CN112646815A

CN112646815A - Micro RNA molecule and application thereof

Info

Publication number: CN112646815A
Application number: CN202011563128.0A
Authority: CN
Inventors: 冯世鹏; 郑运天; 刘欢; 周霞; 李慧萍; 牛晓磊
Original assignee: Hainan University
Current assignee: Hainan University
Priority date: 2020-12-25
Filing date: 2020-12-25
Publication date: 2021-04-13
Anticipated expiration: 2040-12-25
Also published as: CN112646815B

Abstract

The invention discloses a micro RNA molecule and application thereof. The nucleotide sequence of the miRNA molecule is shown as SEQ ID NO.1, the nucleotide sequence of the precursor of the miRNA molecule is shown as SEQ ID NO.2, and the nucleotide sequence of the primary precursor of the miRNA molecule is shown as SEQ ID NO. 3. The invention discovers that the miRNA molecule or the precursor (pre-miRNA) or the primary precursor (pri-miRNA) thereof is introduced into a plant body, so that the organs of roots, stems, leaves, flowers, fruits and the like of the plant are enlarged, the transgenic plant grows vigorously, the yield is increased, the disease resistance is improved, and the application prospect in the field of plant breeding is wide.

Description

Micro RNA molecule and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a micro RNA molecule and application thereof.

Background

Micro RNA molecules (miRNA) are single-stranded non-coding small RNA molecules with the length of about 22 bases, have high conservation in species, and are found in animals, plants, fungi and viruses. mirnas exist in three forms in organisms: primary precursor (pri-miRNA), precursor (pre-miRNA), miRNA. mirnas are encoded by genes in different organisms, and the miRNA genes can be distributed on all chromosomes of the organisms and are often arranged in clusters. The length of the animal miRNA sequences is concentrated in 22 bases, and the length of the plant miRNA sequences is concentrated in 24 bases; animal pre-miRNAs are about 100 bases in length, and plant pre-miRNAs have large length variations of 60-600 bases in length.

Transcription of plant miRNA genes by type II RNA polymerase into pri-miRNA; it is processed in the nucleus to pre-miRNA or mature miRNA; pre-miRNA or mature miRNA is transported to the cytoplasm by transporters on the nuclear membrane; in the cytoplasm, pre-miRNA can be further processed into mature miRNA; the mature miRNA is combined with Ago protein and other related proteins to construct a miRISC silencing complex, and the expression of a target gene is regulated and controlled in a mode of degrading mRNA of the target gene.

The rubber tree is a main source of natural rubber, and 30 miRNAs (microRNAs) and 30 precursors of the rubber tree are found in miRBase (version 22.1, released in 2018 in 10 months); 428 miRNAs of Arabidopsis thaliana, 326 precursors (Kozomara A, Birgaoanu M, Griffiths-Jones S. mirbase: from microRNA sequences to functions. nucleic Acids Res 201947: D155-D162); the number and function of mirnas in hevea trees remain to be further studied.

Disclosure of Invention

The first purpose of the invention is to provide a miRNA molecule or a precursor (pre-miRNA) or a primary precursor (pri-miRNA) thereof, which can enlarge organs such as roots, stems, leaves, flowers and fruits of plants, enable transgenic plants to grow vigorously, increase yield and improve disease resistance.

The invention introduces a miRNA molecule or its precursor (pre-miRNA) or primary precursor (pri-miRNA) into the plant body, thereby enlarging the organs of plant roots, stems, leaves, flowers, fruits and the like, enabling the transgenic plants to grow vigorously, increasing the yield and improving the disease resistance.

Accordingly, the present invention provides a miRNA molecule or a precursor (pre-miRNA) or primary precursor (pri-miRNA) thereof, said miRNA molecule having a nucleotide sequence as shown in SEQ ID No. 1.

Further, the nucleotide sequence of the precursor of the miRNA molecule is shown as SEQ ID NO. 2.

Further, the nucleotide sequence of the primary precursor of the miRNA molecule is shown as SEQ ID NO. 3.

The second objective of the present invention is to provide the application of the above-mentioned miRNA molecule or its precursor (pre-miRNA) or primary precursor (pri-miRNA) in enhancing plant growth, increasing yield or improving disease resistance, for example, in preparing a preparation for enhancing plant growth, increasing yield or improving disease resistance. The application is specifically that miRNA molecules or precursors or primary precursors thereof are introduced into plants, so that the plants grow vigorously, the yield is increased, or the disease resistance is improved.

Furthermore, the vigorous growth of the plant is to enlarge organs such as roots, stems, leaves, flowers and fruits of the plant.

Further, the disease resistance is against Xanthomonas.

Further, the plant may be rubber tree or arabidopsis thaliana.

Preferably, the primary precursor pri-miRNA of the miRNA molecule is introduced into the plant, comprising PCR amplification using the following primers:

forward primer sequence: TAGGTACCTTAACCGAATCAAATGCCA, respectively;

reverse primer sequence: GAGTCGACTCAAAAGGAAATCCCAAAC are provided.

More preferably, the primary precursor pri-miRNA of the miRNA molecule is introduced into a plant body, and the method comprises the steps of carrying out double enzyme digestion on the gene sequence of the pri-miRNA and SalI through KpnI, and then connecting the gene sequence with a pCAMBIA1300 transgenic vector, wherein T4 DNA ligase is adopted as the ligase.

The invention discovers that the miRNA molecule or the precursor (pre-miRNA) or the primary precursor (pri-miRNA) thereof is introduced into a plant body, so that the organs of roots, stems, leaves, flowers, fruits and the like of the plant are enlarged, the transgenic plant grows vigorously, the yield is increased, the disease resistance is improved, and the application prospect in the field of plant breeding is wide.

Drawings

FIG. 1 is a diagram showing the result of extraction of genomic DNA from rubber tree, and 1 and 2 are two samples of repeated rubber tree leaves; m is a molecular weight tag;

FIG. 2 shows PCR amplification results of novel-pri-m1330-3p genes of rubber trees, with the molecular weight tags on the left and novel-pri-m1330-3p genes on the right;

FIG. 3 shows the sequencing result of T clone of the novel-pri-m1330-3p gene of rubber tree, 1330D: genome sequencing sequence, 1330S-rc: a reverse complementary sequence of a T clone sequencing sequence;

FIG. 4 is a selection of resistant plates of Arabidopsis seedlings transformed with novel-pri-m1330-3p gene of rubber tree;

FIG. 5 shows PCR amplification identification of transgenic Arabidopsis seedlings target gene, M: molecular weight label, 1-10:10 of PCR amplification result of novel-pri-m1330-3p gene of rubber tree of plant, 11: wild-type (Col-0) Arabidopsis thaliana, 12: a p1300 plasmid connected with novel-pri-m1330-3p gene is used as a positive control; the detection of the gene of the internal reference actin is a wild type arabidopsis thaliana leaf DNA template, 13: no template control;

FIG. 6 is a comparison of the morphology of wild type and transgenic Arabidopsis plants, with the overall morphology of the plants being transplanted for 30 days on the left; right is organ comparison at the same growth stage, WT: wild-type (Col-0) Arabidopsis thaliana, OE: transgenic rubber tree novel-pri-m1330-3p gene Arabidopsis thaliana;

FIG. 7 is the disease resistant phenotype after inoculation with Xanthomonas DC3000, WT: wild-type (Col-0) Arabidopsis thaliana, OE: transgenic rubber tree novel-pri-m1330-3p gene Arabidopsis thaliana.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These embodiments are merely exemplary. And do not set any limit to the scope of the present invention. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

In addition, the experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are commercially available materials unless otherwise specified.

Example 1 rubber Tree genomic DNA extraction

(1) 20mL of 2 × CTAB was added to 800 μ L of β -mercaptoethanol, and placed in a 65 ℃ water bath to preheat.

(2) Taking a plurality of tender leaves of the rubber tree, grinding by liquid nitrogen, quickly transferring the ground sample into CTAB, immediately whirling and shaking for 30s, and carrying out warm bath in a water bath at 65 ℃ for 15-20 min.

(3) According to the following steps: 1 volume of chloroform: isoamyl alcohol (24: 1), slowly mixing, centrifuging at 25 ℃ and 10000rpm for 10 min.

(4) Taking the supernatant, adding sodium acetate and cold absolute ethyl alcohol, and slowly mixing uniformly according to the following proportion: 3mL of supernatant +6mL of ethanol +1mL of sodium acetate.

(5) The centrifuge tube was placed in a-20 ℃ freezer and the DNA was allowed to settle for about 1 hour.

(6) The precipitated tube was centrifuged at 10000rpm at 4 ℃ for 10min, and the supernatant was discarded, taking care not to dump the DNA.

(7) Washing with 70% glacial ethanol, and naturally drying.

(8) Add 100. mu.L of ddH₂Dissolving O, adding RNA enzyme in water bath at 65 deg.C for 10-15 min; water: 200 parts of enzyme: 1.

(9) storing at-80 deg.C for use.

The results of the DNA electrophoresis are shown in FIG. 1.

Example 2 PCR amplification of the Gene sequence of rubber Tree pri-mirNanovel-pri-m1330-3p

The sequence of novel-pri-m1330-3p gene is taken as the center, 500bp is taken as pri-miRNA sequence respectively at the upstream and the downstream for primer design (the sequence is shown in table 1), and the primers are synthesized in Huada gene. The genomic DNA of rubber tree leaves is used as a template, rTaq DNA polymerase of TaKaRa is used for PCR amplification, and the reaction system refers to the kit instruction. The reaction program is 95 ℃ and 3 min; at 95 ℃ for 30 s; 56.8 ℃ for 30 s; 90s at 70 ℃; beginning with the second step 35 cycles; fully amplifying at 70 ℃ for 10 min. The PCR product was stored at-20 ℃ for further use. The amplification effect of PCR product of novel-pri-m1330-3p gene of hevea brasiliensis is shown in FIG. 2.

TABLE 1 PCR amplification primer sequences for novel-pri-m1330-3p gene

Primer name	Primer sequences
		Hb-novel-m1330-cF1(KpnI-260)	TAGGTACCTTAACCGAATCAAATGCCA
Hb-novel-m1330-cR1(SalI-765)	GAGTCGACTCAAAAGGAAATCCCAAAC

The PCR reaction system is as follows:

example 3 construction of vector T of novel-pri-m1330-3p Gene sequence of rubber Tree and sequence determination

Recovering PCR product glue of novel-pri-m1330-3p gene of rubber tree according to a glue recovery kit of Tiangen biotechnology company; connecting the gel recovery product with a pGEM-T vector of Promega company, establishing a 10 mu L connection system by referring to the specification of the vector, and connecting overnight at 4 ℃; the ligation product was transformed into E.coli (DH5a, all-grass Corp.), and positive clones were selected for sequencing and identified by Huada Gene Co, the sequencing results are shown in FIG. 3, the nucleotide sequence of hevea novel-pri-m1330-3p is shown in SEQ ID NO.3, and the sequence in FIG. 3 is the complement of SEQ ID NO. 1.

The linking system is as follows:

the above ligation system was left overnight at 4 ℃.

The plasmid transfection procedure was as follows:

mu.L of the ligation system was added to 33. mu.L of E.coli DH5a competent cells (all-open gold Co.), gently mixed, ice-cooled for 30min, heat shocked at 42 ℃ for 45s, placed on ice for 2min, added with 500. mu.L of LB medium, mixed well, shake-cultured at 37 ℃ for 1h, the shake-cultured broth was spread on an LB solid plate to which ampicillin was added at a final concentration of 100. mu.g/mL, and placed in a 37 ℃ incubator overnight for culture.

The positive colony identification process is as follows:

after a single colony grows out, the single colony is selected and dissolved in a PCR reaction system of 20 mu L, and PCR is carried out by using the upstream and downstream primers of the target gene, wherein the PCR reaction system and the flow are the same as the example 2. The colonies, PCR containing the desired bands, were dissolved in 5mL of LB medium (containing ampicillin at a final concentration of 100. mu.g/mL) and incubated overnight on a shaker at 37 ℃. Extracting plasmid, and measuring the plasmid concentration according to the plasmid extraction and the kit matched instruction operation of Tiangen Biotech Co. The double cleavage was carried out as follows.

The above enzyme digestion system was kept at 37 ℃ for 2 h. After completion of the digestion, the mixture was taken out and subjected to electrophoresis using 1.2% agarose gel. And (4) carrying out sequencing verification on the bacterial with the enzyme digestion target band by using Huada gene.

Example 4 construction and identification of transgenic vector of novel-pri-m1330-3p Gene sequence of rubber Tree

Sequencing and identifying the correct rubber tree novel-pri-m1330-3p gene sequence on the pGEM-T vector, and performing double enzyme digestion by KpnI and SalI of Thermoscientific company, wherein the enzyme digestion system and the flow are the same as those in example 3; recovering the enzyme digestion product glue; then, the pCAMBIA1300 transgenic vector was ligated (the ligase was T4 DNA ligase from Takara, the ligation system was ligated overnight at 4 ℃ in accordance with the kit instructions), the ligation product was transformed into E.coli (DH5a, all-round gold), and positive clones were selected for identification, and the ligation, transformation and identification procedures were the same as those in example 3, to obtain pCAMBIA1300 plasmid ligated with the novel-pri-m1330-3p gene of rubber tree.

Example 5 construction of transgenic rubber Tree novel-pri-m1330-3p Gene Arabidopsis thaliana plants

The pCAMBIA1300 plasmid linked with the novel-pri-m1330-3p gene of the rubber tree is transformed into agrobacterium (GV3101, Takara Shuzo Co., Ltd.), and a positive colony is selected and identified, wherein the transformation process and the positive colony screening method refer to example 3; carrying out agrobacterium-mediated arabidopsis genetic transformation after carrying out amplification culture on the agrobacterium identified to be positive; allowing the transgenic plant to grow normally, and collecting seeds of F1 generation; f1 generation seeds are paved on a resistance plate for resistance screening, and the screening result is shown in figure 4; arabidopsis seedlings growing normally on the resistant plates are transplanted to soil for cultivation, leaves are taken for transgenic detection after the seedlings continue to grow for 3 weeks (see example 2 in the identification process), and the results are shown in FIG. 5.

The flow of agrobacterium-mediated arabidopsis genetic transformation is as follows:

(1) adding 50 mu L of bacterial liquid (agrobacterium containing pCAMBIA1300 plasmid connected with rubber tree novel-pri-m1330-3p gene) +100mL LB into hygromycin with the final concentration of 25 mu g/mL, mixing uniformly, culturing by shaking at 28 ℃ until the bacterial liquid is orange red, and then obtaining the bacterium with the highest activity.

(2) The shaken bacterial solution is transferred to a centrifuge tube at 4000rpm for 20 min. The supernatant was discarded, and a portion of the mycelia was diluted with 5% sucrose solution to an OD of 0.8. Silwet (surface adhesive) was added at a rate of 20. mu.Lsilwet per 100 mL.

(3) Removing fruit pods of arabidopsis seedlings, immersing flower heads (arabidopsis thaliana is in proper age and mainly has no more buds) in a bacterial solution for 30s, then flatly placing the arabidopsis thaliana in a tray, wrapping the arabidopsis thaliana with a preservative film, placing the arabidopsis thaliana in the dark for 24h, then uncovering a cover, and normally culturing. After recovering the seeds from the plants, they were placed in an oven at 37 ℃ for about 2 weeks, left at 4 ℃ for at least 2 days (vernalization), while adding silica gel, and stored at 4 ℃ until use.

The resistance screening process of F1 generation seeds is as follows:

seed disinfection: soaking in 70% ethanol for 1min, soaking in sodium hypochlorite (water: sodium hypochlorite: 4:1) for 15min, and washing with water for 5-7 times.

The seed screening method comprises the following steps: 1/2MS medium was prepared, added to a final concentration of 25. mu.g/mL hygromycin and plated seeds were evenly distributed without overlapping.

And (3) culture observation: placing the culture dish with the spread seeds in an illumination incubator at 22 ℃, illuminating for 16h in the dark for 8 h, observing once every 3 days, transplanting the arabidopsis thaliana seedlings which normally sprout and leave leaves, normally culturing, and collecting seeds from a single plant after about 2 months. The transgenic homozygous Arabidopsis seeds can be obtained by repeating the steps for 3 times.

Example 6 phenotypic analysis of transgenic rubber Tree novel-pri-m1330-3p Gene Arabidopsis plants

And (3) sowing positive homozygous transgenic rubber tree novel-pri-m1330-3p gene Arabidopsis plants after continuous screening for 3 generations and wild type control at the same time, transplanting and planting, and then performing phenotype analysis.

Growth phenotype analysis: after 3 weeks of transplantation, the wild type Arabidopsis (Col-0) showed bolting phenomenon, and the transgenic rubber tree novel-pri-m1330-3p Arabidopsis was bolting late. Compared with wild plants, the transgenic rubber tree novel-pri-m1330-3p arabidopsis plants are stronger, the stems are thicker, and the leaves, flowers, fruits, seeds and the like are all obviously larger, as shown in figure 6.

Analysis of disease resistance: after 3 weeks of transplantation, wild type and transgenic Arabidopsis seedlings were transplanted, simultaneously inoculated with Xanthomonas DC3000 at the same concentration, and 2 days after inoculation, it was found that Arabidopsis transformed with the novel-pri-m1330-3p gene exhibited stronger resistance than the wild type (FIG. 7).

The xanthomonas inoculation process is as follows:

(1) marking out a single colony of the Xanthomonas DC3000, dipping the bacterial liquid to draw a character 'Zhi' on a plate containing rifampicin, and standing and culturing at 28 ℃ to pick out the single colony.

(2) Shaking bacteria, after single bacteria grow out, picking single bacteria colony in 5mLKB culture medium, adding rifampicin with the final concentration of 25 mug/mL, and placing at 28 ℃ for shaking culture for about 36 h.

(3) Collecting thalli, and centrifuging the bacterial liquid at 25 ℃ and 4000rpm for 10 min; the supernatant was discarded and 1mL of 10mM MgCl was added₂Resuspending the thallus in the solution, centrifuging at 25 ℃ and 4000rpm for 3min, and collecting the thallus; discarding the supernatant, adding 1mL of sterile water, centrifuging at 25 ℃ and 4000rpm for 3min, and collecting thalli; the culture medium was washed 3 times with sterile water to remove soluble impurities.

(4) Adjusting OD600 value to 0.8, adding appropriate amount of sterile water into thallus, mixing, and measuring OD value until OD600 is 0.8. Adding silwet according to the proportion of 1/10000, and mixing.

(5) Spray inoculation: selecting arabidopsis thaliana which grows for about 3 weeks and is consistent in growth vigor and strong in state, uniformly spraying the arabidopsis thaliana by using a spraying pot, and covering a transparent cover for keeping moisture for 2d after spraying. Culturing under normal culture conditions.

Sequence listing

<110> university of Hainan

<120> micro RNA molecule and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> rubber Tree (Hevea brasiliensis)

<400> 1

tgcaagtgat gatagaatag aca 23

<210> 2

<211> 107

<212> DNA

<213> rubber Tree (Hevea brasiliensis)

<400> 2

tagcagttgc tgctgttctt aattagagtt gtttgaataa ttgaattttt tttttttaat 60

ttttaatttt attatgcaag tgatgataga atagacaggg acatcag 107

<210> 3

<211> 506

<212> DNA

<213> rubber Tree (Hevea brasiliensis)

<400> 3

tcaaaaggaa atcccaaact attttgcatg ttatcatggt aaagtcacca aaatgcacca 60

ttattcatgt tctggaacag tacaaaccac ataactaata atttggaaag agaaatgata 120

agatatggac aatcttcata agcaaactct tcaaatatga aatataaaat tacgagaaca 180

ggaaaacata tttgagaaca tgtataatgc atcagagaga ttcccattag accaagtcat 240

cattctccaa aggagatgct gatgtccctg tctattctat catcacttgc ataataaaat 300

taaaaattaa aaaaaaaaaa ttcaattatt caaacaactc taattaagaa cagcagcaac 360

tgctacaatc attgaaaaac ctgtgtggtt gcagtgaaaa atgtagaaaa taaaatccga 420

aatccaacac accaataata attagaaacc caataaaaca tgaaaaagag caaactaaat 480

ccaacaatgg catttgattc ggttaa 506

Claims

1. A miRNA molecule, or a precursor or a primary precursor thereof, wherein the nucleotide sequence of the miRNA molecule is set forth in SEQ ID No. 1.

2. A miRNA molecule or a precursor or primary precursor thereof according to claim 1, wherein the nucleotide sequence of the precursor of the miRNA molecule is as shown in SEQ ID No. 2.

3. The miRNA molecule of claim 1, or a precursor or a primary precursor thereof, wherein the nucleotide sequence of the primary precursor of the miRNA molecule is shown in SEQ ID No. 3.

4. Use of a miRNA molecule according to any one of claims 1-3, or a precursor or primary precursor thereof for enhancing plant growth, increasing yield or enhancing disease resistance.

5. The use of claim 4, wherein the miRNA molecule, or a precursor or primary precursor thereof, is introduced into a plant to enhance plant growth, yield, or disease resistance.

6. Use according to claim 5, wherein the introduction of the primary precursor pri-miRNA of the miRNA molecule into the plant comprises PCR amplification using the following primers:

forward primer sequence: TAGGTACCTTAACCGAATCAAATGCCA, respectively;

reverse primer sequence: GAGTCGACTCAAAAGGAAATCCCAAAC are provided.

7. The use of claim 5, wherein the primary precursor pri-miRNA of the miRNA molecule is introduced into the plant, comprising double cleavage of the gene sequence of the pri-miRNA with SalI by KpnI, and ligation with the pCAMBIA1300 transgenic vector, wherein the ligase is T4 DNA ligase.

8. The use of claim 4, wherein said vigorous growth of a plant is an increase in the roots, stems, leaves, flowers, fruits of the plant.

9. The use of claim 4, wherein the disease resistance is against Xanthomonas spp.

10. The use according to claim 4, wherein the plant is rubber tree or Arabidopsis thaliana.