CN106119262B - Improve the gene OsPTR10 and purposes of rice nitrogen use efficiency and yield - Google Patents
Improve the gene OsPTR10 and purposes of rice nitrogen use efficiency and yield Download PDFInfo
- Publication number
- CN106119262B CN106119262B CN201610605360.3A CN201610605360A CN106119262B CN 106119262 B CN106119262 B CN 106119262B CN 201610605360 A CN201610605360 A CN 201610605360A CN 106119262 B CN106119262 B CN 106119262B
- Authority
- CN
- China
- Prior art keywords
- gene
- osptr10
- plant
- rice
- nitrogen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to plant genetic engineering fields, provide rice nitrogen transporter geneOsPTR10, protein sequence is as shown in SEQ ID No.1, and cDNA sequence is as shown in SEQ ID No.2.The present invention passes through overexpressionOsPTR10Gene improves the efficiency of normal rice absorbing nitrogenous fertilizer, and plant soluble protein increases, and then tiller number increases, spike length and grouting grain number increase, to improve yield.And it is reduced by RNAi technologyOsPTR10The expression quantity of gene, Yi JiOsPTR10The function of the gene is confirmed in target gene mutant.The gene has important application value using nitrogenous fertilizer and in terms of improving yield in terms of illustrating Nitrogen effect plant growth and growth course and in rice high efficient.
Description
Technical field
The invention belongs to plant genetic engineering fields, and in particular to a kind of gene for improving rice nitrogen use efficiency and yield
OsPTR10 and purposes.
Background technique
Rice in China cultivated area accounts for the 20% of the total cultivated area of world crop, but amount of application of nitrogen fertilizer accounts for the world and always applies
The 37% of dosage；Nineteen ninety-five China's nitrogen fertilizer production amount and usage amount have reached No. 1 in the world, but nitrogenous fertilizer service efficiency is lower, nitrogenous fertilizer
Amount of application compared with 50 years before increase by 20 times, by this trend, it is contemplated that the year two thousand fifty, it will turn over 3 times again.The excessive meeting of nitrogen application
Cause the ecological pollutions such as water eutrophication problem [Xu Guohua, Fan Xiaorong rice nitre transporter gene OsNRT1.1a and
The functional study Agricultural University Of Nanjing of OsNRT1.1b, 2011:4-6].More nitrogen nutrition pass through denitrification, water and soil
It is lost, volatilizees naturally, microorganism such as utilizes to be wasted at the approach.
If the absorption efficiency of nitrogen is improved 1%, it is equivalent to save more than ten hundred million dollars of spending every year.From China
National conditions analysis, the potentiality that expansion cultivated area is increased the total yield are very limited, and the only way out is raw on limited soil
The more paddy of output, that is, increase the yield per unit area.It is higher by selection nitrogen use efficiency in traditions of the past farming
Crop, the utilization efficiency of Lai Tigao nitrogen；But compared with the breeding on molecular level, this process seems slow and inefficient [Zhang Hong
Journey, the genotypic difference and physiological Mechanism research Yangzhou University that Dai Qigen Nitrogen in Rice utilizes, 2008:10-13].It improves
Nitrogen use efficiency, it is necessary to find breach from the molecule absorption mechanism of nitrogen.Nitrate anion transporter gene family is divided into low-affinity nitre
[Zhou Shiyi carbohydrate and amino acid are to the high parent of rice induction type for acid group transporter gene and two class of high-affinity nitrate anion transporter gene
With the influence Central China University of Science and Technology of power nitrate transport system, 2009:15-16].By nitrogen assimilation, by nitrate nitrogen and ammonium
State nitrogen absorbs and is converted into amino acid, and the referred to as first kind of nitrogen absorbs.Increase seed nutritional substance by the transport to nitrogen, increases
Add plumpness, referred to as the second class of nitrogen absorbs, that is, recycling [Kant S, Bi Y, the Steven J, et of nitrogen
al.Understanding plant response to nitrogen limitation for the improvement of
crop nitrogen use efficiency.Journal of Experimental,2011,62(4):1499-1509].Increase
Add nitrogen absorption and accumulation amount or N transformation amount, can increase production.Therefore, in agricultural modernization construction, pass through molecular breeding means
To improve rice to the utilization efficiency of nitrogenous fertilizer, it is possible to reduce nitrogenous fertilizer pollution, moreover it is possible to increase yield.
NRT1/PTR family (NRT1/PTR family, NPF) is the small molecule for referring to mediate 2-3 amino acid residue
Albumen [Rentsch D, Schmidt S, the Tegeder M.Transporters of the substances such as peptide and nitrate anion progress transdermal delivery
for uptake and allocation of organic nitrogen compounds in plants.FEBS Let,
2007,581:2281-2289].NRT1/PTR family member takes part in during Seed Development in the accumulation and sprouting of protein
Micromolecule polypeptide form transports [Martre P, Porter J R, Jamieson P D, et al.Modeling after protein degradation
grain nitrogen accumulation and protein composition to understand the sink/
source regulations of nitrogen remobilization for wheat.Plant Physiol,2003,
133:1959-1967].Seldom to the report of NPF family member research at present, OsPTR10 gene disclosed by the invention is rice
One homologous gene of NPF gene family.The research of OsPTR10 gene is ground in promotion plant N uptake and utilization relevant molecule mechanism
Studying carefully has extremely important effect, can be applied to plant molecular improvement to make increasing production of rice.
Summary of the invention
In order to solve the problems in the existing technology, the present invention is with the NPF gene family newcomer OsPTR10 of rice
Object after overexpression, makes normal rice absorbing nitrogen from the full length sequence for having cloned OsPTR10 in 11 is spent in rice
The efficiency of fertilizer improves, and plant accumulates soluble protein, and improves tiller number, spike length and grouting grain number and increase, so that yield is improved,
In addition the function of the gene is also confirmed by RNAi technology and OsPTR10 gene mutation body.
Main contents of the invention are as follows:
1, a kind of gene OsPTR10, cDNA coding for controlling rice nitrogen use efficiency, tillering ability and yield is provided
Protein amino acid sequence as shown in SEQ ID NO.1.
2, the present invention provides the cDNA sequence SEQ ID NO.2 of gene OsPTR10.
It is construed as, (i.e. not in the activated centre of albumen) under the premise of not influencing OsPTR10 protein active, ability
It is one or several that field technique personnel can carry out various substitutions, additions and/or deletions to amino acid sequence shown in SEQ ID NO.1
Amino acid obtains the amino acid sequence with same function.
Therefore, the protein of rice Os PTR10 gene of the invention coding further includes amino acid sequence shown in SEQ ID NO.1
Column are substituted, replace and/or increase one or several amino acid, have the egg of same active rice Os PTR10 gene coding
White matter.Furthermore, it is to be understood that in view of the degeneracy of codon and the preferences of different plant species codon, those skilled in the art
Member can according to need using the codon for being suitble to particular species expression.
3, the invention also includes Sense sequences or antisense sequences based on the polynucleotides, including contain the multicore glycosides
The cloning vector or expression vector of acid sequence or its segment, contain the nucleotide sequence at the host cell containing the carrier
Or plant cell and the genetically modified plants of the conversion of its segment.
4, the application the present invention also provides OsPTR10 gene in rice breeding, the rice breeding are to improve rice
Nitrogen use efficiency, tiller number, spike length and grouting grain number, to improve yield.
5, the application the present invention also provides a kind of OsPTR10 gene in other genetically modified plants.Pass through overexpression base
The nitrogen use efficiency and yield of plant are improved because of OsPTR10.The plant refers to monocotyledon or dicotyledon；
Such as: wheat, corn, cucumber, tomato, poplar, turfgrass or clover.
6, the present invention also provides the molecular detecting method of rice Os PTR10 gene transgenic plant, pass through the primer
To amplification transgenic paddy rice genomic DNA to be checked, and detect amplified production: if using the upstream primer F of primers F P10:
GATGTTGGCGACCTCGTATT and downstream primer R:TCGTTATGTTTATCGGCACTTT, amplifies the amplified fragments of 517bp,
Then explanation is transgenic positive plant, and explanation is transgene negative plant if not expanding this segment.
Realize that technology of the invention is as follows:
1, overexpression OsPTR10 gene:
Overexpression vector OsPTR10-p1301 is constructed, the genetic transforming method mediated using Agrobacterium EHA105, by super table
Up to spending in 11 in the normal rice varieties of vector introduction, the tissue-cultured seedling of overexpression is finally obtained, is planted in crop field, with primer pair FP10's
Upstream primer F:GATGTTGGCGACCTCGTATT and downstream primer R:TCGTTATGTTTATCGGCACTTT, amplifies 517bp
Amplified fragments, then explanation be transgenic positive plant, positive plant single plant sowing is simultaneously planted, until T2 generation identify homozygous plant
Strain, the spike length for overexpressing plant, grain number are than spending 11 raisings, such as Fig. 3 in control wild type.
2, the function of OsPTR10 gene is verified
Interference expression vector OsPTR10-pTCK303, the something lost mediated using Agrobacterium EHA105 are constructed by RNAi technology
Method for transformation is passed, interference expression vector is imported in normal japonica rice variety and is spent in 11, finally obtains the strain of gene expression amount decline
System shows as until T2 generation continues to observe phenotype than spending the reduction of 11 spike lengths in control wild type, and grain number tails off, mass of 1000 kernel decline
The phenomenon that, such as Fig. 4.
The mutant of OsPTR10 is commercially available from Hua Zhong Agriculture University's mutant library (http://rmd.ncpgr.cn/)
The seed of homozygous plants, is transplanted in the frame with soil, is periodically watered, fertilising, when seedling grows tall about 10cm, Zhong Yu great
Mutant plants can be obtained after seedling is grown up in Tanaka, and same to occur than spending the reduction of 11 spike lengths in control wild type, grain number tails off,
The phenomenon that mass of 1000 kernel declines, to confirm the function of the gene, such as Fig. 4.
By adding nitrogen water culture experiment, compares biomass of the OsPTR10 difference transgenic plant under ammonium nitrate, find
After water planting culture 20 days, overexpression biomass than control wild type in spend 11 to obviously increase the phenomenon that, and interfere and
Mutant plants are significantly reduced than control biomass, such as Figure 10.
Advantages of the present invention and effect:
1, enhance Tillering Ability in Rice after the OsPTR10 gene overexpression that the present invention clones, spike length, grain number increase again,
Illustrate that OsPTR10 gene pairs raising rice yield is more apparent, therefore, passes through the table that technique for gene engineering improves OsPTR10 gene
Up to can be improved plant products.It is not only does this facilitate and cultivates high-yield rice under the conditions of nitrogen by normally applying, molecule can also be passed through
The breed improvement of breeding progress plant.
2, the successful clone of OsPTR10 gene further demonstrates important function of the NPF family in nitrogen absorption process,
There is important meaning to the biological function for illustrating NPF family, in addition to plant nitrogen metabolism approach is further appreciated that, improves nitrogen and inhale
The rate of producing effects has great impetus.
Although 3, being cloned into some genes for improving plant products at present, still not to the molecular mechanism of plant yield-increasing
It is clear.And the OsPTR10 gene that the present invention clones can be improved the yield of rice, have pole to the key factor for determining plant yield-increasing
Big impetus.
Detailed description of the invention
The overexpression vector structure figures of Fig. 1 OsPTR10 gene.
The RNAi carrier structure figures of Fig. 2 OsPTR10 gene.
Fig. 3 control, OsPTR10 gene overexpression 3 strains of plant whole strain phenotype.
Fig. 4 control, OsPTR10 gene 3 strains of interference plant and the whole strain phenotype of mutant.
Fig. 5 control, overexpression 3 strains of plant of OsPTR10 gene, 3 strains of interference plant of OsPTR10 gene and
Mutant tiller number.
Fig. 6 control, overexpression plant 3 strain mixing, 3 strains of interference plant of OsPTR10 gene of OsPTR10 gene
Soluble protein content in system's mixing and mutant blade.
Fig. 7 control, overexpression 3 strains of plant of OsPTR10 gene, 3 strains of interference plant of OsPTR10 gene and
Mutant fringe phenotype.
Fig. 8 control, overexpression 3 strains of plant of OsPTR10 gene, 3 strains of interference plant of OsPTR10 gene and
Mutant spike length.
Fig. 9 control, overexpression 3 strains of plant of OsPTR10 gene, 3 strains of interference plant of OsPTR10 gene and
The every fringe grouting grain number of mutant.
Figure 10 control, 3 strains of overexpression plant mixing of OsPTR10 gene, interference plant 3 of OsPTR10 gene
Strain mixing and biomass of mutant plants under the conditions of water planting.
Specific embodiment
By following detailed description combination attached drawing it will be further appreciated that the features and advantages of the invention.Provided implementation
Example is only the explanation to the method for the present invention, remaining content without limiting the invention in any way announcement.
Unless otherwise specified, the conventional means that technological means used is well known to those skilled in the art；Reality used
Proved recipe method is conventional method, and can (referring to molecular cloning, laboratory manual, second edition is cold according to the recombinant technique described
Publishing house, spring Cold Spring Harbor Laboratory, Cold SpringHarbor, New York) it completes；Material, reagent used etc., are commercially available.
The building of [embodiment 1] overexpression OsPTR10 gene plant
11 RNA is spent in extraction rice, and its reverse transcription is utilized at cDNA
Primers F: ATGCCATATAAGTATGTACTA (Seq ID No:3)
Primer R:TCAGTGCGAGTGCGGGACGGC (Seq ID No:4)
After cDNA by PCR amplification OsPTR10 gene, it is connected into pCAM1301 carrier, pCAM1301 carrier structure is certainly
Cambia company constructs the overexpression vector OsPTR10-p1301 of OsPTR10 gene, as shown in Figure 1.Using Agrobacterium
The genetic transforming method that EHA105 is mediated, overexpression vector is imported in normal rice varieties and is spent in 11.
All transgenic plants are transplanted in the frame with soil after obtaining, and are periodically watered, and fertilising is grown tall about to seedling
When 10cm, Zhong Yu great Tanaka detects overexpression plant, the FP10 primer pair designed for detection is after seedling is grown up
F:GATGTTGGCGACCTCGTATT (Seq ID No:5)；
R:TCGTTA TGTTTATCGGCACTTT (Seq ID No:6)；
Positive plant single plant sowing is simultaneously planted, until in T2 generation, identifies homozygous plants, it is available that rice nitrogen can be made to utilize
The overexpression plant of the OsPTR10 gene of efficiency and output increased, as shown in Figure 3.
[embodiment 2] OsPTR10 gene interferes the building of plant and the acquisition of OsPTR10 gene mutation strain
11 cDNA will be spent to utilize primer pair in rice:
F1:5'ACTAGTCATCCCATCACTACAACC 3'(Seq ID No:7)
R1:5'GAGCTCGTATCCAAACGACGACAG 3'(Seq ID No:8)
F2:5'GGTACCCATCCCATCACTACAACC 3'(Seq ID No:9)
R2:5'GGATCCGTATCCAAACGACGACAG 3'(Seq ID No:10)
After respective PCR amplification goes out the cDNA segment of OsPTR10 gene, it is connected into pTCK303 carrier, pTCK303 carrier is in
Institute, section Institute of Zoology kind health laboratory give, and constructs the interference carrier OsPTR10-pTCK303 of OsPTR10 gene.Using
The genetic transforming method that Agrobacterium EHA105 is mediated, interference expression vector is imported in normal japonica rice variety and is spent in 11, such as Fig. 2 institute
Show.
The genetic transforming method mediated using Agrobacterium EHA105, overexpression vector is imported in normal rice varieties and spends 11
In.
All transgenic plants are transplanted in the frame with soil after obtaining, and are periodically watered, and fertilising is grown tall about to seedling
When 10cm, Zhong Yu great Tanaka detects overexpression plant, the FP10 primer pair designed for detection is after seedling is grown up
F:GATGTTGGCGACCTCGTATT (Seq No:5)；
R:TCGTTA TGTTTATCGGCACTTT (Seq No:6)；
Positive plant single plant sowing is simultaneously planted, until T2 generation identifies homozygous plants, is obtained under nitrogen use efficiency and yield
The interference plant of drop, as shown in Figure 4.
The mutant of OsPTR10 is commercially available in Hua Zhong Agriculture University's mutant library (http://rmd.ncpgr.cn/)
The seed of homozygous plants, is transplanted in the frame with soil, is periodically watered, fertilising, when seedling grows tall about 10cm, Zhong Yu great
After seedling is grown up mutant plants can be obtained, as shown in Figure 4 in Tanaka.
The identification of [embodiment 3] transgenic plant and mutant plants nitrogen use efficiency and yield index
Above-mentioned transgenic plant tiller number is counted, it can be found that 3 strains of the overexpression plant of OsPTR10 gene
Become more than control tiller number, and 3 strains of plant and mutant plants is interfered to tail off than control tiller, as shown in Figure 5.Data are adopted
Variable analysis (ANOVA) is carried out with SPSS software, Duncan ' s is used to carry out significance difference analysis in 0.05 level.It is different
Group lowercase (such as a, b, c) indicates significant difference.
It draws materials to above-mentioned plant leaf, measures the soluble protein content in blade, it can be found that overexpression 3 strains of plant
It is the blade and mutant that mixed leaf soluble protein content content significantly improves than control, and 3 strains of plant is interfered to mix
Plant leaf soluble protein content is reduced than control.Illustrate that the change of OsPTR10 gene expression can be with adjusting and controlling rice plant
Nitrogen content, to change the nitrogen use efficiency of plant, as shown in Figure 6.Data carry out variable analysis using SPSS software
(ANOVA), significance difference analysis is carried out in 0.05 level using Duncan ' s.Different group lowercases (such as a, b, c)
Indicate significant difference.
Reproduction period, it can be found that the fringe of overexpression 3 strains of plant is elongated, grouting grain number mentioned by after all plant sowings
Height, and the fringe of 3 strains of plant is interfered to shorten, grouting grain number is reduced, as shown in Figure 7.By being counted to spike length length, table
Bright OsPTR10 gene expression amount changes the length that can change Rice Panicle really, as shown in Figure 8.Every fringe grouting grain number is carried out
Statistics shows that OsPTR10 gene expression amount changes the grouting grain number that can change rice every fringe really, thus direct regulation and control
Rice yield, as shown in Figure 9.Data carry out variable analysis (ANOVA) using SPSS software, use Duncan ' s in 0.05 level
Upper carry out significance difference analysis.Different group lowercases (such as a, b, c) indicate significant difference.
The different all kinds of plant of [embodiment 4] OsPTR10 gene expression amount biomass under the conditions of different nitrogen compares
By adding nitrogen water culture experiment, the ammonium nitrate of 2mM is added in rice nutrition liquid, is compared OsPTR10 difference and is turned
Biomass of the gene plant under ammonium nitrate, after discovery water planting culture 20 days, overexpression biomass is dramatically increased than control,
And interfere and substantially reduced with mutant plants, such as Figure 10.Data carry out variable analysis (ANOVA) using SPSS software, use
Duncan ' s carries out significance difference analysis in 0.05 level.Different group lowercases (such as a, b, c) indicate significant difference.
The above results show that OsPTR10 gene can influence nitrogen use efficiency, further shadow by the change of expression quantity
Rice tillering, spike length and grouting grain number are rung, rice yield is finally influenced.
Claims (1)
1. riceOsPTR10Application of the gene in rice breeding, it is describedOsPTR10The amino acid sequence of DNA encoding the protein
As shown in SEQ ID NO.1, which is characterized in that the rice breeding is to improve rice nitrogen use efficiency, tiller number, spike length and filling
Grain number is starched, to improve yield.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610605360.3A CN106119262B (en) | 2016-07-28 | 2016-07-28 | Improve the gene OsPTR10 and purposes of rice nitrogen use efficiency and yield |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610605360.3A CN106119262B (en) | 2016-07-28 | 2016-07-28 | Improve the gene OsPTR10 and purposes of rice nitrogen use efficiency and yield |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106119262A CN106119262A (en) | 2016-11-16 |
| CN106119262B true CN106119262B (en) | 2019-04-30 |
Family
ID=57254109
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610605360.3A Active CN106119262B (en) | 2016-07-28 | 2016-07-28 | Improve the gene OsPTR10 and purposes of rice nitrogen use efficiency and yield |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106119262B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108220292B (en) * | 2016-12-14 | 2021-07-06 | 浙江省农业科学院 | Rice micromolecule RNAosa-miR171b gene and application thereof in increasing rice yield |
| CN106868022B (en) * | 2017-04-13 | 2020-05-29 | 武汉生物工程学院 | Nitrogen transport gene OsNPF2.4b for promoting increase of effective spike number of rice and application thereof |
| CN106967745B (en) * | 2017-05-11 | 2020-02-21 | 武汉生物工程学院 | Application of nitrogen nutrition transport gene OsNPF7.1 in improving tillering and spike number of rice |
| CN107099549B (en) * | 2017-05-16 | 2020-02-21 | 武汉生物工程学院 | Application of OsNPF5.16 gene in increasing yield of rice single plant |
| CN107056909B (en) * | 2017-05-23 | 2020-03-24 | 武汉生物工程学院 | Application of OsNPF5.11 gene in increasing rice yield |
| CN108034672B (en) * | 2017-12-19 | 2020-05-29 | 武汉生物工程学院 | Application of nitrate transport gene OsNRT1.9b in rice breeding |
| CN108118062B (en) * | 2017-12-19 | 2020-05-29 | 武汉生物工程学院 | Application of nitrate transport gene OsNRT1.9a in rice breeding |
| CN108070601B (en) * | 2017-12-19 | 2020-07-07 | 武汉生物工程学院 | Application of OsNPF8.6b gene in increasing rice yield |
| CN108034661B (en) * | 2017-12-19 | 2020-05-29 | 武汉生物工程学院 | Application of OsNPF8.8b gene in improving rice yield and nutrition quality |
-
2016
- 2016-07-28 CN CN201610605360.3A patent/CN106119262B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| GenBank: ABB48040.1;Buell,C.R.等;《Genbank》;20160714;1页 |
| Two Splicing Variants of OsNPF7.7 Regulate Shoot Branching and Nitrogen Utilization Efficiency in Rice;Weiting Huang等;《Frontiers in Plant Science》;20180308;第9卷;Article 300 |
| 水稻寡肽转运基因OsPTRl-10酵母异源表达载体的构建及转化;蔡昭艳 等;《安徽农业科学》;20091120;第37卷(第32期);15730-15733页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106119262A (en) | 2016-11-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106119262B (en) | Improve the gene OsPTR10 and purposes of rice nitrogen use efficiency and yield | |
| CN106337055B (en) | Application of the nitrate anion transporter gene OsNRT1.8 in rice breeding | |
| CN106222180B (en) | Improve the gene OsNPF7.3 and purposes of rice yield and grain of rice protein content | |
| Anbessa et al. | Strategies to increase nitrogen use efficiency of spring barley | |
| Han et al. | Decreasing nitrogen assimilation under drought stress by suppressing DST-mediated activation of Nitrate Reductase 1.2 in rice | |
| CN108034672A (en) | Applications of the nitrate anion transporter gene OsNRT1.9b in rice selection and breeding | |
| Zhao et al. | DEP1 is involved in regulating the carbon–nitrogen metabolic balance to affect grain yield and quality in rice (Oriza sativa L.) | |
| CN110819635B (en) | Application of HAN homologous gene of leguminous plant in regulating and controlling number of root nodules of leguminous plant | |
| Effah et al. | Transcriptome profiling reveals major structural genes, transcription factors and biosynthetic pathways involved in leaf senescence and nitrogen remobilization in rainfed spring wheat under different nitrogen fertilization rates | |
| Liu et al. | In-season expression of nitrate and ammonium transporter genes in roots of winter wheat (Triticum aestivum L.) genotypes with different nitrogen-uptake efficiencies | |
| CN117051022A (en) | Wheat TaLAC129 gene and encoding protein and application thereof | |
| CN109825501B (en) | Long-chain non-coding RNA T5120 from arabidopsis thaliana and application thereof | |
| CN103012574A (en) | Low-phosphor stress response regulatory factor ZmPHR1, gene for coding the protein and application | |
| CN106868022B (en) | Nitrogen transport gene OsNPF2.4b for promoting increase of effective spike number of rice and application thereof | |
| US11525142B2 (en) | Zea mays NLP transcription factor ZmNLP5 and use thereof | |
| Zhang et al. | Overexpression of MYB-like transcription factor SiMYB30 from foxtail millet (Setaria italica L.) confers tolerance to low nitrogen stress in transgenic rice | |
| WO2015180479A1 (en) | Use of tanac2 protein and encoding gene thereof | |
| CN108070601A (en) | Application of the OsNPF8.6b genes in rice yield is improved | |
| CN108707594B (en) | 1 gene family of -1 related protein kinase of maize sucrose non-fermented and its application | |
| REN et al. | Overexpression of IbSnRK1 enhances nitrogen uptake and carbon assimilation in transgenic sweetpotato | |
| CN111269924B (en) | Rice cysteine synthase coding gene OsASTOL1 mutant and application thereof | |
| CN108118062A (en) | Applications of the nitrate anion transporter gene OsNRT1.9a in rice selection and breeding | |
| Wang et al. | Light induced shoot-sourced transcription factor HY5 regulates the nitrate uptake of cotton by shoot-to-root signal transport | |
| CN106967745B (en) | Application of nitrogen nutrition transport gene OsNPF7.1 in improving tillering and spike number of rice | |
| CN107012153B (en) | Application of nitrogen nutrition transport gene OsNPF8.1 in improving tillering number of rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |