoing, quality softness, look Huang, has greasy feeling, is typical fatty liver tableType. And control group mice liver form is normal. Specifically as shown in A in Fig. 8.
2, liver tissue slices oil red O stain
The liver organization of control group and experimental mice carries out frozen section respectively, then dyes fat with oil red O() dyeing,Lipidosis situation in observation liver organization directly perceived. Concrete operations are as follows: (1) section is fixed 10 minutes with 4% paraformaldehyde; (2)Distillation washing; (3) 60% isopropyl alcohols embathe; (4) oil red O dye liquor 10 minutes; (5) 60% isopropyl alcohol color separations are colourless to background; (6)Distillation washing; (7) Mayer haematoxylin redyeing; (8) washing (oil blackeite) from the beginning 1～3 minute; (9) distillation washing; (10) glycerine is brightRubber seal sheet; (11) oil red O0.5g is dissolved in 100ml isopropyl alcohol.
Result is as shown in B in Fig. 8, and as can be seen from the figure, in experimental mice liver, fat drips number significantly increases, and fat dripsIncrease, occur fatty liver (large area is dyed to red region).
3, RT-PCR detects
Respectively people HSD17B13mRNA in the liver organization of control group and experimental mice is carried out to RT-PCR detection, concreteAs follows:
(1) extraction of total RNA
1) every 50mg tissue uses 1mlTrizol, after low temperature tissue homogenate, and incubated at room 5 minutes; 2) add 0.2ml chlorineImitative, concuss 15 seconds, incubated at room 5 minutes; 3) 12000g, 4 DEG C are centrifugal 10 minutes; 4) carefully draw intermediate layer water (Upper strata is fat deposit) to new EP pipe; 5) add equal-volume 70% ethanol, after mixing, add centrifugal column; 6) 12,000g, 4 DEG C centrifugal 1Minute. Discard the liquid in collecting pipe; 7) 75% ethanol washing precipitation of use 1ml precooling, 12,000g, 4 DEG C are centrifugal 5 minutes; 8)By the absolute ethanol washing precipitation of 1ml precooling, 12,000g, 4 DEG C are centrifugal 5 minutes; Abandon supernatant, of short duration centrifugal, carefully inhale with rifle headRemove residual liquid. In air at room temperature, be dried approximately 5 minutes, add appropriate tri-distilled water.
(2) reverse transcription of RNA
Utilize the reverse transcription kit purchased from Fermentas company of the U.S., carry out to specifications reverse transcription and become cDNA.
(3) PCR in real time detects the expression of corresponding gene
Instrument AgilentTechnologies, MX3000P.
Loop parameter is: 95 DEG C 5 minutes; 95 DEG C 30 seconds, 59 DEG C 30 seconds, 72 DEG C 30 seconds, 35 circulations; 72 DEG C 7 minutes.
People HSD17B13 primer sequence is as follows:
Upstream: 5 '-ATCCAGCCGATCTTCTCAGC-3 ' (the 398-417 position of sequence 2);
Downstream: 5 '-TTCCCAAGGCCTGAAGTTCT-3 ' (reverse complementary sequence of the 627-646 position of sequence 2);
Taking mouse β-actin as internal reference, its primer sequence is as follows:
Upstream: 5 '-AGCCATGTACGTAGCCATCC-3 ';
Downstream: 5 '-GCTGTGGTGGTGAAGCTGTA-3 '.
Result as shown in Figure 9, as can be seen from the figure, does not detect people in control group mice liver organizationThe expression (ratio of people HSD17B13/ β-actin is 0) of HSD17B13mRNA, and detect in experimental mice liver organizationThe HSD17B13mRNA of high-load, the ratio of its people HSD17B13/ β-actin is up to 7000.
4, Westernblot detects
Adopt Westernblot method to detect the table of HSD17B13 albumen in control group and experimental mice liver organizationThe amount of reaching. Specific as follows:
First, prepare loading albumen with reference to preparing the method that liver fat drips (LD) in embodiment 1 step 1; Dying with reference to realityThe method of executing in example 1 step 3 is carried out westernblot, and antibody used is that the primary antibodie and two in embodiment 1 resists, wherein conductThe anti-HSD17B13 antibody (purchased from abcam company, catalog number is ab122036) in the rabbit source of primary antibodie can be identified simultaneouslyPeople HSD17B13 and mouse HSD17B13.
Taking elF5 as internal reference, primary antibodie is that (purchased from santacruz, catalog number is sc-to the anti-elF5 antibody in rabbit source simultaneously292173), two goat anti-rabbit antibodies (purchased from santacruz, sc2006) that resist for HRP coupling.
Gained westernblot collection of illustrative plates is carried out to gray analysis with mapping software I MAGEJ, with the gray scale of HSD17B13Value is than the gray value of the upper elF5 as internal reference, and mouse HSD17B13/elF5, as index, is then normalized control groupProcess, average by the ratio of the each sample of control group, then using each sample than upper this mean value as last relative quantificationAs a result, do block diagram with Graphpad5.0.
Westernblot result, as shown in A in Figure 10, as can be seen from the figure, detects in experimental mice liver organizationExpress to a large amount of HSD17B13 albumen (people HSD17B13+ mouse HSD17B13). By contrast, in control group mice, detectThe HSD17B13 albumen (being only mouse HSD17B13) of low amount is expressed. Further quantitative analysis results, as shown in B in Figure 10, is testedThe expression of organizing HSD17B13 albumen in mouse liver tissue is about 2 times of control group mice.
5, the mensuration of triglycerides and cholesterol level in liver organization
The present inventor further adopts kit in control group and experimental mice liver organization and serumThe content of triglycerides (TG) and cholesterol (CHO) is measured. Wherein, measure the reagent that triglycerides (TG) content adoptsBox is that catalog number is F001-2 purchased from building up Bioengineering Research Institute in Nanjing; Measure the examination that cholesterol (CHO) content adoptsAgent box is that catalog number is F002-2 purchased from building up Bioengineering Research Institute in Nanjing. Concrete operations are referring to kit descriptionCarry out.
Result is (mean value of 5 mouse in every group) as shown in figure 11, and two groups of mice serum triglycerides and cholesterol containAmount is without significant difference. And liver tg and cholesterol level, compared with control group (Ad-GFP), through recombined adhenovirusThe mouse that Ad-HSD17B13 processes shows remarkable rise.
In the present embodiment, all pathological characteristics of experimental mice are all consistent with clinical fatty liver. Visible, according to this realityExecute method described in example, experimental mice is carried out to immunity with recombined adhenovirus Ad-HSD17B13, can build fatty liver animal mouldType.
In addition, the result of the present embodiment also further points out HSD17B13 albumen to promote to do to having of fatty liverWith, the expression that suppresses this albumen may improve fatty liver.
Claims (12)
1.HSD17B13 albumen or its encoding gene are in the application building in fatty liver model.
The application in the product for the preparation of structure fatty liver model of 2.HSD17B13 albumen or its encoding gene.
3. application according to claim 1 and 2, is characterized in that: described HSD17B13 albumen is by sequence in sequence table 1Shown in the albumen of amino acid sequence composition.
4. application according to claim 3, is characterized in that: the encoding gene of described HSD17B13 albumen is following (1)Or the DNA molecular shown in (2):
(1) coded sequence is the DNA molecular of the 25-927 position of sequence 2 in sequence table;
(2) DNA molecular shown in sequence 2 in sequence table.
5. utilize HSD17B13 albumen or its encoding gene to build a method for fatty liver model, comprise the steps:In object animal, import described HSD17B13 albumen or its encoding gene, the transgenosis that obtains having fatty liver clinical symptoms is movingThing.
6. according to the method shown in claim 5, it is characterized in that: described HSD17B13 albumen or its encoding gene are by heavyThe form of group adenovirus vector imports in described object animal;
Described recombinant adenoviral vector is the recombined adhenovirus of expressing described HSD17B13 albumen.
7. method according to claim 6, is characterized in that: in described object animal, import described HSD17B13 albumenOr its encoding gene is: by described recombinant adenoviral vector according to object the weight of animals 4.0 × 10 described in every kg10The consumption of pfuThe described object animal of immunity.
8. method according to claim 5, is characterized in that: described HSD17B13 albumen is for by 1 of sequence in sequence tableShow the albumen of amino acid sequence composition.
9. method according to claim 8, is characterized in that: the encoding gene of described HSD17B13 albumen is following (1)Or the DNA molecular shown in (2):
(1) coded sequence is the DNA molecular of the 25-927 position of sequence 2 in sequence table;
(2) DNA molecular shown in sequence 2 in sequence table.
10. for building the cover medicine of fatty liver model, comprise recombinant adenoviral vector and medication instruction book;
Described recombinant adenoviral vector is the recombined adhenovirus of expressing HSD17B13 albumen;
Described medication instruction book is described below content: by described recombinant adenoviral vector according to every kg object the weight of animals 4.0 ×1010Object animal described in the consumption intravenous injection of pfu.
11. cover medicines according to claim 10, is characterized in that: described HSD17B13 albumen is by sequence in sequence table 1Shown in the albumen of amino acid sequence composition.
12. cover medicines according to claim 11, is characterized in that: the encoding gene of described HSD17B13 albumen is as followsOr the DNA molecular shown in (2) (1):
(1) coded sequence is the DNA molecular of the 25-927 position of sequence 2 in sequence table;
(2) DNA molecular shown in sequence 2 in sequence table.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310503889.0A CN103520724B (en) | 2013-10-23 | 2013-10-23 | The new purposes of the inhibitor of HSD17B13 albumen or its encoding gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310503889.0A CN103520724B (en) | 2013-10-23 | 2013-10-23 | The new purposes of the inhibitor of HSD17B13 albumen or its encoding gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103520724A CN103520724A (en) | 2014-01-22 |
| CN103520724B true CN103520724B (en) | 2016-05-25 |
Family
ID=49923309
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310503889.0A Active CN103520724B (en) | 2013-10-23 | 2013-10-23 | The new purposes of the inhibitor of HSD17B13 albumen or its encoding gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103520724B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019183329A1 (en) * | 2018-03-21 | 2019-09-26 | Ionis Pharmaceuticals, Inc. | Modulation of hsd17b13 expression |
| US11845963B2 (en) | 2017-01-23 | 2023-12-19 | Regeneron Pharmaceuticals, Inc. | HSD17B13 variants and uses thereof |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20190139869A (en) | 2017-04-11 | 2019-12-18 | 리제너론 파마슈티칼스 인코포레이티드 | Assays for Screening the Activity of Regulators of Members of the Hydroxysteroid (17-Beta) Dehydrogenase (HSD17B) Family |
| CA3078883A1 (en) * | 2017-10-11 | 2019-04-18 | Regeneron Pharmaceuticals, Inc. | Inhibition of hsd17b13 in the treatment of liver disease in patients expressing the pnpla3 i148m variation |
| CN112020556A (en) * | 2018-03-21 | 2020-12-01 | 瑞泽恩制药公司 | 17 beta hydroxysteroid dehydrogenase type 13 (HSD17B13) iRNA compositions and methods of use thereof |
| CR20210186A (en) * | 2018-09-19 | 2021-06-14 | Arrowhead Pharmaceuticals Inc | Rnai agents for inhibiting expression of 17beta-hsd type 13- (hsd17b13), compositions thereof, and methods of use |
| JP7394137B2 (en) | 2018-12-21 | 2023-12-07 | アイオニス・ファーマシューティカルズ・インコーポレイテッド | Modulators of HSD17B13 expression |
| CN113817062B (en) * | 2021-07-26 | 2023-06-23 | 无锡傲锐东源生物科技有限公司 | Anti-human hydroxysteroid 17-beta dehydrogenase 13 (HSD 17B 13) rabbit monoclonal antibody and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1878786A (en) * | 2003-11-12 | 2006-12-13 | 索尔瓦药物有限公司 | Novel 17beta-hydroxysteroid dehydrogenase type i inhibitors |
| CN101918352A (en) * | 2007-11-20 | 2010-12-15 | 斯特里克斯有限公司 | Inhibitors of 17beta-hydroxysteroid dehydrogenase |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU1067697A (en) * | 1995-12-05 | 1997-06-27 | Jouko Antero Oikarinen | Hsd17b1 promoter, enhancer, silencer and use thereof |
| EP1864971A4 (en) * | 2005-03-31 | 2010-02-10 | Takeda Pharmaceutical | Prophylactic/therapeutic agent for diabetes |
-
2013
- 2013-10-23 CN CN201310503889.0A patent/CN103520724B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1878786A (en) * | 2003-11-12 | 2006-12-13 | 索尔瓦药物有限公司 | Novel 17beta-hydroxysteroid dehydrogenase type i inhibitors |
| CN101918352A (en) * | 2007-11-20 | 2010-12-15 | 斯特里克斯有限公司 | Inhibitors of 17beta-hydroxysteroid dehydrogenase |
Non-Patent Citations (4)
| Title |
|---|
| 17β-Hydroxysteroid dehydrogenase type 13 is a liver-specific lipid droplet-associated protein;Yuka Horiguchi et al.;《Biochemical and Biophysical Research Communications》;20080324;第370卷;第213-218页 * |
| Identification of HSD17β13 and RORA as Genes Involved in Pathogenesis of Nonalcoholic Fatty Liver Disease;Yaron Rotman et al.;《Hepatology》;20121001;第56卷(第S1期);第265A页 * |
| Molecular cloning and expression analysis of a new gene for short chain dehydrogenase/reductase 9;Shen Liu et al.;《Acta Biochimica Polonia》;20070220;第54卷(第1期);第213-218页 * |
| 人类17β-羟基类固醇脱氢酶的功能;张万飞等;《海南医学》;20080110;第19卷(第01期);第127-130页 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11845963B2 (en) | 2017-01-23 | 2023-12-19 | Regeneron Pharmaceuticals, Inc. | HSD17B13 variants and uses thereof |
| WO2019183329A1 (en) * | 2018-03-21 | 2019-09-26 | Ionis Pharmaceuticals, Inc. | Modulation of hsd17b13 expression |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103520724A (en) | 2014-01-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103520724B (en) | The new purposes of the inhibitor of HSD17B13 albumen or its encoding gene | |
| CN112121063B (en) | Application of exosome in preparation of medicine for treating pulmonary fibrosis | |
| CN108330108A (en) | CH-GD-12-2014 plants of 3 type inactivated vaccine of Ana 1 aviadenovirus | |
| Chen et al. | Up-regulation of THY1 attenuates interstitial pulmonary fibrosis and promotes lung fibroblast apoptosis during acute interstitial pneumonia by blockade of the WNT signaling pathway | |
| CN102023218A (en) | Serum maker of HBV (hepatitis B virus) infestor and application thereof | |
| Zhenzhong et al. | Fibrinogen-like protein 2 gene silencing inhibits cardiomyocytes apoptosis, improves heart function of streptozotocin-induced diabetes rats and the molecular mechanism involved | |
| CN113559273B (en) | Pretreatment method of adult stem cells for intravenous injection, adult stem cell injection and application | |
| Quan et al. | Thymosin β4 promotes the survival and angiogenesis of transplanted endothelial progenitor cells in the infarcted myocardium | |
| CN105251020B (en) | Ubiquitin-specific protease 4（USP4）Function in treating myocardial hypertrophy and application | |
| Li et al. | Effect of different types of macrophages on hepatic fibrosis in Echinococcus Granulosus mice | |
| CN107281172A (en) | Application of the melbine in the medicine for preparing cervical carcinoma | |
| CN104906598A (en) | Application of ACTL6A gene to preparation of medicine for treating liver cancer or preventing relapse of liver cancer after surgery | |
| CN109100513A (en) | A method of the mescenchymal stem cell of screening Angiogensis | |
| CN109939222B (en) | Medical application of CREG protein for promoting skeletal muscle regeneration | |
| CN107115529A (en) | Application of the albumen of Kindlin 2 as target spot in the medicine for treating diabetes is prepared | |
| CN106729756A (en) | Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment | |
| CN113908283A (en) | PRMT5 inhibitor and application thereof in combination with PD-L1 antibody blocking agent in treatment of lung cancer | |
| CN103540655A (en) | Application of MK5 gene for screening anti-liver cancer drug | |
| CN110938134A (en) | Preparation method and application of recombinant human erythropoietin | |
| CN104258377A (en) | Application of PIK3C2A protein in medicament for treating liver cancer | |
| CN103432593B (en) | Medicine composition for preventing or treating esophageal carcinoma | |
| CN104450781A (en) | Cell line for over-expression of CIAPIN1 protein as well as preparation method and application of cell line | |
| CN102166346B (en) | Lrrc10 micromolecules and application thereof to preparation of medicaments for treating myocardial hypertrophy | |
| CN113462770B (en) | Chemotactic factor as molecular marker for diagnosing rosacea | |
| CN110151777B (en) | Application of hsa-miR-12462 in resisting acute myeloid leukemia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20160407 Address after: 225127 No. 217 West Development Road, Yangzhou, Jiangsu (CAS building) Applicant after: Jiangsu Meidisen Biological Medicine Co.,Ltd. Address before: 100029 Beijing City, Chaoyang District Hui Street No. 2 North Building Room 1110 Applicant before: Beijing Mei Sen biological medicine Science and Technology Ltd. |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |