CN108220292B - Rice micromolecule RNAosa-miR171b gene and application thereof in increasing rice yield - Google Patents
Rice micromolecule RNAosa-miR171b gene and application thereof in increasing rice yield Download PDFInfo
- Publication number
- CN108220292B CN108220292B CN201611156326.9A CN201611156326A CN108220292B CN 108220292 B CN108220292 B CN 108220292B CN 201611156326 A CN201611156326 A CN 201611156326A CN 108220292 B CN108220292 B CN 108220292B
- Authority
- CN
- China
- Prior art keywords
- rice
- mir171b
- sequence
- osa
- increased
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a rice small-molecule RNA osa-miR171b and application thereof in regulating rice panicle length and increasing yield. The invention obtains microRNA osa-miR171b from high-throughput sequencing of Nipponbare of rice, and the microRNA is constructed into a precursor gene pre-miR528 sequence. After the microRNA precursor is over-expressed in rice through osa-miR171b, the ears of the over-expression strain are lengthened and the fruiting amount is increased compared with that of a wild type control. Therefore, overexpression of osa-miR171b in rice is of great significance for promoting the increase of rice yield, and a new resource and a research method are provided for high-yield molecular breeding of rice.
Description
The technical field is as follows:
the invention relates to the field of plant genetic engineering, in particular to application of rice micromolecule RNA osa-miR171b in rice.
Background
Small RNA (microRNA) is ubiquitous in animals and plants, and plays an important role in post-transcriptional regulation of target genes thereof, thereby regulating the properties of organisms.
Rice (Oryza sativa L.) is an important food crop, and the successful application of hybrid rice in agricultural production in recent years greatly improves the rice yield, but the rice yield improvement by the hybrid method has certain limit. In order to further improve the yield of the rice, a transgenic method provides a new way.
Disclosure of Invention
The group of the invention finds that the panicle length and the seed setting number can be increased by transgenic over-expression of rice microRNA to improve the rice yield.
On one hand, the mature microRNA of rice with the length of 21nt is obtained through high-throughput sequencing, and is named as osa-miR171b sequence, and the sequence is as follows: 5 'UGAUUGAGCCGUGCCAAUAUC 3' (SEQ ID NO: 1). The sequence of the microRNA and osa-miR171b is used for replacing the sequence of osa-miR528 in the known osa-MIR528 precursor sequence to obtain an artificial miR171b sequence osa-miR171b (SEQ ID NO: 2). After chemically synthesizing the sequence DNA, the DNA fragment was ligated to a binary expression vector pCAMBIA1300UR (FIG. 1). The vector is transformed into EHA105 agrobacterium, and after the microRNA is overexpressed in rice by agrobacterium-mediated genetic transformation, the ears of the overexpression strain are lengthened and more fruits are obtained compared with the wild type of the overexpression strain of the microRNA. Therefore, the overexpression of osa-miR171b in rice can improve the rice yield, and a novel method is provided for high-yield rice molecular breeding.
On the other hand, the invention provides a rice micromolecule RNA osa-miR171b sequence, the nucleotide sequence of the microRNA is shown in SEQ ID NO. 1, and the rice is characterized in that the micromolecule RNA can be used for preparing rice with increased ear length, increased ear number or increased yield by a transgenic water method.
On the other hand, the invention provides a method for preparing rice with increased ear length, increased ear number or increased yield, wherein a gene sequence with a microRNA nucleotide sequence shown as SEQ ID NO. 1 is transferred into the rice.
On the other hand, the invention provides application of a rice micromolecule RNA osa-miR171b sequence in preparation of rice with increased spike length, increased spike knot number or increased yield, wherein the RNA osa-miR171b is a sequence shown in SEQ ID NO. 1.
On the other hand, the invention provides a rice artificial micromolecule RNA osa-miR171b sequence, the nucleotide sequence of the microRNA is shown in SEQ ID NO. 2, and the rice artificial micromolecule RNA is characterized in that rice with increased spike length, increased rice spike real number or increased yield can be prepared by a transgenic method through the micromolecule RNA.
In another aspect, the present invention provides a method for producing rice having an increased panicle length, an increased number of panicle knots or an increased yield, wherein a gene sequence having a nucleotide sequence represented by SEQ ID NO. 2 is transferred into rice.
On the other hand, the invention provides application of the rice artificial micromolecule gene sequence in preparing rice with increased panicle length, increased panicle knot number or increased yield, wherein the gene sequence is a sequence shown as SEQ ID NO. 2.
It is reasonable to those skilled in the art to believe that any method of transgenesis is suitable for the transfer of the gene sequences disclosed herein, and that any rice variety is suitable for the gene of the present invention. The group of the invention finds that different rice varieties or different transgenic methods can show that the diameter of the stem of the strain becomes thicker, the stem wall becomes thicker and the bending resistance is enhanced for successfully transferring the target gene disclosed by the invention although other phenotypes with different properties may exist.
Advantageous effects
The sequence provided by the invention is used for transgenosis to obtain a rice positive plant, so that the ear length of rice is obviously increased, the ear number of the rice is obviously increased, or the yield is increased.
Drawings
FIG. 1 is a schematic structural diagram of the expression vector pCAMBIA1300UR-osa-miR171b of the invention.
FIG. 2 is a Northern blot detection graph of osa-miR171b overexpression transgenic rice positive plant osa-miR171b expression level.
FIG. 3 shows relative expression level of osa-miR171b in positive transgenic rice plants osa-miR171b over-expressed by Real-Time PCR detection of osa-miR171 b.
FIG. 4 shows ears of transgenic rice plants over-expressed by osa-miR171 b.
FIG. 5 is a statistical chart of single ear fruit setting number of osa-miR171b overexpression transgenic rice positive plants
Detailed Description
It should be noted that the specific embodiments of the present invention are only for illustrating how the present invention can be implemented, and such description should not be construed as limiting the present invention in any way. The scope of the invention is indicated in the claims. In order to achieve the object of the present invention, the following description will be made by way of example.
The sequence of osa-miR171b obtained by high-throughput sequencing, the specific sequence information is shown as 5 'UGAUUGAGCCGUGCCAAUAUC 3', (SEQ ID NO: 1), the sequence of the microRNA and osa-miR171b is used for replacing the sequence of osa-miR528 in the known osa-MIR528 precursor sequence to obtain the sequence of osa-miR171b of the artificial miR171b (SEQ ID NO: 2), wherein the underlined part in the sequence 2 is the corresponding sequence formed by replacing the sequence 1, and the replacement is not simple, but the DNA sequence corresponding to the RNA sequence 1TGAT TGAGCCGTGC CAATATCReplacing the osa-MIR528 sequence in the original osa-MIR528 precursor sequence, the italic part being the complement of the DNA sequence corresponding to sequence 1:
then, a new sequence 2 is synthesized by adopting an artificial synthesis mode:
1 GAGCTCTTTG GCTGTAGCAG CAGCAGTGAT TGAGCCGTGC CAATATCCAG
51 GAGATTCAGT TTGAAGCTGG ACTTCACTTT TGCCTCTCTG ATATTGGGGC
101 GGTTCAATCA TTCCTGCTGC TAGGCTGTTC GGATCC(SEQ ID NO：2)。
the sequence is subjected to chemical synthesis to obtain an artificial microRNA osa-miR171b precursor DNA sequence. The DNA was digested with SacI and BamHI and ligated to pCAMBIA1300UR vector, named pCAMBIA1300UR-osa-miR171b (FIG. 1).
Transformation of Agrobacterium
Melting Agrobacterium EHA105 competence preserved at-70 deg.C on ice, sucking 1 μ l pCAMBIA1300UR-osa-miR171b plasmid into 100 μ l competence, mixing, and adding into precooling 1mm electric shock cup; setting voltage to be 2.3kv, capacitance to be 25 muF and resistance to be 200 omega for electric shock conversion; adding 900 μ L LB liquid culture medium, shaking at 28 deg.C and 200rpm for 2h, spreading the bacterial liquid on LB plate containing 50mg/L kanamycin and 50mg/L rifampicin, and culturing at 28 deg.C until forming single colony.
The transgenic rice seedlings are obtained by introducing the agrobacterium-mediated rice genetic transformation into rice, inducing callus of rice seeds, subculture, co-culture, screening and differentiation.
The method comprises the following specific steps:
1. induction of Rice calli
Taking mature Nipponbare paddy seeds, manually shelling, selecting full, smooth and plaque-free seeds, putting the seeds into a 25ml sterile tube, adding 75% alcohol, soaking for 1min, and washing for 3 times in sterile water; adding 30% sodium hypochlorite solution, and soaking for 30 min; pouring out sodium hypochlorite solution, washing the seeds with sterile water for 5 times, and soaking in sterile water for 30 min; the seeds are put on sterile filter paper for suction drying and transferred to an induction culture medium, 6-7 seeds are put in each dish; sealing the culture dish by using a medical adhesive tape, and culturing for about 27 days at the temperature of 27 ℃ and the humidity of 50% in an illumination incubator; the induced callus was picked with tweezers on a clean bench and transferred to a subculture medium, and cultured in an incubator at 27 ℃ under 50% humidity for 7 days.
2. Co-culture of callus with Agrobacterium
Picking single colony of agrobacterium to 5ml LB liquid culture medium (containing Kan 50mg/L and Rif 50mg/L), shake culturing at 28 deg.C and 180rpm to orange yellow; sucking 2ml of bacterial liquid into a 2ml EP tube, centrifuging at 5,000rpm for 5min, and removing supernatant; suspending with appropriate amount of AAM medium, transferring into 100ml sterile triangular flask, and adding 50ml AAM liquid medium. Selecting subcultured callus with good state and yellowish color, transferring into sterile triangular flask, shaking, and standing at room temperature for 30 min. The medium was decanted, the calli were transferred to sterile filter paper to remove excess bacteria, transferred to co-medium and cultured in the dark at 27 ℃ for 2.5 days.
3. Rice callus screening and differentiation
The co-cultured callus was transferred to a selection medium and cultured under illumination at 27 ℃ and 50% humidity. The culture was carried out for 3 cycles in 10 days. The calli, which are bright yellow in color, were picked and transferred to plastic bottles containing approximately 60ml of differentiation medium, 5 per bottle. Culturing at 27 deg.C and humidity of 50% in incubator until seedling is differentiated.
4. Rooting, hardening and transplanting
When the seedling differentiated from the callus grows to about 10cm, pulling out the seedling, removing the culture medium, cutting off the root, inserting the root into a rooting culture medium, and culturing for 5 days. After the roots grow out, the culture medium is washed away, the seeds are cultured in light water at the temperature of 27 ℃ for 5 days, and the seeds are transplanted to paddy fields.
5. Culture medium for rice genetic transformation:
induction medium: large amount of N6, MS-Fe salt, trace amount of B5, organic B5, 2, 4-D2.5 mg/L, proline 2800mg/L, L-glutamine 500mg/L, hydrolyzed casein 300mg/L, inositol 2g/L, sucrose 30g/L, vegetable gel 3.0g/L, pH 5.8
7. Subculture medium: large amount of N6, MS-Fe salt, trace amount of B5, organic B5, 2, 4-D2.0 mg/L, proline 2800mg/L, L-glutamine 500mg/L, hydrolyzed casein 300mg/L, inositol 2g/L, sucrose 30g/L, vegetable gel 3.0g/L, pH 5.8
AAM medium: large amount of AA, MS-Fe salt, trace amount of B5, B5 organic matter, 3.9 g/L2-morpholine ethanesulfonic acid, 500mg/L casein amino acid, 2g/L inositol, 30g/L maltose, pH 5.5, acetosyringone 200 μ M
9. Co-culture medium: large amount of N6, MS-Fe salt, trace amount of B5, organic B5, 500mg/L of hydrolyzed casein, 2g/L of inositol, 30g/L of sucrose, 3.0g/L of plant gel, 3.9g/L of 2-morpholine ethanesulfonic acid, pH value of 5.5, 100 mu M of acetosyringone
10. Selecting a culture medium: large amount of N6, MS-Fe salt, trace amount of B5, organic B5, 2, 4-D2.0 mg/L, proline 500mg/L, glutamine 500mg/L, hydrolyzed casein 300mg/L, inositol 100mg/L, sucrose 30g/L, plant gel 3.0g/L pH 5.8, carbenicillin 250mg/L, hygromycin 50mg/L
11. Differentiation medium: large amount of N6, MS-Fe salt, trace amount of B5, organic B5, 0.5mg/L of naphthylacetic acid, 500mg/L of proline, 500mg/L of glutamine, 300mg/L of hydrolyzed casein, 3mg/L of 6-benzylaminopurine, 100mg/L of inositol, 30g/L of sucrose, 20g/L of sorbitol, 3.0g/L of plant gel, pH 5.8, 250mg/L of carbenicillin, and 50mg/L of hygromycin
12. Rooting culture medium: 1/2N6, MS-Fe salt, B5, sucrose (30 g/L), inositol (100 mg/L), agar (0.8% pH 5.8)
The specific proportion of the culture medium used for rice transgenosis is as follows:
macroelement N6 (20X)
MS iron salt (200X)
Na2.EDTA 7460mg
FeSO4·7H2O 5560mg
Adding water to a constant volume of 1000mL
B5 microelement (100X)
B5 organic (100X)
AA macroelement (10X)
Molecular biological detection of transgenic rice
1) Northern blot analysis
In order to confirm that the transferred artificial microRNA is over-expressed, the Trizol Reagent extracts the total RNA of 3 transgenic positive strains (OE- #1, OE- #2 and OE- #3) respectively, and Northern blot analysis is carried out by using a probe (the sequence is 5 'GATATTGGCACGGCTCAATCA 3' SEQ ID NO: 3). The specific operation flow refers to the DIG High Prime DNA Lebeling and Detection Starter Kit II instruction of Roche. The detection result shows that the expression of the detected over-expression transgenic osa-miR171b is up-regulated (figure 2).
2) Real-Time PCR analysis
In order to confirm the expression level of the transferred artificial microRNA, after the transgenic rice seedlings transplanted to paddy fields are propagated for two generations, Trizol Reagent extracts the total RNA of 3 transgenic positive strains (OE- #1, OE- #2 and OE- #3) respectively, and reverse transcription primers 5' GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACGATATT3' (SEQ ID NO: 4) was reverse-transcribed to obtain cDNA. Upstream primer 5' GCATCGGTGATTGAGCCGTGCC3 ' (SEQ ID NO: 5) and the downstream primer 5 ' GTGCAGGGTCCGAGGT 3 ' (SEQ ID NO: 6) were subjected to real-time PCR to analyze the expression level of osa-miR171b in transgenic rice. The results showed that the expression levels of osa-miR171b in transgenic rice were 30 times, 19 times and 39 times higher than those of control wild-type rice plants, respectively (FIG. 3)
Transgenic rice ear
Transplanting the transgenic rice seedling overexpressed by osa-miR171b after two generations of propagation into a paddy field, and observing the phenotype of the transgenic rice overexpressed by osa-miR171 b. The results show that the osa-miR171b overexpression transgenic rice ears are significantly longer than wild-type rice plants compared with the control, and the average knot number of a single ear is increased by 69% (P <0.01) and is significantly higher than that of the wild-type rice (FIGS. 4 and 5). The fact that the overexpression of osa-miR171b can increase the yield of rice is shown.
Organization Applicant
----------------------
Street :
City :
State :
Country :
PostalCode :
PhoneNumber :
FaxNumber :
EmailAddress :
<110> OrganizationName agricultural scientific college in Zhejiang province
Application Project
-------------------
<120> Title, rice small molecular RNA os-miR171b gene and application thereof in increasing rice yield
<130> AppFileReference :
<140> CurrentAppNumber :
<141> CurrentFilingDate : _ - -
Sequence
--------
<213> OrganismName Rice (Oryza sativa)
<400> PreSequenceString :
ugauugagcc gugccaauau c 21
<212> Type : RNA
<211> Length : 21
Sequence name Rice Small molecule RNA os-miR171b sequence
SequenceDescription :
Sequence
--------
<213> organic name-Artificial Synthesis
<400> PreSequenceString :
gagctctttg gctgtagcag cagcagtgat tgagccgtgc caatatccag gagattcagt 60
ttgaagctgg acttcacttt tgcctctctg atattggggc ggttcaatca ttcctgctgc 120
taggctgttc ggatcc 136
<212> Type : DNA
<211> Length : 136
Sequence name precursor sequence of rice artificial small molecule RNA osa-miR171b
SequenceDescription :
Sequence
--------
<213> organic name-Artificial Synthesis
<400> PreSequenceString :
gatattggca cggctcaatc a 21
<212> Type : DNA
<211> Length : 21
Probe
SequenceDescription :
Sequence
--------
<213> organic name-Artificial Synthesis
<400> PreSequenceString :
gttggctctg gtgcagggtc cgaggtattc gcaccagagc caacgatatt 50
<212> Type : DNA
<211> Length : 50
Sequence name reverse transcription primer
SequenceDescription :
Sequence
--------
<213> organic name-Artificial Synthesis
<400> PreSequenceString :
gcatcggtga ttgagccgtg cc 22
<212> Type : DNA
<211> Length : 22
Sequence name upstream primer
SequenceDescription :
Sequence
--------
<213> organic name-Artificial Synthesis
<400> PreSequenceString :
gtgcagggtc cgaggt 16
<212> Type : DNA
<211> Length : 16
Sequence name downstream primer
SequenceDescription :
Claims (5)
1. A method for preparing rice with increased panicle length and increased panicle knot number comprises the step of transferring a gene sequence with a microRNA nucleotide sequence shown as SEQ ID NO. 1 into the rice.
2. The application of a rice micromolecule RNA osa-miR171b gene sequence in preparation of rice with increased spike length and increased rice spike knot number, wherein the RNA osa-miR171b is a sequence shown in SEQ ID NO. 1.
3. The rice artificial micromolecule RNA osa-miR171b gene is characterized in that the micromolecule RNA can be used for preparing rice with increased spike length and increased rice spike knot real number by a transgenic method, and the sequence of the precursor DNA of the microRNA is shown in SEQ ID NO: 2.
4. A method for preparing rice with increased panicle length, increased panicle number or increased yield, wherein a gene sequence of nucleotide whose precursor DNA sequence is shown in SEQ ID NO. 2 is transferred into rice.
5. The application of the artificial small molecular gene of rice in the preparation of the rice with increased panicle length and increased panicle knot number is disclosed, wherein the precursor DNA sequence of the gene is a sequence shown in SEQ ID NO. 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611156326.9A CN108220292B (en) | 2016-12-14 | 2016-12-14 | Rice micromolecule RNAosa-miR171b gene and application thereof in increasing rice yield |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611156326.9A CN108220292B (en) | 2016-12-14 | 2016-12-14 | Rice micromolecule RNAosa-miR171b gene and application thereof in increasing rice yield |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108220292A CN108220292A (en) | 2018-06-29 |
| CN108220292B true CN108220292B (en) | 2021-07-06 |
Family
ID=62651064
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611156326.9A Active CN108220292B (en) | 2016-12-14 | 2016-12-14 | Rice micromolecule RNAosa-miR171b gene and application thereof in increasing rice yield |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108220292B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102604962A (en) * | 2011-01-20 | 2012-07-25 | 中国科学院华南植物园 | Gene OsPTR9 capable of improving nitrogen absorption efficiency and yield of rice and application thereof |
| WO2015185862A1 (en) * | 2014-06-03 | 2015-12-10 | Universite Toulouse Iii-Paul Sabatier | Use of micropeptides in order to stimulate mycorrhizal symbiosis |
| CN106119262A (en) * | 2016-07-28 | 2016-11-16 | 武汉生物工程学院 | Improve Oryza sativa L. nitrogen use efficiency and the gene OsPTR10 of yield and purposes |
-
2016
- 2016-12-14 CN CN201611156326.9A patent/CN108220292B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102604962A (en) * | 2011-01-20 | 2012-07-25 | 中国科学院华南植物园 | Gene OsPTR9 capable of improving nitrogen absorption efficiency and yield of rice and application thereof |
| WO2015185862A1 (en) * | 2014-06-03 | 2015-12-10 | Universite Toulouse Iii-Paul Sabatier | Use of micropeptides in order to stimulate mycorrhizal symbiosis |
| CN106119262A (en) * | 2016-07-28 | 2016-11-16 | 武汉生物工程学院 | Improve Oryza sativa L. nitrogen use efficiency and the gene OsPTR10 of yield and purposes |
Non-Patent Citations (1)
| Title |
|---|
| Computational Identification of Plant MicroRNAs and Their Targets,Including a Stress-Induced miRNA;Matthew W.Jones-Rhoades等;《Molecular Cell》;20040618;第14卷;附表S4 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108220292A (en) | 2018-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107541520B (en) | OsSAUR11 gene related to rice root development and stress resistance, coding protein and application | |
| CN102485897A (en) | Method for changing petal colors by using cotton gene GbF3H | |
| CN107177610B (en) | Arabidopsis thaliana MPK gene for regulating seed size and method for increasing seed size | |
| CN112779234B (en) | Phyllostachys pubescens PeAPX5 gene and application thereof | |
| CN108893481B (en) | Tomato SlOAS7 gene and application thereof | |
| CN110878302B (en) | Method for knocking out Brassica napus Bna. TT8 gene by using CRISPR/Cas9 system and application | |
| CN108220290B (en) | Application of rice micromolecule RNAosa-miR171b in resisting rice stripe disease | |
| CN117070536A (en) | Application of Arabidopsis HOS1 gene in regulating and controlling leaf senescence | |
| CN109852634B (en) | Method for cultivating high-nodulation nitrogen-fixing transgenic plant | |
| CN109536513B (en) | Chinese cabbage pistil development related gene BrCRF11a and application thereof | |
| CN107557384B (en) | Genetic transformation system for inducing plant dwarfing and construction and application thereof | |
| CN108220292B (en) | Rice micromolecule RNAosa-miR171b gene and application thereof in increasing rice yield | |
| CN113462706B (en) | Gene for increasing tomato fruit weight and ventricular number and regulation and control method thereof | |
| KR20100053456A (en) | A method for producing transformed rice plant removed selection marker | |
| CN104513831B (en) | Method for promoting plant growth | |
| CN108220291B (en) | Rice small molecule RNA osa-miR171b and application thereof in rice lodging resistance | |
| CN110951752B (en) | Application of soybean biological regulation gene | |
| CN109536514B (en) | Chinese cabbage gynoecium development related gene BrCRF6 and application thereof | |
| CN107056907A (en) | The application of NAC062D transcription factor proteins and its encoding gene in germination is suppressed | |
| CN112646815B (en) | Micro RNA molecule and application thereof | |
| CN114214325B (en) | Betula alnoides miR156a precursor gene and application thereof in promotion of plant branching formation | |
| CN116179573B (en) | Application of carrot gibberellin oxidase gene DcGA2ox1 in regulation of plant growth and development | |
| CN116375835B (en) | Application of Yan flower MYB4b protein in regulation and control of plant leaf morphology | |
| KR101174491B1 (en) | Method for increasing transformation efficiency of Chinese cabbage plant using Agrobacterium and Chinese cabbage plant produced by the method | |
| CN115851821B (en) | Application of BBX16 gene in improving plant salt tolerance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |