CN112646815B - Micro RNA molecule and application thereof - Google Patents
Micro RNA molecule and application thereof Download PDFInfo
- Publication number
- CN112646815B CN112646815B CN202011563128.0A CN202011563128A CN112646815B CN 112646815 B CN112646815 B CN 112646815B CN 202011563128 A CN202011563128 A CN 202011563128A CN 112646815 B CN112646815 B CN 112646815B
- Authority
- CN
- China
- Prior art keywords
- mirna
- plant
- pri
- mirna molecule
- primary precursor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8281—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for bacterial resistance
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a micro RNA molecule and application thereof. The nucleotide sequence of the miRNA molecule is shown as SEQ ID NO.1, the nucleotide sequence of the precursor of the miRNA molecule is shown as SEQ ID NO.2, and the nucleotide sequence of the primary precursor of the miRNA molecule is shown as SEQ ID NO. 3. The invention discovers that the miRNA molecule or the precursor (pre-miRNA) or the primary precursor (pri-miRNA) thereof is introduced into a plant body, so that the organs of roots, stems, leaves, flowers, fruits and the like of the plant are enlarged, the transgenic plant grows vigorously, the yield is increased, the disease resistance is improved, and the application prospect in the field of plant breeding is wide.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a micro RNA molecule and application thereof.
Background
Micro RNA molecules (miRNA) are single-stranded non-coding small RNA molecules with the length of about 22 bases, have high conservation in species, and are found in animals, plants, fungi and viruses. mirnas exist in three forms in organisms: primary precursor (pri-miRNA), precursor (pre-miRNA), miRNA. mirnas are encoded by genes in different organisms, and the miRNA genes can be distributed on all chromosomes of the organisms and are often arranged in clusters. The length of the animal miRNA sequences is concentrated in 22 bases, and the length of the plant miRNA sequences is concentrated in 24 bases; animal pre-miRNAs are about 100 bases in length, and plant pre-miRNAs have large length variations of 60-600 bases in length.
Transcription of plant miRNA genes by type II RNA polymerase into pri-miRNA; it is processed in the nucleus to pre-miRNA or mature miRNA; pre-miRNA or mature miRNA is transported to the cytoplasm by transporters on the nuclear membrane; in the cytoplasm, pre-miRNA can be further processed into mature miRNA; the mature miRNA is combined with Ago protein and other related proteins to construct a miRISC silencing complex, and the expression of a target gene is regulated and controlled in a mode of degrading mRNA of the target gene.
The rubber tree is a main source of natural rubber, and 30 miRNAs (microRNAs) and 30 precursors of the rubber tree are found in miRBase (version 22.1, released in 2018 in 10 months); 428 miRNAs of Arabidopsis thaliana, 326 precursors (Kozomara A, birgaoaanu M, griffiths-Jones S. Mirbase: from microRNA sequences to functions. Nucleic Acids Res 201947, D155-D162); the number and function of mirnas in hevea trees remain to be further studied.
Disclosure of Invention
The first purpose of the invention is to provide a miRNA molecule or a precursor (pre-miRNA) or a primary precursor (pri-miRNA) thereof, which can enlarge organs such as roots, stems, leaves, flowers and fruits of plants, enable transgenic plants to grow vigorously, increase yield and improve disease resistance.
The invention introduces a miRNA molecule or its precursor (pre-miRNA) or primary precursor (pri-miRNA) into the plant body, thereby enlarging the organs of plant roots, stems, leaves, flowers, fruits and the like, enabling the transgenic plants to grow vigorously, increasing the yield and improving the disease resistance.
Accordingly, the present invention provides a miRNA molecule or a precursor (pre-miRNA) or primary precursor (pri-miRNA) thereof, said miRNA molecule having a nucleotide sequence as shown in SEQ ID No. 1.
Further, the nucleotide sequence of the precursor of the miRNA molecule is shown as SEQ ID NO. 2.
Further, the nucleotide sequence of the primary precursor of the miRNA molecule is shown as SEQ ID NO. 3.
The second objective of the present invention is to provide the application of the above-mentioned miRNA molecule or its precursor (pre-miRNA) or primary precursor (pri-miRNA) in enhancing plant growth, increasing yield or improving disease resistance, for example, in preparing a preparation for enhancing plant growth, increasing yield or improving disease resistance. The application is specifically that miRNA molecules or precursors or primary precursors thereof are introduced into plants, so that the plants grow vigorously, the yield is increased, or the disease resistance is improved.
Furthermore, the vigorous growth of the plant is to enlarge organs such as roots, stems, leaves, flowers and fruits of the plant.
Further, the disease resistance is against Xanthomonas.
Further, the plant may be hevea brasiliensis or arabidopsis thaliana.
Preferably, the primary precursor pri-miRNA of the miRNA molecule is introduced into the plant, comprising PCR amplification using the following primers:
forward primer sequence: TAGGTACCTTAACCGAATCAAATGCCA;
reverse primer sequence: GAGTCGACTCAAAAGGAAATCCCAAAC.
More preferably, the primary precursor pri-miRNA of the miRNA molecule is introduced into a plant body, and the method comprises the steps of carrying out double enzyme digestion on the gene sequence of the pri-miRNA and SalI through KpnI, and then connecting the gene sequence with a pCAMBIA1300 transgenic vector, wherein T4 DNA ligase is adopted as ligase.
The invention discovers that the miRNA molecule or the precursor (pre-miRNA) or the primary precursor (pri-miRNA) thereof is introduced into a plant body, so that the organs of roots, stems, leaves, flowers, fruits and the like of the plant are enlarged, the transgenic plant grows vigorously, the yield is increased, the disease resistance is improved, and the application prospect in the field of plant breeding is wide.
Drawings
FIG. 1 is a graph of the results of genomic DNA extraction from rubber tree, 1,2 is a sample of two replicate rubber tree leaves; m is a molecular weight tag;
FIG. 2 shows PCR amplification results of novel-pri-m1330-3p genes of rubber trees, with the molecular weight tags on the left and novel-pri-m1330-3p genes on the right;
FIG. 3 shows the sequencing result of T clone of the novel-pri-m1330-3p gene of rubber tree, 1330D: genome sequencing sequence, 1330S-rc: a reverse complementary sequence of a T clone sequencing sequence;
FIG. 4 is a selection of resistant plates of Arabidopsis seedlings transformed with novel-pri-m1330-3p gene of rubber tree;
FIG. 5 shows PCR amplification identification of transgenic Arabidopsis seedlings target gene, M: molecular weight tag, PCR amplification result of novel-pri-m1330-3p genes of rubber trees of 1-10 seedlings, 11: wild-type (Col-0) Arabidopsis thaliana, 12: a p1300 plasmid connected with novel-pri-m1330-3p gene is used as a positive control; the detection of the gene of the internal reference actin is a wild type arabidopsis thaliana leaf DNA template, 13: no template control;
FIG. 6 is a diagram comparing the shapes of wild type and transgenic Arabidopsis plants, and the left is a diagram of the overall shape of the plants transplanted for 30 days; right is organ comparison at the same growth stage, WT: wild-type (Col-0) Arabidopsis thaliana, OE: transgenic rubber tree novel-pri-m1330-3p gene Arabidopsis thaliana;
FIG. 7 is the disease resistant phenotype after inoculation with Xanthomonas DC3000, WT: wild-type (Col-0) Arabidopsis thaliana, OE: transgenic rubber tree novel-pri-m1330-3p gene Arabidopsis thaliana.
Detailed Description
The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These embodiments are merely exemplary. And do not set any limit to the scope of the present invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.
In addition, the experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are commercially available materials unless otherwise specified.
Example 1 rubber Tree genomic DNA extraction
(1) 20mL of 2 xCTAB was added to 800. Mu.L of beta-mercaptoethanol, and the mixture was preheated in a 65 ℃ water bath.
(2) Taking a plurality of tender leaves of the rubber tree, grinding by liquid nitrogen, quickly transferring the ground sample into CTAB, immediately whirling and shaking 30s, and carrying out warm bath in a water bath at 65 ℃ for 15-20min.
(3) According to the following steps: 1 volume of chloroform: isoamyl alcohol (24.
(4) Taking the supernatant, adding sodium acetate and cold absolute ethyl alcohol, and slowly mixing uniformly according to the following proportion: 3mL of supernatant +6mL of ethanol +1mL of sodium acetate.
(5) The centrifuge tube was placed in a-20 ℃ freezer and the DNA was allowed to settle for about 1 hour.
(6) The precipitated centrifuge tube was centrifuged at 10000rpm at 4 ℃ for 10min, and the supernatant was discarded, taking care not to pour the DNA.
(7) Washing with 70% glacial ethanol, and naturally drying.
(8) Add 100. Mu.L of ddH 2 Dissolving O, adding RNA enzyme in water bath at 65 deg.C for 10-15min; water: enzyme =200:1.
(9) Storing at-80 deg.C for use.
The results of the DNA electrophoresis are shown in FIG. 1.
Example 2 PCR amplification of the Gene sequence of rubber Tree pri-mirNanovel-pri-m1330-3p
The novel-pri-m1330-3p gene sequence is taken as the center, 500bp is taken as the pri-miRNA sequence at the upstream and the downstream respectively for primer design (the sequence is shown in table 1), and the primers are synthesized in Huada gene. The genomic DNA of rubber tree leaves is used as a template, rTaq DNA polymerase of TaKaRa is used for PCR amplification, and the reaction system refers to the kit instruction. The reaction program is 95 ℃ and 3min; at 95 ℃ for 30s;56.8 ℃ for 30s; 90s at 70 ℃; beginning with the second step 35 cycles; fully amplifying at 70 ℃ for 10min. The PCR product was stored at-20 ℃ for further use. The amplification effect of PCR product of novel-pri-m1330-3p gene of hevea brasiliensis is shown in FIG. 2.
TABLE 1 PCR amplification primer sequences for novel-pri-m1330-3p genes
Primer name | Primer sequences |
Hb-novel-m1330-cF1(KpnI-260) | TAGGTACCTTAACCGAATCAAATGCCA |
Hb-novel-m1330-cR1(SalI-765) | GAGTCGACTCAAAAGGAAATCCCAAAC |
The PCR reaction system is as follows:
example 3 construction of vector T of novel-pri-m1330-3p Gene sequence of rubber Tree and sequence determination
Recovering PCR product glue of novel-pri-m1330-3p gene of rubber tree according to a glue recovery kit of Tiangen biotechnology company; connecting the gel recovery product with a pGEM-T vector of Promega company, establishing a 10 mu L connection system by referring to the specification of the vector, and connecting overnight at 4 ℃; the ligation product was transformed into E.coli (DH 5a, all-grass King Co.), and positive clones were selected for sequencing and identified by Huada Gene Co, the sequencing results are shown in FIG. 3, the nucleotide sequence of hevea novel-pri-m1330-3p is shown in SEQ ID NO.3, and the sequence in FIG. 3 is the complement of SEQ ID NO. 1.
The linking system is as follows:
the above ligation system was left overnight at 4 ℃.
The plasmid transfection procedure was as follows:
mu.L of the ligation system was added to 33. Mu.L of E.coli DH5a competent cells (all-open gold Co.), gently mixed, subjected to ice bath 30min, heat shock at 42 ℃ for 45s, allowed to stand on ice for 2min, added with 500. Mu.L of LB medium, mixed well, subjected to shake culture at 37 ℃ for 1h, and the shaken bacterial solution was spread on an LB solid plate to which ampicillin was added at a final concentration of 100. Mu.g/mL, and placed in a 37 ℃ incubator overnight for culture.
The positive colony identification process is as follows:
after a single colony grows out, the single colony is selected and dissolved in a PCR reaction system of 20 mu L, and PCR is carried out by using the upstream and downstream primers of the target gene, wherein the PCR reaction system and the flow are the same as the example 2. The colonies, PCR containing the desired bands, were dissolved in 5mL of LB medium (containing ampicillin at a final concentration of 100. Mu.g/mL) and incubated overnight on a shaker at 37 ℃. Extracting plasmid, and measuring the plasmid concentration according to the plasmid extraction and the kit matched instruction operation of Tiangen Biotech Co. The double cleavage was carried out as follows.
The above enzyme digestion system was kept at 37 ℃ for 2h. After completion of the digestion, the mixture was taken out and subjected to electrophoresis using 1.2% agarose gel. And (4) carrying out sequencing verification on the bacterial with the enzyme digestion target band by using Huada gene.
Example 4 construction and identification of transgenic vector of novel-pri-m1330-3p Gene sequence of rubber Tree
Sequencing and identifying the correct rubber tree novel-pri-m1330-3p gene sequence on the pGEM-T vector, and performing double enzyme digestion by KpnI and SalI of Thermoscientific company, wherein the enzyme digestion system and the flow are the same as those in example 3; recovering the enzyme digestion product glue; then, the pCAMBIA1300 transgenic vector was ligated (the ligase was T4 DNA ligase from Takara, the ligation system was ligated overnight at 4 ℃ in accordance with the kit instructions), the ligation product was transformed into E.coli (DH 5a, all-round gold), and positive clones were selected and identified, and the ligation, transformation and identification procedures were the same as those in example 3, thereby obtaining pCAMBIA1300 plasmid ligated with the gene of Novel-pri-m1330-3p of rubber tree.
Example 5 construction of transgenic rubber Tree novel-pri-m1330-3p Gene Arabidopsis thaliana plants
The pCAMBIA1300 plasmid linked with the novel-pri-m1330-3p gene of the rubber tree is transformed into agrobacterium (GV 3101, takara Shuzo Co., ltd.), and a positive colony is selected and identified, wherein the transformation process and the positive colony screening method refer to example 3; carrying out agrobacterium-mediated arabidopsis genetic transformation after carrying out amplification culture on the agrobacterium identified to be positive; allowing the transgenic plant to grow normally, and collecting F1 generation seeds; f1 generation seeds are paved on a resistance plate for resistance screening, and the screening result is shown in figure 4; arabidopsis seedlings growing normally on the resistant plates are transplanted to soil for cultivation, leaves are taken for transgenic detection after the seedlings continue to grow for 3 weeks (see example 2 in the identification process), and the results are shown in FIG. 5.
The flow of agrobacterium-mediated arabidopsis genetic transformation is as follows:
(1) Adding 50 mu L of bacterial liquid (agrobacterium containing pCAMBIA1300 plasmid connected with rubber tree novel-pri-m1330-3p gene) and 100mL of LB into hygromycin with the final concentration of 25 mu g/mL, uniformly mixing, culturing in a shaking table at 28 ℃ until the color of the bacterial liquid is orange red, and then obtaining the bacterial liquid with the highest activity.
(2) The shaken bacterial solution was transferred to a centrifuge tube at 4000rpm for 20min. The supernatant was discarded, and a portion of the mycelia was diluted with 5% sucrose solution to OD =0.8. Silwet (surface adhesive) was added at a rate of 20. Mu. Lsilwet per 100 mL.
(3) Removing fruit pods of arabidopsis seedlings, immersing flower heads (arabidopsis thaliana is in proper age and mainly has no more buds) in a bacterial solution for 30s, then flatly placing the arabidopsis thaliana in a tray, wrapping the arabidopsis thaliana with a preservative film, placing the arabidopsis thaliana in the dark for 24h, then uncovering a cover, and normally culturing. After recovering the seeds from the plants, they were placed in an oven at 37 ℃ for about 2 weeks, left at 4 ℃ for at least 2 days (vernalization), while adding silica gel, and stored at 4 ℃ until use.
The resistance screening process of F1 generation seeds is as follows:
seed disinfection: soaking in 70% ethanol for 1min, soaking in sodium hypochlorite (water: sodium hypochlorite = 4:1) for 15min, and washing with clear water for 5-7 times.
The seed screening method comprises the following steps: 1/2MS culture medium is prepared, hygromycin with the final concentration of 25 mug/mL is added, and the plated seeds are evenly distributed and do not overlap.
And (3) culture observation: and placing the culture dish with the spread seeds in an illumination incubator, illuminating for 16h at 22 ℃, and observing for 8 hours in darkness every 3 days, transplanting the arabidopsis thaliana seedlings which normally sprout and leave leaves, normally culturing, and harvesting the seeds from the individual plants after about 2 months. Repeating the above steps for 3 times to obtain transgenic homozygous Arabidopsis seeds.
Example 6 phenotypic analysis of transgenic rubber Tree novel-pri-m1330-3p Gene Arabidopsis plants
And (3) sowing positive homozygous transgenic rubber tree novel-pri-m1330-3p gene Arabidopsis plants after continuous screening for 3 generations and wild type control at the same time, transplanting and planting, and then performing phenotype analysis.
Growth phenotype analysis: after 3 weeks of transplantation, bolting of wild type Arabidopsis (Col-0) occurred, and bolting of transgenic rubber tree novel-pri-m1330-3p Arabidopsis was late. Compared with wild plants, the transgenic rubber tree novel-pri-m1330-3p arabidopsis plants are stronger, the stems are thicker, and the leaves, flowers, fruits, seeds and the like are all obviously larger, as shown in figure 6.
Analysis of disease resistance: after 3 weeks of transplantation, wild type and transgenic Arabidopsis seedlings were transplanted, simultaneously inoculated with Xanthomonas DC3000 at the same concentration, and 2 days after inoculation, it was found that Arabidopsis transformed with the novel-pri-m1330-3p gene exhibited stronger resistance than the wild type (FIG. 7).
The xanthomonas inoculation process is as follows:
(1) Marking out a single colony of the Xanthomonas DC3000, dipping the bacterial liquid to draw a character 'Zhi' on a plate containing rifampicin, and standing and culturing at 28 ℃ to pick out the single colony.
(2) Shaking bacteria, after single bacteria grow out, picking single bacteria colony in 5mLKB culture medium, adding rifampicin with the final concentration of 25 mug/mL, and placing at 28 ℃ for shaking culture for about 36h.
(3) Collecting thalli, and centrifuging the bacterial liquid at 25 ℃ and 4000rpm for 10min; the supernatant was discarded, and 1mL of 10mM MgCl was added 2 Resuspending the thallus in the solution, centrifuging at 25 ℃ and 4000rpm for 3min, and collecting the thallus; discarding the supernatant, adding 1mL of sterile water, centrifuging at 25 ℃ and 4000rpm for 3min, and collecting thalli; the culture medium was washed 3 times with sterile water to remove soluble impurities.
(4) Adjusting OD600 value to 0.8, adding appropriate amount of sterile water into thallus, mixing, and measuring OD value until OD600 is 0.8. Adding silwet according to the proportion of 1/10000, and mixing evenly after adding.
(5) Spray inoculation: selecting arabidopsis thaliana which grows for about 3 weeks and is consistent in growth vigor and strong in state, uniformly spraying the arabidopsis thaliana by using a spraying pot, and covering a transparent cover for keeping moisture for 2d after spraying. Culturing under normal culture conditions.
Sequence listing
<110> university of Hainan
<120> micro RNA molecule and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> rubber Tree (Hevea brasiliensis)
<400> 1
<210> 2
<211> 107
<212> DNA
<213> rubber Tree (Hevea brasiliensis)
<400> 2
tagcagttgc tgctgttctt aattagagtt gtttgaataa ttgaattttt tttttttaat 60
ttttaatttt attatgcaag tgatgataga atagacaggg acatcag 107
<210> 3
<211> 506
<212> DNA
<213> rubber Tree (Hevea brasiliensis)
<400> 3
tcaaaaggaa atcccaaact attttgcatg ttatcatggt aaagtcacca aaatgcacca 60
ttattcatgt tctggaacag tacaaaccac ataactaata atttggaaag agaaatgata 120
agatatggac aatcttcata agcaaactct tcaaatatga aatataaaat tacgagaaca 180
ggaaaacata tttgagaaca tgtataatgc atcagagaga ttcccattag accaagtcat 240
cattctccaa aggagatgct gatgtccctg tctattctat catcacttgc ataataaaat 300
taaaaattaa aaaaaaaaaa ttcaattatt caaacaactc taattaagaa cagcagcaac 360
tgctacaatc attgaaaaac ctgtgtggtt gcagtgaaaa atgtagaaaa taaaatccga 420
aatccaacac accaataata attagaaacc caataaaaca tgaaaaagag caaactaaat 480
ccaacaatgg catttgattc ggttaa 506
Claims (8)
1. A primary precursor of a miRNA molecule, wherein the nucleotide sequence of the primary precursor of the miRNA molecule is shown in SEQ ID NO. 3.
2. Use of a primary precursor of the miRNA molecule of claim 1 for enhancing plant growth, increasing yield, or improving disease resistance.
3. The use of claim 2, wherein the primary precursor of the miRNA molecule is introduced into the plant to enhance plant growth, increase yield, or improve disease resistance.
4. Use according to claim 3, wherein the introduction of the primary precursor pri-miRNA of the miRNA molecule into the plant comprises PCR amplification using the following primers:
forward primer sequence: TAGGTACCTTAACCGAATCAAATGCCA;
reverse primer sequence: GAGTCGACTCAAAAGGAAATCCCAAAC.
5. The use of claim 3, wherein the primary precursor pri-miRNA of the miRNA molecule is introduced into the plant, comprising the steps of carrying out double enzyme digestion on the gene sequence of the pri-miRNA and SalI through KpnI, and then connecting the gene sequence with the pCAMBIA1300 transgenic vector, wherein the ligase is T4 DNA ligase.
6. The use according to claim 2, wherein said vigorous growth of a plant is an increase in the roots, stems, leaves, flowers, fruits of the plant.
7. The use of claim 2, wherein the disease resistance is against Xanthomonas spp.
8. Use according to claim 2, wherein the plant is rubber tree or Arabidopsis thaliana.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202011563128.0A CN112646815B (en) | 2020-12-25 | 2020-12-25 | Micro RNA molecule and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202011563128.0A CN112646815B (en) | 2020-12-25 | 2020-12-25 | Micro RNA molecule and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112646815A CN112646815A (en) | 2021-04-13 |
CN112646815B true CN112646815B (en) | 2022-12-02 |
Family
ID=75363020
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202011563128.0A Active CN112646815B (en) | 2020-12-25 | 2020-12-25 | Micro RNA molecule and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112646815B (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107446928A (en) * | 2017-09-25 | 2017-12-08 | 南开大学 | One cauliflower allelotaxis regulates and controls miRNA sequence and its application |
-
2020
- 2020-12-25 CN CN202011563128.0A patent/CN112646815B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107446928A (en) * | 2017-09-25 | 2017-12-08 | 南开大学 | One cauliflower allelotaxis regulates and controls miRNA sequence and its application |
Non-Patent Citations (3)
Title |
---|
Identification of novel microRNAs in Hevea brasiliensis and computational predic prediction;Gébelin等;《BMC Plant Biol》;20121231;全文 * |
XR_002491491.1;无;《NCBI:GenBank》;20170719;全文 * |
橡胶树miRNA 探查;冯世鹏;《贵州科学》;20161231;第34卷(第5期);全文 * |
Also Published As
Publication number | Publication date |
---|---|
CN112646815A (en) | 2021-04-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107988236B (en) | Genetic engineering application of oryza sativa auxin transport protein gene OsPIN9 | |
CN111440804A (en) | Application of corn ZmBES1/BZR1-5 gene in cultivation of large-grain plants | |
CN114480431A (en) | Application of corn ZmBES1/BZR1-10 gene in improving drought tolerance and yield of plants | |
CN109423492B (en) | Application of SlTOE1 gene in regulation and control of flowering time and yield of tomatoes | |
CN107012147B (en) | Drought and/or high-salt induction promoter SlWRKY8P from tomato and application thereof | |
CN109735538B (en) | Carrier for improving forest strawberry leaf regeneration efficiency and preparation method and application thereof | |
CN109477091A (en) | Construct and carrier for the conversion of gene implants | |
CN109852634B (en) | Method for cultivating high-nodulation nitrogen-fixing transgenic plant | |
CN109536513B (en) | Chinese cabbage pistil development related gene BrCRF11a and application thereof | |
CN108220290B (en) | Application of rice micromolecule RNAosa-miR171b in resisting rice stripe disease | |
CN112646815B (en) | Micro RNA molecule and application thereof | |
CN108795944B (en) | Cotton long-chain non-coding RNA-lnc973 and application thereof in plant salt tolerance | |
CN111153976A (en) | Rice defense mechanism regulation protein and application thereof in breeding | |
CN102876680A (en) | Soybean-source oleosin gene seed specificity promoter and application thereof | |
CN110373417A (en) | Cotton GhMADS41-A04 gene is promoting the application in flowering of plant | |
KR20100053456A (en) | A method for producing transformed rice plant removed selection marker | |
CN108795927A (en) | The clone of common wheat gene TaSPX3 coded sequences and its application | |
CN104513831B (en) | Method for promoting plant growth | |
Cao et al. | Extremely simplified cut-dip-budding method for genetic transformation and gene editing in Taraxacum kok-saghyz | |
CN109536514B (en) | Chinese cabbage gynoecium development related gene BrCRF6 and application thereof | |
CN108588069B (en) | Precursor gene of mulberry miR171a and application thereof in enhancing salt tolerance of plants | |
CN102199621B (en) | Agrobacterium tumefaciens-mediated peanut efficient transgene method | |
CN106947770B (en) | Kohlrabi gene and application thereof in cultivation of purple mini tomatoes | |
CN110951771A (en) | Application of cymbidium goeringii miR390a in control of plant root system development | |
CN110904110B (en) | Application of OsHAP3C gene expression reduction in rice variety with shortened heading period and prolonged growth period |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |