CN106222180B - Improve the gene OsNPF7.3 and purposes of rice yield and grain of rice protein content - Google Patents
Improve the gene OsNPF7.3 and purposes of rice yield and grain of rice protein content Download PDFInfo
- Publication number
- CN106222180B CN106222180B CN201610605152.3A CN201610605152A CN106222180B CN 106222180 B CN106222180 B CN 106222180B CN 201610605152 A CN201610605152 A CN 201610605152A CN 106222180 B CN106222180 B CN 106222180B
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- plant
- grain
- fringe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to plant genetic engineering fields, provide rice nitrogen transporter geneOsNPF7.3, protein sequence is as shown in SEQ ID No.1, and cDNA sequence is as shown in SEQ ID No.2.The present invention passes through overexpressionOsNPF7.3Gene improves rice tillering number, every fringe Secondary branch quantity, every fringe grouting grain number and grain of rice protein content, directly enhances yield and grain of rice quality.And it is reduced by RNAi technologyOsNPF7.3The expression quantity of gene, it was confirmed that the function of the gene.The gene has important application value using nitrogenous fertilizer and in terms of improving yield in terms of illustrating Nitrogen effect plant growth and growth course and in rice high efficient.
Description
Technical field
The invention belongs to plant genetic engineering fields, and in particular to a kind of base for improving rice yield and grain of rice protein content
Because of OsNPF7.3 and purposes.
Background technique
Rice is one of most important cereal crops of the mankind.Since Reformation and development, China's economy is skyrocketed through, industrialization
Scale is increasing, causes cultivated area fewer and fewer, this is to solve increase in demand of the population to grain pressure.Solve grain
Food problem must improve the yield of unit area crop.Spike number is the determinant of rice yield, and single plant tiller number is to determine
An important factor for determining spike number, too low or excessively high tiller number can all influence yield per unit area [Li Xueyong, Qian Qian, Li Jiayang water
The molecular mechanism research Bulletin of Chinese Academy of Sciences of rice tiller, 2003, (4): 274-276].Therefore reasonable tiller number is certain
Increase yield in degree.Equally, the quantity of every fringe Secondary branch is also closely related with rice yield, directly determines the every fringe of rice
Raw grouting grain number.And nitrogen metabolism is in the Central Position of metabolic activity in plant, nitrogen nutrition is limiting plant growth
[Chen Yajun, Yan Qingwei, Zhang Lu wait nitrogen and the northeast plant growth Developments agricultural big with the primary factor of yield
Journal, 2013,44:144-148].Nitrogen nutrition can influence vegetative growth of rice plants such as tiller bud development and reproductive growth such as fringe
[Ishikawa S, Maekawa M, the Arite T et al.Suppression of tiller bud activity such as development
in tillering dwarf mutants of rice.Plant and Cell Physiol,2005,46:79-86]。
Plant depends on its intracorporal nitrogen transport protein to the absorption of nitrogen, assimilation and distribution.In order to adapt to environment, water
Rice has evolved the nitrogen transportation system of a set of bulky complex to realize the absorption to different form nitrogen.Contain including transport
The small-molecular peptides transport protein of 2-3 amino acid residue and the nitrate anion transport protein of transport nitrate nitrogen.It sends out in rice at present
Existing 80 small-molecular peptides transporter genes (PTR) [Tsay Y F, Chiu C C, Tsai C B, et al.Nitrate
Transporters and peptide transporters [J] .FEBS Lett, 2007,581:2290-2300] and more than 100
A nitrate anion transporter gene (NRT) [Wu Wei, Zhao Jun plant are notified to progress China's agronomy of N-uptake and use efficiency,
2010,26:75-78].According to the power of transporting nitric acid root ability, NRT gene can be divided into two classes, and one kind is the nitre of low-affinity
Acid group transporter gene (LATs) is also NRT1, and another kind of is that the nitrate anion transporter gene (HATs) of high-affinity is also NRT2
[Marschner H,Kirkby E A,Engels C.Importance of cycling and recycling of
mieral nutrients within plants for growth and development[J].Bot Acta(Dtsch),
1997,110:265-274].Sequence homology between NRT1 and PTR is high and constitutes NRT1/PTR gene family, abbreviation NPF
Family.Seldom to the report of NPF family member research at present, OsNPF7.3 gene disclosed by the invention is exactly rice NPF family
An important gene member, which can be applied to genetic modification of plants, will be formed to plant products and Rice puantity point
Sub- mechanism study has biggish facilitation.
Summary of the invention
In order to solve the problems in the existing technology, the present invention is with the NPF gene family newcomer OsNPF7.3 of rice
For object, from spending the full length sequence for having cloned OsNPF7.3 in 11 in rice, after overexpression, improve rice tillering number,
Every fringe Secondary branch quantity, every fringe grouting grain number and grain of rice protein content, directly enhance yield, in addition also pass through RNAi technology
Confirm the function of the gene.
The object of the present invention is to provide a kind of control rice yield and gene OsNPF7.3, the cDNA codings of grain of rice albumen
Protein amino acid sequence as shown in SEQ ID NO.1.
The present invention also provides the cDNA sequence SEQ ID NO.2 of gene OsNPF7.3 a kind of.
It is construed as, (i.e. not in the activated centre of albumen) under the premise of not influencing OsPTR10 protein active, ability
It is one or several that field technique personnel can carry out various substitutions, additions and/or deletions to amino acid sequence shown in SEQ ID NO.1
Amino acid obtains the amino acid sequence with same function.
Therefore, the protein of rice Os NPF7.3 gene of the invention coding further includes amino acid shown in SEQ ID NO.1
Sequence is substituted, replaces and/or increases one or several amino acid, has same active rice Os NPF7.3 gene coding
Protein.Furthermore, it is to be understood that in view of the degeneracy of codon and the preferences of different plant species codon, art technology
Personnel can according to need using the codon for being suitble to particular species expression.
On the other hand, the invention also includes Sense sequences or antisense sequences based on the polynucleotides, including containing
State polynucleotide sequence or its segment cloning vector or expression vector, the host cell containing the carrier, containing the core
The plant cell of the conversion of nucleotide sequence or its segment and genetically modified plants.
The present invention also provides application of the OsNPF7.3 gene in rice breeding, the rice breeding is to improve rice point
Tiller number, every fringe Secondary branch quantity, every fringe grouting grain number and grain of rice protein content, to improve rice yield and rice quality.
The present invention also provides a kind of application of OsNPF7.3 gene in other genetically modified plants.Pass through overexpression gene
OsNPF7.3 improves the nitrogen use efficiency and yield of plant.The plant refers to monocotyledon or dicotyledon；Such as:
Wheat, corn, cucumber, tomato, poplar, turfgrass or clover etc.
The present invention also provides the molecular detecting methods of rice Os NPF7.3 gene transgenic plant, pass through the primer pair
Transgenic paddy rice genomic DNA to be checked is expanded, and detects amplified production: if using the upstream primer F of primers F P7:
GATGTTGGCGACCTCGTATT and downstream primer R:TCGTTATGTTTATCGGCACTTT, amplifies the amplified fragments of 517bp,
Then explanation is transgenic positive plant, and explanation is transgene negative plant if not expanding this segment.
Realize that technology of the invention is as follows:
1, overexpression OsNPF7.3 gene:
Overexpression vector OsNPF7.3-p1301 is constructed, the genetic transforming method mediated using Agrobacterium EHA105 will surpass
Expression vector is imported in normal rice varieties and is spent in 11, finally obtains the tissue-cultured seedling for overexpressing this gene, is planted in crop field, is used primer
To the upstream primer F:GATGTTGGCGACCTCGTATT and downstream primer R:TCGTTATGTTTATCGGCACTTT of FP7, amplification
The amplified fragments of 517bp out, then explanation is transgenic positive plant, and positive plant single plant sowing is simultaneously planted, until T2 generation identification
Homozygous plants out, the yield for overexpressing plant and grain of rice protein content are than spending 11 raisings, such as Fig. 3 in control wild type.
2, the function of OsNPF7.3 gene is verified
Interference expression vector OsNPF7.3-pTCK303, the something lost mediated using Agrobacterium EHA105 are constructed by RNAi technology
Method for transformation is passed, interference expression vector is imported in normal japonica rice variety and is spent in 11, finally obtains the strain of gene expression amount decline
System shows as such as scheming than spending 11 yield and grain of rice protein content to tail off in control wild type until T2 generation continues to observe phenotype
4。
Advantages of the present invention and effect:
1, enhance Tillering Ability in Rice after the OsNPF7.3 gene overexpression that the present invention clones, improve every fringe Secondary Branch
Obstruct quantity, every fringe grouting grain number and grain of rice protein content, illustrates that OsNPF7.3 gene pairs raising rice yield is more apparent, therefore,
It can be improved plant products by the expression that technique for gene engineering improves OsNPF7.3 gene.It is not only does this facilitate by normally applying
High-yield rice is cultivated under the conditions of nitrogen, and the breed improvement of plant can also be carried out by molecular breeding.
2, the successful clone of OsNPF7.3 gene further demonstrates important function of the NPF family in nitrogen absorption process,
There is important meaning to the biological function for illustrating NPF family, in addition to plant nitrogen metabolism approach is further appreciated that, improves nitrogen and inhale
The rate of producing effects has great impetus.
Although 3, being cloned into some genes for improving plant products at present, still not to the molecular mechanism of plant yield-increasing
It is clear.And the OsNPF7.3 gene that the present invention clones can be improved the yield of rice, have to the key factor for determining plant yield-increasing
Great impetus.
Detailed description of the invention
The overexpression vector structure figures of Fig. 1 OsNPF7.3 gene；
The RNAi carrier structure figures of Fig. 2 OsNPF7.3 gene；
Fig. 3 control, OsNPF7.3 gene overexpression 3 strains of plant, 3 strains of interference plant of OsNPF7.3 gene
Whole strain phenotype；
Fig. 4 control, OsNPF7.3 gene overexpression 3 strains of plant, 3 strains of interference plant of OsNPF7.3 gene
Tiller number compares；
Fig. 5 control, OsNPF7.3 gene overexpression 3 strains of plant, 3 strains of interference plant of OsNPF7.3 gene
Every fringe Secondary branch number compares；
Fig. 6 control, OsNPF7.3 gene overexpression 3 strains of plant, 3 strains of interference plant of OsNPF7.3 gene
Every fringe grouting grain number compares；
Fig. 7 control, OsNPF7.3 gene overexpression 3 strains of plant, 3 strains of interference plant of OsNPF7.3 gene
The total protein content of every fringe grain of rice compares；
Specific embodiment
By following detailed description combination attached drawing it will be further appreciated that the features and advantages of the invention.Provided implementation
Example is only the explanation to the method for the present invention, remaining content without limiting the invention in any way announcement.
Unless otherwise specified, the conventional means that technological means used is well known to those skilled in the art；Reality used
Proved recipe method is conventional method, and can (referring to molecular cloning, laboratory manual, second edition is cold according to the recombinant technique described
Publishing house, spring Cold Spring Harbor Laboratory, Cold SpringHarbor, New York) it completes；Material, reagent used etc., are commercially available.
The building of [embodiment 1] overexpression OsNPF7.3 gene plant
11 RNA is spent in extraction rice, and its reverse transcription is utilized at cDNA
Primers F: AGATCTATGGACGCCGGCGAAATCATCGTG (Seq ID No:3)
Primer R:CTTAAGTCACGACACGACCAGCTTCACC (Seq ID No:4)
After cDNA by PCR amplification OsNPF7.3 gene, it is connected into pCAM1301 carrier, pCAM1301 carrier structure is certainly
Cambia company constructs the overexpression vector OsNPF7.3-p1301 of OsNPF7.3 gene, as shown in Figure 1.Using Agrobacterium
The genetic transforming method that EHA105 is mediated, overexpression vector is imported in normal rice varieties and is spent in 11.
All transgenic plants are transplanted in the frame with soil after obtaining, and are periodically watered, and fertilising is grown tall about to seedling
When 10cm, Zhong Yu great Tanaka detects overexpression plant, the FP7 primer pair designed for detection is after seedling is grown up
F:GATGTTGGCGACCTCGTATT (Seq ID No:5)；
R:TCGTTATGTTTATCGGCACTTT (Seq ID No:6)；
Positive plant single plant sowing is simultaneously planted, until in T2 generation, identifies homozygous plants, it is available that rice nitrogen can be made to utilize
The overexpression plant of the OsNPF7.3 gene of efficiency and output increased, as shown in Figure 3.
The building of [embodiment 2] OsNPF7.3 gene interference plant
11 cDNA will be spent to utilize primer pair in rice:
R1F:5'ACTAGTAACCTTGCTTGCTTGCCTCT 3'(Seq ID No:7)
R1R:5'GAGCTCGCTTTGCTCCTCGCTTTCT 3'(Seq ID No:8)
R2F:5'GGTACCAACCTTGCTTGCTTGCCTCT 3'(Seq ID No:9)
R2R:5'GGATCCGCTTTGCTCCTCGCTTTCT 3'(Seq ID No:10)
After respective PCR amplification goes out the cDNA segment of OsNPF7.3 gene, it is connected into pTCK303 carrier, pTCK303 carrier is in
Institute, section Institute of Zoology kind health laboratory give, and constructs the interference carrier OsNPF7.3-pTCK303 of OsNPF7.3 gene.It adopts
The genetic transforming method mediated with Agrobacterium EHA105, interference expression vector is imported in normal japonica rice variety and is spent in 11, such as Fig. 2
It is shown.
The genetic transforming method mediated using Agrobacterium EHA105, overexpression vector is imported in normal rice varieties and spends 11
In.
All transgenic plants are transplanted in the frame with soil after obtaining, and are periodically watered, and fertilising is grown tall about to seedling
When 10cm, Zhong Yu great Tanaka detects overexpression plant, the FP7 primer pair designed for detection is after seedling is grown up
F:GATGTTGGCGACCTCGTATT (Seq ID No:5)；
R:TCGTTATGTTTATCGGCACTTT (Seq ID No:6)；
Positive plant single plant sowing is simultaneously planted, until T2 generation identifies homozygous plants, is obtained under nitrogen use efficiency and yield
The interference plant of drop, as shown in Figure 4.
The measurement of [embodiment 3] transgenic plant phenotype and physical signs
Above-mentioned transgenic plant tiller number is counted, it can be found that 3 strains of the overexpression plant of OsNPF7.3 gene
System becomes more than control tiller number, as shown in Figure 4.Data carry out variable analysis (ANOVA) using SPSS software, use Duncan ' s
Significance difference analysis is carried out in 0.05 level.Different group lowercases (such as a, b, c) indicate significant difference.
Reproduction period by after all plant sowings, by counting to every fringe Secondary branch quantity, shows OsNPF7.3 base
Because expression quantity change can change Rice Panicle Secondary branch quantity really, as shown in figure 5, explanation.Data using SPSS software into
Row variable analysis (ANOVA), uses Duncan ' s to carry out significance difference analysis in 0.05 level.Different group lowercases
(such as a, b, c) indicates significant difference.
Reproduction period, it can be found that the fringe of overexpression 3 strains of plant is elongated, grouting grain number mentioned by after all plant sowings
Height, and the fringe of 3 strains of plant is interfered to shorten, grouting grain number is reduced, as shown in Figure 6.Every fringe grouting grain number is counted,
To show that OsNPF7.3 gene expression amount changes can change the grouting grain number of the every fringe of rice really, thus direct regulation and control rice production
Amount, data carry out variable analysis (ANOVA) using SPSS software, Duncan ' s are used to carry out the significance of difference in 0.05 level
Analysis.Different group lowercases (such as a, b, c) indicate significant difference.
To the grain of rice is obtained after the every fringe paddy husking of above-mentioned plant, protein testing instrument then is utilized with Kjeldahl's method, is surveyed
The total protein content of fixed every fringe rice, it can be found that the total protein content in the overexpression every fringe grain of rice of 3 strains of plant is than control
It significantly improves, and 3 strains of plant is interfered to reduce than control.The change of OsNPF7.3 gene expression can be in the adjusting and controlling rice grain of rice
Protein content, to change the quality of the grain of rice, as shown in Figure 7.Data carry out variable analysis (ANOVA) using SPSS software,
Duncan ' s is used to carry out significance difference analysis in 0.05 level.Different group lowercases (such as a, b, c) indicate difference
Significantly.
The above results show that rice yield and the grain of rice can be improved by the change of expression quantity in OsNPF7.3 gene
Protein content.
Claims (1)
1.OsNPF7.3Application of the gene in raising rice tillering number, every fringe Secondary branch quantity, every fringe grouting grain number, it is special
Sign is, describedOsNPF7.3The amino acid sequence of DNA encoding the protein is as shown in SEQ ID NO.1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610605152.3A CN106222180B (en) | 2016-07-28 | 2016-07-28 | Improve the gene OsNPF7.3 and purposes of rice yield and grain of rice protein content |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610605152.3A CN106222180B (en) | 2016-07-28 | 2016-07-28 | Improve the gene OsNPF7.3 and purposes of rice yield and grain of rice protein content |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106222180A CN106222180A (en) | 2016-12-14 |
| CN106222180B true CN106222180B (en) | 2019-10-29 |
Family
ID=57534212
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610605152.3A Active CN106222180B (en) | 2016-07-28 | 2016-07-28 | Improve the gene OsNPF7.3 and purposes of rice yield and grain of rice protein content |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106222180B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868022B (en) * | 2017-04-13 | 2020-05-29 | 武汉生物工程学院 | Nitrogen transport gene OsNPF2.4b for promoting increase of effective spike number of rice and application thereof |
| CN108794607B (en) * | 2017-04-29 | 2021-09-07 | 华中农业大学 | Yield gene OsAFB6 for regulating and controlling rice flowering period and number of glumes per ear and application |
| CN106947777B (en) * | 2017-05-11 | 2020-05-29 | 武汉生物工程学院 | Application of nitrogen transport gene OsNPF7.4 in rice breeding |
| CN107937433B (en) * | 2017-11-22 | 2020-05-29 | 武汉生物工程学院 | Application of OsNPF8.13 gene in promotion of rice growth under high nitrogen |
| CN108034672B (en) * | 2017-12-19 | 2020-05-29 | 武汉生物工程学院 | Application of nitrate transport gene OsNRT1.9b in rice breeding |
| CN108034661B (en) * | 2017-12-19 | 2020-05-29 | 武汉生物工程学院 | Application of OsNPF8.8b gene in improving rice yield and nutrition quality |
| CN108118062B (en) * | 2017-12-19 | 2020-05-29 | 武汉生物工程学院 | Application of nitrate transport gene OsNRT1.9a in rice breeding |
| CN108070601B (en) * | 2017-12-19 | 2020-07-07 | 武汉生物工程学院 | Application of OsNPF8.6b gene in increasing rice yield |
| CN116143892B (en) * | 2023-03-30 | 2024-01-12 | 沈阳农业大学 | Application of OsGN11 gene in improving rice grain number per ear character |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101027397A (en) * | 2004-04-23 | 2007-08-29 | 西尔斯公司 | Nucleotide sequences and polypeptides encoded thereby useful for modifying nitrogen use efficiency characteristics in plants |
| CN102604962A (en) * | 2011-01-20 | 2012-07-25 | 中国科学院华南植物园 | Gene OsPTR9 capable of improving nitrogen absorption efficiency and yield of rice and application thereof |
-
2016
- 2016-07-28 CN CN201610605152.3A patent/CN106222180B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101027397A (en) * | 2004-04-23 | 2007-08-29 | 西尔斯公司 | Nucleotide sequences and polypeptides encoded thereby useful for modifying nitrogen use efficiency characteristics in plants |
| CN102604962A (en) * | 2011-01-20 | 2012-07-25 | 中国科学院华南植物园 | Gene OsPTR9 capable of improving nitrogen absorption efficiency and yield of rice and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| Over-expression of OsPTR6 in rice increased plant growth at different nitrogen supplies but decreased nitrogen use efficiency at high ammonium supply;Xiaorong Fan et al.;《Plant Science》;20140608;第227卷;摘要，第2-10页 * |
| XM_015778304.1;Genbank;《Genbank》;20160301;全文 * |
| 中国水稻功能基因组研究进展与展望;肖景华 等;《科学通报》;20150522;第60卷(第18期);第1715页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106222180A (en) | 2016-12-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106222180B (en) | Improve the gene OsNPF7.3 and purposes of rice yield and grain of rice protein content | |
| CN106119262B (en) | Improve the gene OsPTR10 and purposes of rice nitrogen use efficiency and yield | |
| CN101679999A (en) | Transgenic plants with increased stress tolerance and yield | |
| CN104450640A (en) | Transgenic Plant With Increased Stress Tolerance And Yield | |
| CN109750047B (en) | Tea tree hexose transporter gene CsSWEET17 and application thereof in regulating and controlling vegetative growth and seed size of plants | |
| CN108034672A (en) | Applications of the nitrate anion transporter gene OsNRT1.9b in rice selection and breeding | |
| CN111172179A (en) | Ubiquitin ligase gene OsNLA2, protein and application thereof in rice breeding | |
| CN117051022A (en) | Wheat TaLAC129 gene and encoding protein and application thereof | |
| WO2015180479A1 (en) | Use of tanac2 protein and encoding gene thereof | |
| CN116218876A (en) | Gene OsB12D3 for regulating rice chalkiness, encoding protein and application thereof | |
| CN109825501B (en) | Long-chain non-coding RNA T5120 from arabidopsis thaliana and application thereof | |
| CN103012574A (en) | Low-phosphor stress response regulatory factor ZmPHR1, gene for coding the protein and application | |
| CN110438134A (en) | Plant leaf blade frizzled related protein OsRoc8 and its encoding gene and application | |
| CN110760539B (en) | Application of tea tree hexose transporter gene CsSWEET1a | |
| CN109371041B (en) | Rice gene OsHGN for increasing grain number per ear and application thereof | |
| CN107988225B (en) | Corn grain development related gene miR169o and application thereof | |
| CN105802931A (en) | CRK4 protein and application of coded gene thereof in regulating and controlling growth of plant stems and leaves | |
| CN115948422A (en) | Plant drought tolerance related gene ZmDnaJ, and amplification primer, recombinant vector and application thereof | |
| CN105505946B (en) | A kind of gene GF14e, albumen and its application improving Pyricularia Oryzae resistance | |
| CN108707594A (en) | 1 gene family of -1 related protein kinase of maize sucrose non-fermented and its application | |
| CN102942623B (en) | AtTAR2 protein and application of AtTAR2 protein coding genes to regulation of plant lateral root growth | |
| CN106636187B (en) | Application of the rice CIPK2 gene in regulation root growth and Nitrogen Absorption | |
| CN105646682B (en) | It is a kind of to utilize relevant paddy gene to Low nitrogen stress and nitrogenOsPIMT2Clone and application | |
| CN116987716B (en) | Expression vector, application of OsSUT1 gene and transgenic rice | |
| CN111454345B (en) | Amino acid transport gene OsATL4 and application thereof in rice breeding |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |