CN111269924B - Rice cysteine synthase coding gene OsASTOL1 mutant and application thereof - Google Patents

Rice cysteine synthase coding gene OsASTOL1 mutant and application thereof Download PDF

Info

Publication number
CN111269924B
CN111269924B CN202010192032.1A CN202010192032A CN111269924B CN 111269924 B CN111269924 B CN 111269924B CN 202010192032 A CN202010192032 A CN 202010192032A CN 111269924 B CN111269924 B CN 111269924B
Authority
CN
China
Prior art keywords
rice
mutant
osastol1
cysteine synthase
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010192032.1A
Other languages
Chinese (zh)
Other versions
CN111269924A (en
Inventor
赵方杰
孙晟凯
唐仲
黄新元
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN202010192032.1A priority Critical patent/CN111269924B/en
Publication of CN111269924A publication Critical patent/CN111269924A/en
Application granted granted Critical
Publication of CN111269924B publication Critical patent/CN111269924B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C12Y205/01076—Cysteate synthase (2.5.1.76)

Abstract

The invention discloses rice cysteine synthase OsASTOL1 and application thereof. A cysteine synthase OsASTOL1 has a sequence shown in SEQ ID NO. 1. After the gene is subjected to point mutation to cause single amino acid substitution, the accumulation of arsenic content at the roots of rice and the accumulation of sulfur and selenium on the overground part are obviously improved. The invention discovers the biological function of cysteine synthase coding gene OsASTOL1 in rice through a large number of experiments, and after the gene is mutated, the arsenic storage capacity of the root of the astol1 mutant is obviously improved, so that the arsenic content of mutant grains is obviously reduced; the sulfur and selenium absorption capacity of the roots of the astol1 mutant is obviously improved, so that the sulfur and selenium content of the mutant grains is obviously increased.

Description

Rice cysteine synthase coding gene OsASTOL1 mutant and application thereof
Technical Field
The invention belongs to the technical field of plant genetic engineering, and relates to a rice cysteine synthase gene OsASTOL1 mutant and application thereof.
Background
At present, the food safety problem caused by heavy metal pollution is increasingly prominent. The rice is an important grain crop, and about half of the global population takes the rice as a main grain crop. Rice has an enriching effect on arsenic (As) relative to other crops (Su et al, 2009), and people are threatened by As through daily ingestion (Zhao et al, 2010). Therefore, it is very important to analyze the mechanism of As absorption and detoxification of rice and to develop a method for reducing As accumulation in rice grains by genetic engineering techniques. In plants, As (III) is the predominant form of As, which is sequestered by plant Glutathione (GSH) and chelating Peptides (PCs) and transported into the vacuole (ZHao et al, 2010; Clemens and Ma, 2016). GSH and PCs are products of thionin (S) metabolism, and increasing the content of GSH and PCs in rice is an important means for reducing As accumulation of rice grains (Hayashi et al, 2017; Deng et al, 2018).
"stealth starvation" due to inadequate long-term vitamin and mineral nutrient intake is also receiving increasing international social attention. Selenium (Se), a necessary nutrient for humans, is lacking to increase the risk of health problems such as cancer and cardiovascular disease (Sors et al, 2005). The average selenium intake in many areas of China is below the World Health Organization (WHO) recommendations (40 μ g d)-1) Even some regions have selenium intake less than 10 mu g d-1(Combs, 2001; Chen et al, 2002). As an important staple food, the rice can improve the selenium content in rice grains, which is a good way for satisfying the selenium intake of human beings. Selenate in the soil is the main source of selenium absorption by plants. Due to the chemical similarity of sulfate and selenate, selenate can be absorbed into roots through sulfate transporters (Shibagaki et al, 2002).
At present, few reports of genes directly influencing the accumulation of arsenic and selenium in rice grains exist. The OsASTOL1 gene has accession number AF073695.2 in GenBank and is annotated as Cysteine Synthase (Cysteine Synthase).
Disclosure of Invention
The invention aims to provide a mutant rice cysteine synthase coding gene OsASTOL 1.
The invention aims to provide application of a rice cysteine synthase coding gene mutant.
The purpose of the invention can be realized by the following technical scheme:
the CDS sequence of the mutant rice OsASTOL1 gene is shown in SEQ ID NO.1, and the position 566 generates single base substitution (G of wild type is mutated into A) to cause amino acid substitution (serine of wild type is substituted into asparagine of mutant type).
The application of the mutant cysteine synthase gene in reducing the arsenic content in rice grains is provided.
The application of the mutant cysteine synthase gene in improving the contents of sulfur and selenium elements in roots and overground parts of rice is disclosed.
The mutant cysteine synthase gene is applied to reducing the arsenic content in rice grains and improving the contents of sulfur and selenium elements at the roots and the overground parts of rice by means of genetic engineering.
A recombinant expression vector comprising the mutated cysteine synthase gene of the present invention.
The recombinant expression vector disclosed by the invention is applied to reducing the arsenic content in rice grains.
The recombinant expression vector is applied to improving the contents of sulfur and selenium elements in roots and overground parts of rice.
The recombinant expression vector is applied to reducing the arsenic content in rice grains and improving the contents of sulfur and selenium elements in roots and overground parts of rice by means of genetic engineering.
A method for improving variety of rice includes editing 566 th site base of wild cysteine synthase gene of rice shown in SEQ ID No.2 by gene engineering means to make it generate single base substitution, and mutating from wild G to A.
The application of the cysteine synthase in enhancing the accumulation of arsenic in rice roots.
The application of the cysteine synthase in enhancing the sulfate absorption capacity of roots and remarkably improving the total sulfur accumulation of overground parts of rice.
The application of the cysteine synthase in enhancing the selenate absorption capacity of roots and obviously improving the total selenium accumulation of overground parts of rice.
The cysteine synthase is applied to obviously reducing the accumulation of total arsenic in rice grains, obviously improving the accumulation of total sulfur and total selenium in the rice grains and not obviously influencing the agronomic characters.
The invention has the advantages of
1. The invention provides a mutant rice cysteine synthase coding gene OsASTOL1 and a biological function thereof for the first time through systematic research.
2. After the mutation of the cysteine synthase coding gene OsASTOL1, the arsenic content of the rice roots is obviously improved under the hydroponic condition (figure 1).
3. After the cysteine synthase encoding gene OsASTOL1 is mutated, the accumulation amount of sulfur and selenium elements in rice bodies is obviously improved under the condition of water culture (figure 2 and figure 3).
4. After the mutation of the cysteine synthase coding gene OsASTOL1, the arsenic content of the rice grain is obviously reduced under the field experiment condition, the sulfur and selenium content of the rice grain is obviously improved, and the agronomic characters of the rice are not influenced (figure 4, figure 5 and figure 6).
5. The overground sulfur and root arsenic content of the anaplerosis strain is restored to the wild type level by knocking out the OsASTOL1 gene anaplerosis 1 mutant through CRISPR-Cas9 gene editing (figure 7).
Drawings
FIG. 1 shows molecular markers for the differential identification of wild type and heterozygous and homozygous mutants.
FIG. 2 shows that the gene OsASTOL1 has obviously improved the accumulation of arsenic element in roots after mutation. After being cultured in 1/2Kimura B nutrient solution for four weeks, the hybrid mutant material is treated by 5 mu M As (III) for 3 days, compared with the wild type, the hybrid mutant material of astol1 accumulates more than one time of total As at the root part, and the content of the As at the overground part is not different;
FIG. 3 shows that the OsASTOL1 gene has obviously improved sulfur accumulation in rice after mutation. After being cultured in 1/2Kimura B nutrient solution for five weeks, the hybrid and homozygous mutant materials of the astol1 obviously increase the total S content on the overground part compared with the wild type;
FIG. 4 shows that the OsASTOL1 gene has been mutated to increase the accumulation of selenium in rice. Treatment with 2 μ M sodium selenate for 3 days after five weeks hydroponics in 1/2Kimura B nutrient solution resulted in a significant increase in total Se content in roots and aerial parts of the astol1 hybrid mutant material compared to wild type;
fig. 5 shows that in different field experiments, the astol1 hybrid mutant material significantly reduced the accumulation of As in rice kernels compared with the wild type.
Fig. 6 shows that in different field experiments, the astol1 hybrid mutant material significantly increased the accumulation of S and Se in rice kernels compared with the wild type.
A, the S content of grains in wild type and astol1 hybrid mutant materials in different paddy fields;
b, in different paddy fields, the Se content of grains in the wild type and astol1 hybrid mutant materials;
FIG. 7 shows agronomic performance indicators (plant height, effective tiller number, grain number per ear, seed set percentage, thousand kernel weight and individual plant yield) of wild type and astol1 hybrid mutant materials in field experiments.
FIG. 8 shows that knocking out the mutant OsASTOL1 gene in the background of astol1 mutant can restore total sulfur in aerial parts and total arsenic content in roots to wild type levels.
A: after being cultured in 1/2Kimura B nutrient solution for five weeks, the total sulfur content of the overground parts of four independent transgenic lines of which the mutant OsASTOL1 gene is knocked out under the background of the astol1 mutant is restored to the level of a wild type.
B: the total arsenic content of the roots of four independent transgenic lines of knock-out mutant OsASTOL1 gene in the background of astol1 mutant was restored to wild type level by hydroponic culture in 1/2Kimura B nutrient solution for five weeks, 5. mu.M As (III) treatment for 3 days.
FIG. 9 is a transgenic shoot overexpressing the mutant OsASTOL1 gene in a wild-type background.
Detailed Description
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. It is intended that all modifications or alterations to the methods, procedures or conditions of the present invention be made without departing from the spirit or essential characteristics thereof.
Example 1
The specific implementation process of obtaining and gene positioning of the cysteine synthase gene OsASTOL1 rice mutant is as follows:
1) structure of rice Ethyl Methane Sulfonate (EMS) chemical induced libraryBuilding: about 1kg of rice seeds (Kasalath) were soaked at 37 ℃ for 24 hours, then subjected to chemical mutagenesis using 1% EMS (v/v) for 8 hours, and then rinsed with tap water to remove residual EMS. Accelerating germination for 48 hours at 37 ℃, then sowing the mutagenized rice seeds into a rice field, and harvesting seeds M of each individual plant after the rice is mature2And generating, drying, storing and preparing to complete the construction of the rice mutant library.
2) Screening and gene mapping of rice mutants: when a rice mutant library is screened, 20 mu M As (III) is used for screening to obtain a semi-dominant arsenic-resistant rice mutant which is named As arsenite tolerant 1(astol1), the rice whole genome sequencing is carried out on the semi-dominant arsenic-resistant rice mutant, the rice whole genome sequencing is cloned until a mutant gene is OsASTOL1, G at the 566 th site of a fifth exon in a CDS sequence region of the OsASTOL1 gene is mutated into A, so that single amino acid substitution (serine-asparagine) is caused, and the CDS sequence of the mutated rice cysteine synthase coding gene OsASTOL1 is shown in SEQ ID NO. 1.
In the embodiment, a cysteine synthase coding gene osastol1 mutant of Kasalath rice background is obtained.
Example 2
The identification of heterozygous and homozygous mutants of astol1 is carried out as follows:
1) accelerating germination of seeds of the wild type and the astol1 mutant at 37 ℃ for 3 days, and then sowing the seeds on a suspended plastic small black net;
2) after culturing for two weeks, transferring the seedlings into 1/2Kimura B nutrient solution for culturing;
3) after taking leaves for DNA extraction, PCR amplification is carried out by using the following primers:
dCAPS-F：5’-CTCACGATGCCGGCCTCCCTGA-3’
dCAPS-R：5’-TCCCAGTATGAGTCCACAGAACACA-3’
10 μ l amplification system: 5 μ l Mix buffer; 1. mu.l of DNA; 1. mu.l of each primer; 2 μ l ddH2O
Amplification conditions: (1)95 ℃ for 5 min; (2) at 95 ℃ for 30 s; (3) 30s at 55 ℃; (4) 10s at 72 ℃; (5) 5min at 95 ℃; (6) 5min at 12 ℃; steps (2) - (4) were repeated for 35 cycles.
Example 3
The identification of heterozygous and homozygous mutants of astol1 is carried out as follows:
1) the PCR product amplified in example 2 was digested overnight at 37 ℃ using DdeI restriction enzyme. The enzyme digestion system is as follows: 3. mu.l of PCR product; 1 μ l of cutmarst buffer; 0.2. mu.l DdeI; 5.8 μ l ddH2O
2) Adding 2 μ l loading buffer to the enzyme digestion product, and separating by electrophoresis at 190V voltage for 1h on 8% polyacrylamide gel (SDS-PAGE);
3) adding the gel after electrophoresis into 0.5 percent AgNO3Placing the solution on a shaking table, and silver staining for 10-14 min;
3) washing with deionized water for three times, adding the washed glue into developer (1.0-1.5% NaOH, 0.5% formaldehyde), and slowly shaking in parallel until clear band shape appears.
In this example, a molecular marker was obtained to identify heterozygous and homozygous mutants of astol1, as shown in fig. 1, the single upper band representing the wild type, the single lower band representing the homozygous mutant of astol1, and the two bands representing the heterozygous mutant of astol 1.
Example 4
The specific implementation process of comparing the total As content in the hybrid mutant material of astol1 with that in the wild rice is As follows:
1) accelerating germination of seeds of the wild type and the astol1 mutant at 37 ℃ for 3 days, and then sowing the seeds on a suspended plastic small black net;
2) after two weeks of culture, the seedlings were transferred to 1/2Kimura B nutrient solution and cultured for another 2 weeks; during which hybrid mutant material of astol1 was identified using the method of example 2;
3) planting 8 rice plants of 4 weeks in 5L culture dish, each material is treated with 5 μ MAs (III) for 3 days in 4 replicates;
4) as (III) after 3 days of treatment, collecting the overground part and the underground part of the rice, washing the overground part and the underground part with deionized water for 3 times, and drying the rice for 3 days at 65 ℃;
5) the sample was weighed and 5ml of mixed acid (HNO) was added3:HClO485:15) in a graphite digesting furnace；
6) With 2% HNO3The volume of the digestion solution of the sample is determined to be 10mL, the digestion solution is fully shaken up and transferred to a 15mL centrifuge tube for preservation;
7) the content of As in each sample was determined by inductively coupled plasma-mass spectrometry (ICP-MS).
The results of this example show that the osastol1 hybrid mutant material accumulated more total As in roots than in wild type, rather than in the aerial parts (fig. 2).
Example 5
The comparison of the total S content in the hybrid and homozygous mutant materials of astol1 and wild rice is carried out as follows:
1) accelerating germination of seeds of the wild type and the astol1 mutant at 37 ℃ for 3 days, and then sowing the seeds on a suspended plastic small black net;
2) after two weeks of culture, the seedlings were transferred to 1/2Kimura B nutrient solution and cultured for another 3 weeks; during which hybrid and homozygous mutant material of astol1 was identified using the method in example 2;
3) collecting the overground part and the underground part of the rice with the size of about five weeks, cleaning the overground part and the underground part with deionized water for 3 times, and drying the rice for 3 days at 65 ℃;
5) the sample was weighed and 5ml of mixed acid (HNO) was added3:HClO485:15) is cooked in a graphite cooking oven.
6) With 2% HNO3The digestion solution was made to 10mL, shaken well and transferred to a 15mL centrifuge tube for storage.
7) The S content in each sample was determined by ICP-MS.
The results of this example show that the osastol1 heterozygous and homozygous mutant material accumulated more total S above ground compared to the wild type (figure 3).
Example 6
The specific implementation process of comparing the total Se content in the astol1 hybrid mutant material with that in the wild rice is as follows:
1) accelerating germination of seeds of the wild type and the astol1 mutant at 37 ℃ for 3 days, and then sowing the seeds on a suspended plastic small black net;
2) after two weeks of culture, the seedlings were transferred to 1/2Kimura B nutrient solution and cultured for another 2 weeks; during which hybrid mutant material of astol1 was identified using the method of example 2;
3) 8 rice plants of about 4 weeks in size were grown in 5L petri dishes, 4 replicates of each material, treated with 2. mu.M Se (VI) for 3 days;
4) se (VI) treating for 3 days, collecting the overground part and the underground part of the rice, washing for 3 times by using deionized water, and drying for 3 days at 65 ℃;
5) the sample was weighed and 5ml of mixed acid (HNO) was added3:HClO485:15) digesting in a graphite digesting furnace;
6) with 2% HNO3The volume of the digestion solution of the sample is determined to be 10mL, the digestion solution is fully shaken up and transferred to a 15mL centrifuge tube for preservation;
7) the Se content in each sample was determined by ICP-MS.
The results of this example show that the osastol1 hybrid mutant material accumulated more total Se in roots and aerial parts compared to wild type (fig. 4).
Example 7
The specific implementation process of comparing the contents of total As, total S and total Se of grains of wild rice and astol1 hybrid mutant materials in a field experiment is As follows:
1) accelerating germination of seeds of the wild type and the astol1 mutant at 37 ℃ for 3 days, and then sowing the seeds on a suspended plastic small black net;
2) after two weeks of culture, the seedlings were transferred to 1/2Kimura B nutrient solution and cultured for another 2 weeks; during which hybrid mutant material of astol1 was identified using the method of example 2;
3) transplanting the seedlings into a paddy field when the seedlings grow to three or four leaves, wherein one plant is planted in each hole, the distance between every two plants is 10cm, and the distance between every two lines is 15 cm. In the period, normal moisture, nutrient management control and pest control are carried out;
4) paddy fields (south Beijing and Hainan Ling water, Jiangsu) planted in different places in different years;
5) and after the rice is mature, randomly taking rice grains of four single plants to measure the contents of total As, total S and total Se in the rice wild type and astol1 heterozygous mutant grains.
6) After the rice is mature, 9 plants of each row of intermediate rice are selected to determine the agronomic characters of the rice wild type and the astol1 heterozygous mutant.
7) Determining the content of total As, total S and Se in rice grains: weighing 0.5g of grains in a microwave digestion tube, adding 5mL of concentrated nitric acid (super pure) for microwave digestion, metering the volume to 10mL with 5% nitric acid, and transferring to a 15mL centrifuge tube for storage. And measuring the content of As and S in the grain sample by utilizing ICP-MS (inductively coupled plasma-mass spectrometry), and measuring the content of Se in the grain sample by utilizing a liquid chromatogram-atomic fluorescence spectrometer (LC-AFS 8500).
The results of this example show that when planted in paddy fields in different regions, the astol1 hybrid mutant material significantly reduced the accumulation of As (FIG. 5) and enriched more S (FIG. 6A) and Se (FIG. 6B) in the seeds compared with the wild type, and the agronomic characters were not changed much (FIG. 7).
Example 8
Knocking out a mutant gene of a cysteine synthase encoding gene OsASTOL1 in a mutant astol1 by using a CRISPR-Cas9 gene editing technology, and verifying whether the mutant phenotype accumulated by root high As and overground high S can be successfully complemented or not, wherein the specific implementation process comprises the following steps:
1) target I sequence (ATGGGTGAGACCATCGCCA) was found by analysis of the second exon of the coding region of OsASTOL1 and target II sequence (TTGGCTCAATCAGCACACTC) was found on the antisense strand of the coding region of the OsASTOL1 functional domain. Primers were designed from these two target gene fragments found, and the sequences of the primers (5 '-3') were as follows:
ASTOL1-U3-F:5’-ggcaATGGGTGAGACCATCGCCA-3’
ASTOL1-U3-R:5’-aaacTGGCGATGGTCTCACCCAT-3’
ASTOL1-U6-F:5’-gccgTTGGCTCAATCAGCACACTC-3’
ASTOL1-U6-R:5’-aaacGAGTGTGCTGATTGAGCCAA-3’
2) the short target fragments formed by the primer self-ligation reaction are respectively ligated into the linearized vectors pYLsgRNA-OsU3 and pYLsgRNA-OsU6a which are singly digested by BsaI, so as to form U3-ASTOL1-sgRNA and U6a-ASTOL1-sgRNA fragments, and then the fragments containing two target sequences are finally ligated into the final vector pYLCRISPR/Cas9-MTmono plasmid.
3) The correct plasmid was verified for transgenesis. The seeds used for transgenosis are from the previous generation heterozygous mutant, so the obtained transgenic rice backgrounds are respectively wild type, heterozygous mutant and homozygous mutant. After the transgenic T0 generation was obtained, genotyping was first performed by dCAPS marker in example 2, followed by PCR amplification and DNA sequencing of both targets with the following sequencing primers.
ASTOL1-crispr-F1:5’-TCCTGATGCTTCCTCCTCCAACTC-3’
ASTOL1-crispr-R1:5’-GCTTCACCTATCCTTGACGCTGG-3’
ASTOL1-crispr-F2:5’-CCCGTGTCTAAGCCTAGAACTCCTT-3’
ASTOL1-crispr-R2:5’-TCAGGTCCAGTGGTCTCGTAATGG-3’
4) Comparing the Kasalath wild type sequence with the sequencing sequence, recording the mutation site of each seedling, selecting a single plant homozygous for sequencing, namely the knockout material of the mutated astol1 gene, and then breeding the single plant for later use.
5) Accelerating germination of wild type and four independent seeds which are subjected to gene editing astol1 heterozygous mutant at 37 ℃ for 3 days, and then sowing the seeds on a suspended plastic small black net;
6) after two weeks of culture, the seedlings were transferred to 1/2Kimura B nutrient solution and cultured for another 2 weeks; during which the background of the genotype of rice was identified by the method in example 2;
7) treating with 5 μ M As (III) for 3 days, collecting the overground part and underground part of rice, washing with deionized water for 3 times, and drying at 65 deg.C for 3 days; the sample was weighed and 5ml of mixed acid (HNO) was added3:HClO485:15) digesting in a graphite digesting furnace; with 2% HNO3The volume of the digestion solution of the sample is determined to be 10mL, the digestion solution is fully shaken up and transferred to a 15mL centrifuge tube for preservation;
8) the S and As content of each sample was measured by ICP-MS.
The results of this example show that the total S content and root As content of the overground part of the knockout anaplerotic line obtained by the CRISPR-Cas9 gene editing technology in the background of the astol1 mutant have been restored to the normal level of wild-type rice (fig. 8A and 8B), demonstrating that the mutation of the cysteine synthase encoding gene OsASTOL1 affects the phenotype of the rice mutant with root As-rich and overground S accumulation.
Example 9
The transgenic material of the overexpression mutant OsASTOL1 gene under the wild background is obtained by the following specific implementation process:
1) accelerating germination of seeds of the wild type and the astol1 mutant at 37 ℃ for 3 days, and then sowing the seeds on a suspended plastic small black net;
2) after two weeks of culture, seedlings were transferred to 1/2Kimura B nutrient solution, and the method in examples 2 and 3 was used to identify the astol1 homozygous mutant material;
3) the leaves of the astol1 homozygous mutant are stored in liquid nitrogen, and a plant total RNA extraction kit (Beijing Baitag company) is used for extracting RNA.
4) The total cDNA synthesis was performed using a reverse transcription kit (Nanjing Novozam Co.).
5) Obtaining the full length of the mutant OsASTOL1 gene and constructing an overexpression vector:
an overexpression primer is designed according to the OsASTOL1 full-length cDNA sequence, and the primer sequence is as follows:
OsASTOL1-F:GGATCCCCGGGTACCATGGCCGTCCAGG；
OsASTOL1-R:GAGCTCTCTAGAACTAGTTCATTCAACCACCAT；
amplifying by taking the rice cDNA extracted in the step 4) as a template to obtain a mutant OsASTOL1 gene open reading frame sequence. And recovering and purifying the PCR product containing the target gene, and then connecting the PCR product with a pTCK303 vector containing a specific enzyme cutting site obtained by double enzyme cutting with Spe I and Kpn I to obtain an expression vector pTCK303-Osastol1, and sequencing and verifying the accuracy for later use.
6) The vector pTCK303-Osastol1 with correct enzyme connection is transferred into agrobacterium for standby.
7) Infecting the obtained agrobacterium transformed with pTCK303-Osastol1 plasmid with Kasalath rice callus, culturing for 2 days, selective culturing, differentiating, rooting, and hardening to obtain T0Transgenic plants are generated.
The results of this example yielded transgenic material overexpressing mutant OsASTOL1 gene in wild-type background (FIG. 9).
Reference to the literature
Chen,L.,Yang,F.,Xu,J.,Hu,Y.,Hu,Q.,Zhang,Y.,and Pan,G.(2002).Determination of selenium concentration of rice in china and effect of fertilization of selenite and selenate on selenium content of rice.J.Agric.Food Chem.50,5128-5130.
Clemens,S.,and Ma,J.F.(2016).Toxic Heavy Metal and Metalloid Accumulation in Crop Plants and Foods.Annual Review of Plant Biology.
Combs,G.F.(2001).Selenium in global food systems.Br.J.Nutr.85,517-547.
Deng,F.,Yamaji,N.,Ma,J.F.,Lee,S.K.,Jeon,J.S.,Martinoia,E.,Lee,Y.,and Song,W.Y.(2018).Engineering rice with lower grain arsenic.Plant Biotechnology Journal 16,1691-1699.
Hayashi,S.,Kuramata,M.,Abe,T.,Takagi,H.,Ozawa,K.,and Ishikawa,S.(2017).Phytochelatin synthase OsPCS1 plays a crucial role in reducing arsenic levels in rice grains.The Plant Journal 91,840-848.
Shibagaki,N.,Rose,A.,McDermott,J.P.,Fujiwara,T.,Hayashi,H.,Yoneyama,T.,and Davies,J.P.(2002).Selenate-resistant mutants of Arabidopsis thaliana identify Sultr1；2,a sulfate transporter required for efficient transport of sulfate into roots.Plant Journal 29,475-486.
Sors,T.G.,Ellis,D.R.,and Salt,D.E.(2005).Selenium uptake,translocation,assimilation and metabolic fate in plants.Photosynth.Res.86,373-389.
Su,Y.-H.,McGrath,S.P.,and Zhao,F.-J.(2009).Rice is more efficient in arsenite uptake and translocation than wheat and barley.Plant and Soil 328,27-34.
Zhao,F.-J.,McGrath,S.P.,and Meharg,A.A.(2010).Arsenic as a food chain contaminant:mechanisms of plant uptake and metabolism and mitigation strategies.Annual review of plant biology 61,535-559.
Sequence listing
<110> Nanjing university of agriculture
<120> rice cysteine synthase encoding gene OsASTOL1 mutant and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1227
<212> DNA
<213> Rice (Kasalath)
<400> 1
atggccgtcc aggttcaacg aacgcccctc ccccggtcca cgtacaccgg ccatcggggc 60
tatctcctgc gggccccacc tgcagtgaca cggtgcaccg tggaccgcgc cttcccgcgc 120
agtcatggac ctccccttcc tcgtctcctg tataaaacct cgcgtcctga tgcttcctcc 180
tccaactcca cgagtcgcca tttcccaagg aggagcaagg attgttgttg tttcgctgtc 240
agatcgattc ctgacgggat aatgggtgag accatcgcca aggatgtcac cgagttgatt 300
gggaacacgc cgttggtgta cctcaaccgg gtgacggatg ggtgcgtcgg gcgcgtcgcg 360
gccaagctcg agtccatgga gccatgctcc agcgtcaagg ataggattgg atacagtatg 420
atcactgatg cagaggagaa ggggctgatc actccaggca agagtgtgct gattgagcca 480
actagtggca acacaggcat tggactggcc ttcatggctg ctgcaaaggg ttacaggctt 540
gtactcacga tgccggcctc catgaacatg gagaggagaa tcatattgaa ggcttttggt 600
gctgaattga tacttactga cccactcttg ggaatgaaag gagctgtcca aaaggcagaa 660
gaactggcag cgaagacaaa caactcattt atcctccaac aattcgagaa ccctgctaac 720
ccaaagatcc attacgagac cactggacct gaaatctgga aaggaacagg aggtaaagtt 780
gatggtttag tttctggtat tgggacaggt ggcactatta ctggagctgg acgatacctc 840
agagagcaaa atcctgatat caagatctat ggtgtggagc cagtcgagag cgctgtctta 900
tctggtggaa agcctgggcc acacaagatt caaggaattg gagctggttt tgttcctggg 960
gtcctggatg ttgacctcat caatgaaact gtacaagttt caagtgatga agctatcgag 1020
atggcaaagg ctcttgcatt gaaagaaggg ttgctggttg gaatatcttc aggtgcagct 1080
gcagcagcag ctgttaggct cgctcagagg ccggaaaatg aaggaaaact ttttgttgtt 1140
gtcttcccaa gctttggtga gcggtacctt tcgtcggtgc tcttccagtc catcaagaag 1200
gaagctgaaa acatggtggt tgaatga 1227

Claims (9)

1. A mutant cysteine synthase gene is characterized in that the sequence is shown as SEQ ID NO. 1.
2. The use of the mutated cysteine synthase gene of claim 1 for reducing arsenic content in rice grain.
3. Use of the mutated cysteine synthase gene according to claim 1 for increasing the content of elemental sulphur and selenium in the upper part of the rice.
4. The use of the mutated cysteine synthase gene of claim 1 in reducing arsenic content in rice grain and increasing the content of sulfur and selenium in the overground part of rice by genetic engineering means.
5. A recombinant expression vector comprising the mutated cysteine synthase gene of claim 1.
6. The recombinant expression vector of claim 5 for use in reducing arsenic content in rice grain.
7. The use of the recombinant expression vector of claim 5 to increase the sulfur and selenium content of rice above ground.
8. The recombinant expression vector of claim 5 is applied to the reduction of arsenic content in rice grains and the improvement of sulfur and selenium content in overground parts of rice by means of genetic engineering.
9. A method for improving the variety of rice features that the nucleotide at 566 th site of wild-type cysteine synthase gene shown by SEQ ID No.2 is edited by gene engineering to make it generate single-base substitution, and the wild-type G is mutated to A.
CN202010192032.1A 2020-03-18 2020-03-18 Rice cysteine synthase coding gene OsASTOL1 mutant and application thereof Active CN111269924B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010192032.1A CN111269924B (en) 2020-03-18 2020-03-18 Rice cysteine synthase coding gene OsASTOL1 mutant and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010192032.1A CN111269924B (en) 2020-03-18 2020-03-18 Rice cysteine synthase coding gene OsASTOL1 mutant and application thereof

Publications (2)

Publication Number Publication Date
CN111269924A CN111269924A (en) 2020-06-12
CN111269924B true CN111269924B (en) 2022-03-04

Family

ID=70994505

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010192032.1A Active CN111269924B (en) 2020-03-18 2020-03-18 Rice cysteine synthase coding gene OsASTOL1 mutant and application thereof

Country Status (1)

Country Link
CN (1) CN111269924B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112391394B (en) * 2020-11-26 2022-10-04 南京农业大学 Rice blast resistance related gene OsCYS and application thereof in genetic engineering

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109666682A (en) * 2019-01-29 2019-04-23 南京农业大学 Rice serine hydroxymethyl transferase encoding gene OsSHM4 mutant and its application
CN109956998A (en) * 2017-12-26 2019-07-02 南京农业大学 Rice aquaporin encoding gene OsNIP1;1 application

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7816579B2 (en) * 2007-02-20 2010-10-19 The University Of Massachusetts Metal resistant plants, methods of manufacture, and methods of use thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109956998A (en) * 2017-12-26 2019-07-02 南京农业大学 Rice aquaporin encoding gene OsNIP1;1 application
CN109666682A (en) * 2019-01-29 2019-04-23 南京农业大学 Rice serine hydroxymethyl transferase encoding gene OsSHM4 mutant and its application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Application of CRISPR/Cas9 in Crop Quality Improvement;Qier Liu et al.;《Int. J. Mol. Sci.》;20210419;第22卷;第1-16页 *
水稻转运和解毒三价砷的机制研究;孙晟凯;《中国优秀博硕士学位论文全文数据库(博士)工程科技Ⅰ辑》;20210815(第08期);第B027-4页 *

Also Published As

Publication number Publication date
CN111269924A (en) 2020-06-12

Similar Documents

Publication Publication Date Title
CN104277101B (en) Application of rice nitrate transporter NRT1.1B in enhancing nitrogen utilization efficiency of plants
Gu et al. Enhanced tolerance to drought in transgenic rice plants overexpressing C4 photosynthesis enzymes
Pei et al. Overexpression of Thellungiella halophila H+-pyrophosphatase gene improves low phosphate tolerance in maize
US11542482B2 (en) Rice serine hydroxymethyltransferase coded gene OsSHM4 mutants and application thereof
CN109879944B (en) EAR1 protein related to plant drought resistance and coding gene and application thereof
Chen et al. Generation of low-cadmium rice germplasms via knockout of OsLCD using CRISPR/Cas9
CN108728449B (en) Application of cotton gene GhDTX27 in aspects of salt tolerance, drought tolerance and cold stress of plants
CN111269924B (en) Rice cysteine synthase coding gene OsASTOL1 mutant and application thereof
Yang et al. ZmIAA5 regulates maize root growth and development by interacting with ZmARF5 under the specific binding of ZmTCP15/16/17
CN109880829A (en) Barley HvPAA1 gene and application thereof
CN112210566B (en) Application of rice OsS6K1 gene or OsS6K2 gene in improving rice yield and/or drought resistance
CN107652360A (en) The application of ABI5 albumen and its encoding gene in vegetable seeds oxidative stress resistance is regulated and controled
Dutta et al. Physiological and molecular response to low light intensity in rice: A review
CN109371041B (en) Rice gene OsHGN for increasing grain number per ear and application thereof
CN105802931A (en) CRK4 protein and application of coded gene thereof in regulating and controlling growth of plant stems and leaves
CN115976056A (en) Application of rice zinc-iron regulation transport protein coding gene OsZIP2
CN108676081A (en) Chinese milk vetch LEAFY genes and its application
CN111073896B (en) Gene for controlling corn grain filling, encoding product, primer, carrier and application
CN111733167B (en) Mutant gene OsHMA4 of rice copper high accumulation mutant hc1 and application thereof
CN103525825B (en) The clone of the resistance to manganese poisoning important gene ShMDH1 of one kind of plant and application thereof
Singh et al. 19 Physiological and Molecular Interventions for Improving Nitrogen-Use
JP7246726B2 (en) Method for producing plants with increased weight
CN116732048B (en) Application of rice transcription factor gene OsbZIP48 in obtaining high-zinc rice grains and/or regulating nitrogen absorption
CN111187780B (en) Genetic engineering application of rice potassium ion transport protein gene OsHAK18
Borkarg et al. Transcription factor bHLH121 regulates root cortical aerenchyma formation in maize

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant