CN106390125A - Function and application of interferon regulatory factor 2 combined with protein 2 in treating fatty liver and II type diabetes - Google Patents

Abstract

The invention takes Alb-cre mouse and IRF2BP2 liver cell specific gene knockout mouse (IRF2BP2 Delta/ Delta) as experimental subjects; by comparing a fat mouse model induced by high fat diet with Alb-cre mouse, the IRF2BP2 Delta/ Delta mouse is fat, and the fasting blood-glucose level is obviously higher than the Alb-cre mouse; the intraperitoneal injection glucose tolerance experiment finds that the gluconic endurance capacity of IRF2BP2 gene knockout mouse is obviously weakened. The liver weight, ratio of liver and weight, pathological staining result and others indicate that the fatty liver lesion of the IRF2BP2 Delta/ Delta mouse after being induced by high fat diet is more serious, and the fat accumulation is significantly increased. As the drug target for screening and treating fatty liver and/or II type diabetes, the accelerant of the IRF2BP2 can be used for preparing the drug for treating fatty liver and/or II type diabetes.

Description

Interferon regulatory factor 2 associated proteins 2 are in treatment fatty liver and type II diabetes Function and application

Technical field

The invention belongs to the function of gene and application, particularly to a kind of interferon regulatory factor 2 associated proteins 2 （Interferon regulatory factor 2 binding protein 2, IRF2BP2）Pre- in preparation as target gene Prevent, alleviate and/or treat in fatty liver and/or the medicine of type II diabetes and apply.

Background technology

Diabetes are one group and increase, with blood glucose levels, the chronic metabolic disease being characterized, its illness rate is just with people Class growth in the living standard, the raising of living-pattern preservation, aging population and early screening rate and sharply increase, gradually Become the third-largest serious worldwide public health problem threatening human health after malignant tumour and angiocardiopathy.At present The illness rate of more than 20 years old crowd's diabetes of China is 10.3 ~ 12.8%, and the illness rate of prediabetes is more up to 14.7%. The population diabetes investigation carried out for 1980 finds that its illness rate is only 0.67%；Diabetes generaI investigation in 1994 finds in illness rate Rise to 2.28%；Diabetes sample investigation display illness rate to population is 3.62% within 1996；The investigation of 2002 finds China City diabetes prevalence is about 4.5%, and rural area is 1.8%；Population diabetes investigation in 2010 shows that its illness rate is up to 9.65%[1].In a word, current diabetes mellitus in China patient populations are indisputable for the fact that be in the first in the world, and the world defends To 2025, global diabetic will break through 1.3 hundred million main forces to raw microstructure Prediction, and the expense being used for this part disease control will Account for the 40% [2] of medical total expenses, extremely white elephant will be brought for human society.

The World Health Organization（1999）It is classified as IDDM, II type sugar according to the diabetes cause of disease and pathogenesis Urine disease, gestational diabetes mellitus and specific type diabetes, wherein type II diabetes account for the 90% of diabetes sum.Type II diabetes Pathogenesis it is not immediately clear, insulin resistance and insulin β cell dysfunction are considered as the important machine of its morbidity System.Multiple chronic complicating diseases of type II diabetes such as related heart and brain blood of diabetic nephropathy, diabetic retinopathy, diabetes Pipe disease and " diabetes " have obtained fully realizing of people, are also its lethal main cause disabling.Additionally, diabetes With non-alcoholic fatty liver disease（nonalcoholic fatty liver disease, NAFLD）Between contact also obtain Extensive concern, NASH is a kind of and fat and the interactional clinical syndrome of type II diabetes.NAFLD is definite Pathogenesis not yet illustrate so far, wherein insulin resistance and its related metabolic disturbance are in the generation evolution of NAFLD There is important function.Research display, NAFLD is the major contributory factor of type II diabetes M ＆ M, thus research The chronic complicating diseases of the relation between type II diabetes and NAFLD and preventing and treating type II diabetes are particularly important.

IRF2BP2 is a kind of transcription factor belonging to IRF2BP family.IRF2BP family include IRF2BP1, IRF2BP2 and Tri- members of IRF2BPL, wherein IRF2BP2 includes two kinds of alternative splicing hypotypes IRF2BP2A and IRF2BP2B.IRF2BP2 bag N-terminal Zinc finger domain containing an about 64 amino acid composition（Zinc finger domain）With about 82 ammonia The C-terminal ring structure domain of base acid composition（RING finger domain）, the two is the conserved domain of IRF2BP2 albumen, Numerous cell pathology physiological activities play a significant role.IRF2BP2 is screened by yeast two-hybrid system earliest is used as The transcription factor collective effect factor identified [3] of IRF2.Research shows, IRF2BP2 passes through chromatin as the target gene of p53 Co-immunoprecipitation experiment（Chromatin Immunoprecipitation Assay）It is verified, IRF2BP2 can simultaneously As the transcription co-suppression factor of p53, suppress the expression of gene such as p21 and BAX in p53 downstream, thus in cell cycle, cell [4] are played a significant role in the bioprocess such as differentiation and Apoptosis；IRF2BP2 and NFAT1 combines to form transcription factor and is combined Thing, the initial transcription of suppression NFAT1 downstream gene and enhancer activated transcription [5]；When cardiac muscle and skeletal muscle are in ischemic shape During state, IRF2BP2 is as VGLL4（Vestigial-like 4）The co-activation factor, promote VEGFA（Vascular endothelial growth factor A）Express and then play a significant role [6] in revascularization；In rat aorta congee In sample hardening model, IRF2BP2 and MEF2（Myocyte enhancer factor 2）Interaction collectively promotes KLF2 （Kruppel-like factor 2）Expression, and then suppress macrophage to M1 type polarization and promote cholesterol metabolic balance [7]；IRF2BP2 can be combined with another two member IRF2BP1 and IRF2BPL in its family, three be collectively forming transcription because Sub- compound, the apoptosis [8] of suppression breast cancer cell.Research finds recently, IRF2BP2 and ETO2（Eight-twenty-one 2）It is bound to each other to form the transcription co-suppression factor, act on notable [9] during the differentiation and development of red blood cell.In addition, IRF2BP2 gene forms fusion in mesenchymal cell chondrosarcoma and multiple bone with genes such as CDX1 and BCL1/JH respectively Play a role in myeloma [10,11].

Bibliography：

[1] Liao Yong. the present epidemiology of diabetes mellitus in China and prospect [J]. Medical University Of Chongqing's journal, 2015,40（7）.

[2] Farag Y M, Gaballa M R. Diabesity: an overview of a rising epidemic [J]. Nephrol Dial Transplant, 2011,26(1):28-35.

[3] Childs K S, Goodbourn S. Identification of novel co-repressor molecules for Interferon Regulatory Factor-2[J]. Nucleic Acids Res, 2003,31 (12):3016-3026.

[4] Koeppel M, van Heeringen S J, Smeenk L, et al. The novel p53 target gene IRF2BP2 participates in cell survival during the p53 stress response[J]. Nucleic Acids Res, 2009,37(2):322-335.

[5] Carneiro F R, Ramalho-Oliveira R, Mognol G P, et al. Interferon regulatory factor 2 binding protein 2 is a new NFAT1 partner and represses its transcriptional activity[J]. Mol Cell Biol, 2011,31(14):2889-2901.

[6] Teng A C, Kuraitis D, Deeke S A, et al. IRF2BP2 is a skeletal and cardiac muscle-enriched ischemia-inducible activator of VEGFA expression[J]. FASEB J, 2010,24(12):4825-4834.

[7] Chen H H, Keyhanian K, Zhou X, et al. IRF2BP2 Reduces Macrophage Inflammation and Susceptibility to Atherosclerosis[J]. Circ Res, 2015,117(8): 671-683.

[8] Yeung K T, Das S, Zhang J, et al. A novel transcription complex that selectively modulates apoptosis of breast cancer cells through regulation of FASTKD2[J]. Mol Cell Biol, 2011,31(11):2287-2298.

[9] Stadhouders R, Cico A, Stephen T, et al. Control of developmentally primed erythroid genes by combinatorial co-repressor actions[J]. Nat Commun, 2015,6:8893.

[10] Nyquist K B, Panagopoulos I, Thorsen J, et al. Whole-transcriptome sequencing identifies novel IRF2BP2-CDX1 fusion gene brought about by translocation t(1;5)(q42;q32) in mesenchymal chondrosarcoma[J]. PLoS One, 2012,7(11):e49705.

[11] Ni I B, Ching N C, Meng C K, et al. Translocation t(11;14) (q13;q32) and genomic imbalances in multi-ethnic multiple myeloma patients: a Malaysian study[J]. Hematol Rep, 2012,4(3):e19.

Content of the invention

For solving defect and the deficiency of above-mentioned prior art, it is an object of the invention to provide a kind of IRF2BP2 gene Correlation between expression and fatty liver and type II diabetes, provides a target for treating fatty liver and type II diabetes The new application of gene IRF2BP2, and then IRF2BP2 gene is applied to fatty liver and the treatment of type II diabetes.

The purpose of the present invention is achieved through the following technical solutions：

The present invention is with gene knockout instrument mouse（Alb-cre）With IRF2BP2 hepatocyte-specific gene knock-out mice（IRF2BP2^Δ/Δ）For experimental subjects, by high fat diet（High fat diet）The Mice model of obesity of induction（diet induced Obesity, DIO）The function of research IRF2BP2 gene, it is found that compared with Alb-cre mouse, IRF2BP2^Δ/ΔMouse table Reveal obesity, the Alb-cre mouse that its body weight and fasting blood glucose level are raised apparently higher than high lipid food, passes through abdominal cavity further Injectable dextrose monohydrate tolerance test finds that liver cell specificity IRF2BP2 knock out mice substantially subtracts to the tolerance of glucose Weak.Mouse liver weight and liver/weight ratio and pathological staining result etc. all show IRF2BP2 after high fat diet induction^Δ/Δ Mouse adipose liver pathological changes are more serious, and accumulation of lipid dramatically increases.The above result shows liver cell specificity IRF2BP2 gene Knockout can aggravate fatty liver and the generation of type II diabetes, and IRF2BP2 gene can suppress fatty liver and type II diabetes.

The research of the present inventor demonstrates：In the fatty liver and type II diabetes model of high fat diet induction, IRF2BP2 There is suppression fat, reduce liver lipids accumulation, protect liver function；Reduce blood sugar, strengthen glucose tolerance.

For the above-mentioned functions of IRF2BP2, IRF2BP2 is provided in screening protection liver and to maintain sugared generation as drug targets Thank to the application in the medicine of stable state.

For the above-mentioned functions of IRF2BP2, IRF2BP2 is provided and/or to treat in screening prevention, alleviation as drug targets Application in the medicine of fatty liver and/or type II diabetes.

Above medicine is the medicine referring to promote IRF2BP2 gene expression.

The present invention has such advantages as with respect to prior art and effect：

（1）Present invention discover that the New function of IRF2BP2 gene, that is, IRF2BP2 gene has and can protect fatty liver and II type sugar The effect of the sick disease of urine.

（2）Based on effect in protection fatty liver and type II diabetes disease for the IRF2BP2, it is pre- that it can be used for preparation Medicine that is anti-, alleviating and/or treat fatty liver and/or type II diabetes.

Brief description

Fig. 1 is the construction strategy figure of liver cell specificity IRF2BP2 knock out mice.

Fig. 2 is Alb-cre and IRF2BP2^Δ/ΔThe body weight of mouse, fasting blood-glucose result figure；

A is Mouse Weight result figure, and B is fasting blood glucose level statistical chart（*：P ＜ 0.05 vs Alb-cre NC group, * *：P ＜ 0.01 vs Alb-cre NC group, #：P ＜ 0.05 vs Alb-cre HFD group, ##：P ＜ 0.01 vs Alb-cre HFD group）.

Fig. 3 is Alb-cre and IRF2BP2^Δ/ΔMouse passes through lumbar injection glucose tolerance test result figure；

A is different time points mouse blood sugar level statistic figure after lumbar injection glucose, and B is each group glucose tolerance in mice curve Lower area（area under the curve, AUC）Comparison diagram（**：P ＜ 0.01 vs Alb-cre NC group, ##：P ＜ 0.01 vs Alb-cre HFD group）.

Fig. 4 is Alb-cre and IRF2BP2^Δ/ΔMouse liver weight, liver weight/weight ratio figure；

A is liver weight, B is liver weight and weight ratio Data-Statistics block diagram（##：P ＜ 0.01 vs Alb-cre HFD group）.

Fig. 5 is Alb-cre and IRF2BP2^Δ/ΔMouse liver tissue HE and oil red O stain figure.

Specific embodiment

By combination accompanying drawing described further below it will be further appreciated that the features and advantages of the invention.The enforcement being provided Example is only the explanation to the inventive method, and limits remaining content of present invention announcement never in any form.

Animal for research and raising：

Animal used as test kind, sex, week old and source：C57BL/6 mouse, IRF2BP2 liver specific genes knock out （IRF2BP2^Δ/Δ）Mouse and the specific expressed Cre transgenic mice Alb-Cre of liver cell（Purchased from The Jackson Laboratory, article No. 003574）, male, 8 week old.C57BL/6 mouse is purchased from Beijing Fukang bio tech ltd of China, IRF2BP2 liver specific genes knock-out mice is obtained by IRF2BP2-flox mouse Alb-Cre hybridization, and construction strategy is shown in Fig. 1.

The structure of liver specificity IRF2BP2 knock out mice：

According to gene information, using CRISPR Design（Network address：http://crispr.mit.edu/）Respectively in introne 1 With the target practice site respectively designing a CRISPR in the noncoding region of exon 2.Target sequence is respectively:

IRF2BP2 sgRNA1: GGGTTGATAGGCAGCGACACG GGG

IRF2BP2 sgRNA2: GGCTATATTTTTTTTGACGACAAA AGG

In addition have also been devised a donor plasmid for homology reparation（Donor Vector）, it include both sides homology arm, in Between exon 3 and two loxp sequences in the same direction.

（1）The structure of targeting vector：Respectively corresponding for sgRNA1 and sgRNA2 two primers are fused into double-stranded DNA, so It is connected in the pUC57-sgRNA carrier that restriction enzyme ferment treatment is crossed with T4DNA ligase afterwards.This carrier upstream has one T7 promoter, can be used for follow-up In vitro transcription.

（2）Conditionity knock out skeleton carrier pBluescript SK (+) structure of -2loxp：

It is respectively synthesized 4 oligomerization single stranded nucleotide sequence：

loxp1-F：AGCTTGACGTCATAACTTCGTATAGCATACATTATAGCAATTTATACCGGTGAT,

loxp1-R：ATCACCGGTATAAATTGCTATAATGTATGCTATACGAAGTTATGACGTCA；

loxp2-F：GATCCCTTAAGATAACTTCGTATAGCATACATTATAGCAATTTATACGCGTA,

loxp2-R：CTAGTACGCGTATAAATTGCTATAATGTATGCTATACGAAGTTATCTTAAGG；

Form two double-strands of loxp1 and loxp2 after above-mentioned oligonucleotide sequence annealing.By pBluescript II SK (+) carrier Use HindIII（NEB, R0104L）And EcoRV（NEB, R0195L）Connect after double digestion into loxp1 annealing double-strand, then will be sequenced Correct carrier BamHI（NEB, R0136L）And SpeI（NEB, R0133L）Double digestion, connects into loxp2 annealing double-strand, obtains To conditionity knock out skeleton carrier, be named as pBluescript SK (+) -2loxp.

（3）The structure of donor vehicle：According to design of primers principle, design following primer（Table 1）For expanding donor vehicle Left and right homology arm（LA and RA）And the extron part of centre（M）.Expand the product obtaining to connect through in table 13 to limit Property restriction endonuclease processed successively digestion pBluescript SK (+) in -2loxp carrier, obtain Donor Vector.

Table 1 builds primer sequence needed for donor vehicle and corresponding restriction enzyme site

Primer	Primer sequence	Restriction enzyme site
			IRF2BP2 LA-F	CCGCTCGAGCCAACGGGTTCTCCAAACTG	XhoI
IRF2BP2 LA-R	ATGGACGTCGTCGCTGCCTATCAACCC	AatII
			IRF2BP2 M-F	CCGGAATTCACGGGGTTTTCCTTTCC	EcoRI
IRF2BP2 M-R	GGCGATATCGTCGTCAAAAAAAATATAGAAACAC	EcoRV
			IRF2BP2 RA-F	CGACGCGTAAAAGGTATGTACTTTAAGGCATTTTC	MluI
IRF2BP2 RA-R	ATAAGAATGCGGCCGCTGCAGTAAGCACTCGTCACA	NotI

（4）The transcription of targeting vector：Two parts that CRIPR/Cas9 system is comprised（The Cas9 albumen of responsible dissection and Guiding Cas9 albumen navigates to the gRNA of target site）Transcribed respectively.For Cas9 albumen, by its expression vector （pST1374-Cas9 ）WithPmeI carries out digestion, to reclaim linearization plasmid after purification as transcription templates, uses T7 mMESSAGE MMACHINE kit（AM1345, Ambion）Carry out in-vitro transcription, obtain the mRNA product capping.And with Poly (A) Tailing kit（Ambion）To above-mentioned product tailing, obtain ripe mRNA product；For sgRNA, use MEGAshortscript™ Kit（AM1354, Ambion company）Carry out in-vitro transcription.Cas9 and sgRNA that transcription is obtained MRNA use miRNeasy Micro Kit（Qiagen, 217084）Purified.

（5）The making of IRF2BP2-flox conditionity knock-out mice

Above-mentioned ripe mRNA product is together injected in mouse fertilized egg with donor vehicle, is transplanted in replace-conceive dams body and carries out Cultivate.The mouse obtaining is identified.Take out the mouse toe after raw a week or tail tissue, extract genome, and pass through PCR The positive head of method screening builds mouse.From determine select at random the mouse that homologous recombination occurs one be only used as F0 generation carry out follow-up numerous Grow, final acquisition IRF2BP2-flox Mice homozygous.

（6）The making of liver cell specificity IRF2BP2 knock out mice

Above-mentioned IRF2BP2-flox mouse is mated with liver specificity Alb-Cre transgenic mice, screening obtains IRF2BP2^flox/flox/ Alb-Cre mouse, after about this mouse length to 6 week old, lumbar injection Tamoxifen, induce Cre enzyme Expression, two loxp in the same direction of identification of Cre enzyme spcificity, and excise sequence between the two and one of loxp, Finally obtain liver cell specificity IRF2BP2 knock out mice.

Animal used as test feed formula：High lipid food（High fat diet, HFD）（Have purchased from Beijing China Fukang biotechnology Limit company, article No. D12942）：Percent of calories：Protein 20%, carbohydrate 20%, fat 60%；Total thermal mass ratio 5.24kcal/g.Low fat feed（Normal chow, NC）（Purchased from Beijing Fukang bio tech ltd of China, article No. D12450B）：Percent of calories：Protein 20%, carbohydrate 70%, fat 10%；Total thermal mass compares 3.85kcal/g.

Animal feeding and environmental condition：All of experiment mice is all raised and is moved in Wuhan University's animal experimental center SPF level Thing room.Alternately illuminate within every 12 hours, 24 ± 2 DEG C of temperature, humidity 40%-70%, mouse free water is taken food.

【Embodiment 1】Mouse fatty liver and type II diabetes model（Diet induced obesity, DIO）Obtain

（1）Animal used as test is grouped：From 8 week old, male, Alb-cre mouse and IRF2BP2^Δ/ΔMouse, gives two kinds of spies respectively Different feed D12942 high lipid food（High fat diet, HFD）With D12450B low fat feed（Normal chow, NC）Raise Support, i.e. Alb-cre NC group, IRF2BP2^Δ/ΔNC group, Alb-cre HFD group, IRF2BP2^Δ/ΔHFD group totally 4 groups.

（2）Model induces operating process by high lipid food：

Using Alb-cre and IRF2BP2^Δ/ΔMouse, sets up DIO model, carries out phenotype correlation analysis, specifies IRF2BP2 gene The effect that fatty liver and type II diabetes are played.From 8 week old, male, Alb-cre mouse and IRF2BP2^Δ/ΔMouse, point Do not give two kinds of special feed D12942 high lipid foods（High fat diet, HFD）With D12450B low fat feed（Normal Chow, NC）Raise, i.e. Alb-cre NC group, IRF2BP2^Δ/ΔNC group, Alb-cre HFD group, IRF2BP2^Δ/ΔHFD group totally 4 Group.All record weekly mouse food ration in detail, mouse empty body weight and fasting blood-glucose detected 1 time every 2 weeks.Test the 10th In week, carry out lumbar injection glucose experiment（IPGTT）, to evaluate mouse body to glucose tolerance.Whole end takes within 12nd week Material, takes out mouse liver and takes pictures, and then a part is placed in formalin fixing or O.C.T frozen section embedding medium（Tissue Freezing Medium）Embedding is used as pathological analysis.

【Embodiment 2】Mouse Weight, determination of blood glucose level

（1）Mouse empty body weight detects

A. body weight detection

1. fasting：The morning 8:00 will treat experiment mice fasting（Can't help water）, afternoon 2:00 beginning experimental implementation.

2. weigh：Weighed at the 0th week, 2 weeks, 4 weeks, 6 weeks, 8 weeks, 10 weeks, 12 weeks respectively, a plastics keg is placed on dynamic On state electronic balance, pick up mouse, put in weighing keg, measure body weight record data

B. fasting blood glucose level test experience

By the mouse being needed to be tested from the morning 8:00 to afternoon 2:00 fasting（Can't help water）, start real after fasting 6 hours Test operation.

1. blood glucose meter prepares：Check blood glucose meter（Johnson Co., ONETOUCH）Battery, by right-side switch, by test paper It is properly placed left side slot, screen display and the corresponding code of blood sugar test paper bar, subsequently show pattern of bleeding, point out blood glucose meter Device is in state to be measured.

2. fix mouse：The right hand grabs rat-tail, and left hand holds one piece of towel, and towel doubling pinches towel with thumb and forefinger Fold position, mouse head and body is wrapped into the towel in palm, and rat-tail root is being fixed by thumb and forefinger.

3. cut tail：At the 0.1-0.2cm of rat-tail end, rat-tail is being cut rapidly using eye scissors, treating drop of blood voluntarily Flow out.

4. blood sugar test：Blood glucose meter test paper edge is touched drop of blood, blood immerses test paper, blood glucose meter countdown display in 5 seconds Reading.

The evaluation index of type II diabetes injury severity score mainly includes the levels such as body weight, blood sugar, body weight, change of blood sugar Result, as shown in Fig. 2 Alb-cre mouse is after giving the raising of HFD feed, started body weight apparently higher than its NC feed from the 2nd week Group, gives IRF2BP2^Δ/ΔAfter the mouse HFD feed of 12 weeks and the raising of NC feed, started the IRF2BP2 of HFD group from the 2nd week^Δ/Δ Mouse Weight, apparently higher than the Alb-cre Mouse Weight of HFD group, is continued until the 12nd week（See Fig. 2A）；Through fasting blood-glucose inspection Survey and find mouse in HFD group from the 2nd week, 4 weeks, 6 weeks, 8 weeks, 10 weeks, fasting blood glucose level substantially corresponding NC pair of the ratio of 12 weeks Raise according to group, and the IRF2BP2 of HFD group^Δ/ΔMouse fasting blood glucose level is also apparently higher than Alb-cre mouse fasting blood glucose level （See Fig. 2 B）.Sugar generation under HFD raising state for the mouse is significantly affects after showing liver cell specificity IRF2BP2 gene knockout Thank to stable state, IRF2BP2 gene can significantly improve the glycometabolism stable state of mouse, show II type that IRF2BP2 causes in the induction of high fat Play an important role in diabetes.

【Embodiment 3】Glucose tolerance test（Intraperitoneal glucose tolerance test, IPGTT）

Test the 10th week, carry out lumbar injection glucose experiment（IPGTT）, to evaluate mouse body to sugared tolerance.

（1）Before surveying blood sugar, first measure the empty body weight of mouse, calculate the volume injected of glucose according to 10 μ L/g.

（2）First detection is fasting blood glucose level when 0 minute before carrying out glucose injection, rapidly through abdominal cavity after detection finishes Injectable dextrose monohydrate liquid.

（3）Lumbar injection method of operating：1. fix mouse；Pick up mouse, the little finger of toe of left hand and the nameless tail grabbing mouse Bar, another three fingers catch the neck of mouse, make the head of mouse downwards, mouse web portion is fully exposed.2. inserting needle positioning and note Penetrate：From the right hand syringes of belly side inserting needle, hour hands are injected in the most advanced and sophisticated angle at 45 ° with mouse web portion, inserting needle, pumpback Head walks little segment distance in subcutaneous abdomen, enters abdominal cavity in belly opposite side, after injection medicine, slowly pull out through after midline abdominal Go out syringe needle, and slight rotating needle, prevent leakage.

（4）After lumbar injection, 15,30,60,120 minutes points cut off afterbody and survey mouse blood sugar value, and record Blood sugar numerical value and detection time.

Pass through lumbar injection glucose tolerance test further（intraperitoneal glucose tolerance Tests, IPGTT）To assess the disposal ability to glucose for each group mouse, in experiment the 10th week, by injecting 1.0g/kg body weight Glucose after, the Alb-cre mouse of HFD group and IRF2BP2^Δ/ΔMouse blood sugar level increases severely in 15 minutes points and reaches peak Value, elapses, two groups of mouse blood sugar levels somewhat decline over time, but still in higher than fasting blood glucose level（Blood when 0 minute Sugar）, Alb-cre mouse 2 little constantly recover to fasting blood glucose level, and IRF2BP2^Δ/ΔMouse blood sugar level is from 0 minute to 2 Hour is constantly in the blood sugar level higher than Alb-cre mouse（Fig. 3 A）.Relatively each group mouse blood sugar TG-AUC（area Under the curve, AUC）, find that the AUC of Alb-cre mouse HFD group is significantly higher than NC group, IRF2BP2^Δ/ΔHFD group AUC is noticeably greater than the AUC of Alb-cre HFD group（Fig. 3 B）, show that IRF2BP2 has powerful regulation and control to maintenance glycometabolism stable state Ability.

【Embodiment 4】Liver general appearance and liver organization lipid components measure

（1）End liver organization is drawn materials eventually

A., after mouse weights, put to death using cervical dislocation rapidly.Dorsal position fixes mouse, with distilled water by mouse chest Portion, belly hair wet.

B. tweezer folder mouse web portion center skin, hit exactly along belly and cut off skin to xiphoid-process to head, caudad Cut off skin, successively expose subcutaneous fascia, muscle etc., open abdominal cavity, fully expose each internal organs.

C. quickly find and take off the liver of mouse, the liver specimens taken off are placed on sterile gauze, wipe dry liver table Remained blood on face, liver is placed in sterile culture vessel, takes pictures rapidly, weigh.

D. paraffin specimen：Cut partial liver and be placed in fixation in 10% neutral formalin.Frost sample：Cut part liver Dirty, it is placed in embedding in the tinfoil mould of OCT, be placed on cryofixation on dry ice.

（2）Liver organization is processed and pathological staining related experiment

A. liver dehydration, transparent, waxdip

Cut the embedding inframe that the part lobe of the liver fixing in 10% neutral formalin is organized in mark, under low discharge flowing water Rinse more than 30 minutes.According to below scheme, program is set on machine, is 1. dehydrated：75% alcohol（45 minutes）→ 75% alcohol （45 minutes）→ 85% alcohol（45 minutes）→ 85% alcohol（45 minutes）→ 95% alcohol（45 minutes）→ 95% alcohol（45 minutes） → absolute alcohol（1 hour）→ absolute alcohol（1 hour）；2. transparent：Dimethylbenzene（1 hour）→ dimethylbenzene（1 hour）；3. soak cured （65℃）：Paraffin（1 hour）→ paraffin（1 hour）.After tissue flushing finishes, the embedding frame comprising tissue is put into machine basket In basket, start said procedure.After the completion of said procedure, take out the embedding frame holding tissue, send pathology room investing tissue, clearly simultaneously Washing machine device is standby.

B. liver tissue slices

Using microtome（5 μm of slice thickness）.

C. liver organization Hematoxylin-eosin（HE）Dyeing

Liver organization paraffin section is put into 65 DEG C of baking ovens（30 minutes）In → dimethylbenzene（5 minutes × 3 times）→ 100% alcohol（1 Minute）→ 90% alcohol（1 minute）→ 70% alcohol（1 minute）→ distillation washing → haematoxylin（5 minutes）→ running water washes away to be cut Loose colour → 1% hydrochloride alcohol on piece（1 to 3 second）→ wash from the beginning several under → Scott liquid（Sodium acid carbonate 0.35g, magnesium sulfate 2g, Distilled water 100mL）（1 minute）→ wash from the beginning several under → Yihong（1 minute）→ distilled water washes away loose colour → 70% wine in section Under single-minded → 90% alcohol once → 100% alcohol（30 seconds × 3 times）→ dimethylbenzene（2 minutes × 3 times）→ when dimethylbenzene is not dry Mounting, takes pictures.

D. liver organization oil red O stain

1. frozen liver tissues section is air-dried 30 minutes in fume hood, 4% paraformaldehyde fixes 10 minutes.It is placed in distilled water In wash 10 minutes, to remove the paraformaldehyde that tissue shows.

2. processed 1 minute with 60% isopropanol.

3. use oil red O（Company sigma, article No. O0625,0.5 gram/100mL of concentration 100% isopropanol）Dyeing 30 minutes.

Afterwards with 60% isopropyl alcohol 1 minute × 3 times, until clean background.

With Mayer ' s haematoxylin dye liquor（5）Light dye nucleus.

Water rinses, and promotees blue, fully wash, be washed to nucleus oil blackeite in dilute lithium carbonate aqueous solution.

Use glycerin gelatine mounting, take pictures.

Liver general appearance result as shown in Figure 4, the IRF2BP2 of HFD group^Δ/ΔMouse no matter liver weight or liver Weight and mouse body weight ratio itself are all high compared with the Alb-cre mouse of HFD group（As Fig. 4）.Pass through histotomy further, carry out HE and oil red O stain, basis of microscopic observation each group mouse liver is organized under high fat diet rearing conditions and there occurs significant disease Reason changes.Dyeed it can be observed that under HFD rearing conditions by liver HE, Alb-cre mouse and IRF2BP2^Δ/ΔMouse Liver Dirty tissue all has fat deposition, and steatosis, vacuolation the liver cell of Alb-cre group mouse occur and fusion is linked to be sheet, liver Dirty cellular morphology is almost destroyed completely, and IRF2BP2^Δ/ΔThe liver cell metamorphosis of group mouse is even more serious（On Fig. 5）.Logical Cross liver oil red O stain to detect lipid in hepatic tissue, it can be found that around the vena portae hepatica of the Alb-cre mouse of HFD group In large stretch of red, point out there is substantial amounts of lipidosis, and the IRF2BP2 in HFD group^Δ/ΔLipid around the vena portae hepatica of mouse Deposition is more notable（Under Fig. 5）.These results illustrate that the fatty liver of liver cell specificity IRF2BP2 knock out mice is substantially disliked Change.

The above results show IRF2BP2^Δ/ΔThe fatty live lesions that mouse occurs under the induction of HFD and type II diabetes show Work increases.These results show that IRF2BP2 gene pairs improves type II diabetes and fatty liver has obvious action.The present invention ties Fruit explanation IRF2BP2 gene has important protective effect in fatty liver and type II diabetes disease model.

Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not subject to above-described embodiment Limit, other any Spirit Essences without departing from the present invention and the change made under principle, modification, replacement, combine, simplify, All should be equivalent substitute mode, be included within protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhan University

<120>Function and application in treatment fatty liver and type II diabetes for interferon regulatory factor 2 associated proteins 2

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 24

<212> DNA

<213> IRF2BP2 sgRNA1

<400> 1

gggttgatag gcagcgacac gggg 24

<210> 2

<211> 27

<212> DNA

<213> IRF2BP2 sgRNA2

<400> 2

ggctatattt tttttgacga caaaagg 27

<210> 3

<211> 29

<212> DNA

<213> IRF2BP2 LA-F

<400> 3

ccgctcgagc caacgggttc tccaaactg 29

<210> 4

<211> 27

<212> DNA

<213> IRF2BP2 LA-R

<400> 4

atggacgtcg tcgctgccta tcaaccc 27

<210> 5

<211> 26

<212> DNA

<213> IRF2BP2 M-F

<400> 5

ccggaattca cggggttttc ctttcc 26

<210> 6

<211> 34

<212> DNA

<213> IRF2BP2 M-R

<400> 6

ggcgatatcg tcgtcaaaaa aaatatagaa acac 34

<210> 7

<211> 35

<212> DNA

<213> IRF2BP2 RA-F

<400> 7

cgacgcgtaa aaggtatgta ctttaaggca ttttc 35

<210> 8

<211> 36

<212> DNA

<213> IRF2BP2 RA-R

<400> 8

ataagaatgc ggccgctgca gtaagcactc gtcaca 36

Claims (6)

1. The application in the medicine of screening protection liver and maintenance glycometabolism stable state as drug targets of 1.IRF2BP2 gene.
2. 2. according to claim 1 application it is characterised in that：Described medicine is the medicine promoting IRF2BP2 gene expression Thing；Described application is non-diagnostic and non-treatment.
3. Application in the medicine of preparation protection liver and maintenance glycometabolism stable state for the 3.IRF2BP2.
4. 4.IRF2BP2 gene is as drug targets in screening prevention, alleviation and/or the medicine treating fatty liver, type II diabetes In application.
5. 5. according to claim 4 application it is characterised in that：Described medicine is the medicine promoting IRF2BP2 gene expression Thing；Described application is non-diagnostic and non-treatment.
6. Application in preparation prevention, alleviation and/or treatment fatty liver, the medicine of type II diabetes for the 6.IRF2BP2.