CN102199621B - Agrobacterium tumefaciens-mediated peanut efficient transgene method - Google Patents

Abstract

The invention relates to a plant transgenic technology and in particular relates to an Agrobacterium tumefaciens-mediated peanut transgenic method. The method comprises the following steps: (1) adopting the conventional method to deliver the constructed Ti plasmid vector carrying the target gene into Agrobacterium tumefaciens; (2) using the transformed bacteria to perform shake culture in YEP culture medium; (3) taking 2-6mu l of weight drop bacterial solution to inject in a peanut plant in the suitable period of the growth of peanut to ensure the infection and convertion of Agrobacterium tumefaciens in the peanut plant; (4) taking the sheets of the peanut cotyledon tissue after harvesting seeds, rapidly extracting the DNA of the sample to be tested to use the DNA as the PCR template; and (5) using a specific primer designed according to the target gene sequence to perform PCR identification, and performing electrophoresis detection. In the method, an Agrobacterium tumefaciens-mediated transgenic technology is utilized, thus viable offspring can be obtained conveniently and rapidly and the single tissue culture regeneration stage is not required.

Description

Agrobacterium tumefaciens mediated high-efficient transgenic method of peanuts

Technical field

The present invention relates to plant transgenic technology, relate in particular to a kind of based on Agrobacterium tumefaciens mediated peanut transgenic method.

Background technology

Peanut is one of most important oil crops in the world.The peanut transgenic technology of setting up so far needs the program of plant tissue culture regeneration mostly, thereby it is lower to show stronger genotype dependency and transformation efficiency.The parent material that has Important Economic to be worth may not transform easily.The transgenic technology that lacks a cover highly versatile has become the bottleneck that restricts the research of peanut molecular biology mechanism and Breeding Application research.

International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) directly screens by PCR, has obtained the transgenic peanuts of marker-free, and Spain's type kind JL24 transformation efficiency is more than 75%, but still needs the step of tissue culture.Academy of agricultural sciences, Guangdong Province crop institute beam is dazzled strong team, reported take No. 7, pearl beans type kind Guangdong oil with the plumular axis of cotyledon as explant, by Agrobacterium tumefaciens mediated high-efficiency peanut transformation system, adopt this system can significantly improve the genetic transformation rate, gus gene masculine expression rate is up to 73.3%, but this technology still needs group training step, and exogenous origin gene integrator has no report with the Molecular work of transcribing.We have declared the patent of invention (number of patent application: 201010182543.1) of floral organ injection acquisition transgenic peanuts, the method transformation efficiency is high, and need not the tissue culture regeneration step, but obtain easily the peanut body of foreign gene multi-copy integration, be not suitable for agriculture bacillus mediated genetic transformation.

No matter from the angle of peanut genetic improvement, produce useful products as plant bioreactor or as the angle of gene function analysis instrument from peanut, or from want the angle of functional gene to consider by the insertion mutation separating heavy, all be necessary to set up one overlap agriculture bacillus mediated, high conversion, the genotype dependency is little or without genotype dependency, simple and easy to do peanut transgenic technology.

Summary of the invention

Technique effect of the present invention can overcome defects, and a kind of Agrobacterium tumefaciens mediated high-efficient transgenic method of peanuts is provided, and it remedies the generally deficiency of strong, the complex operation of on the low side, genotype dependency of existing peanut transgenic technology transformation efficiency.

For achieving the above object, the present invention adopts following technical scheme: it comprises the steps:

(1) the Ti-plasmids carrier that carries goal gene that uses ordinary method to have built changes agrobacterium tumefaciens over to;

(2) transform thalline shaking culture in the YEP substratum;

(3) get the resuspended bacterium liquid of 2-6 μ l, inject peanut plant in the suitable phase of peanut growth, make Agrobacterium in peanut plant, infect, transform;

(4) behind the results seed, get the peanut cotylcdon tissue slice, rapid extraction testing sample DNA is as pcr template;

(5) use the Auele Specific Primer according to the goal gene sequences Design to carry out PCR evaluation, electrophoresis detection result.

Technology of the present invention is at the suitable time of peanut plant growth, utilizes the apparatus injury, and Agrobacterium is entered, and infects, transforms, and need not through the tissue culture regeneration stage, obtains transgenic progeny.

Transforming the culture temperature of thalline in the YEP substratum is 25 ℃-30 ℃.Shaking culture is to OD ₆₀₀Value is till 0.1-0.6.The suitable phase of peanut growth is behind the peanut seeding 30-60 days.The position that bacterium liquid injects peanut plant is the over-ground part of peanut plant.As shift NPT II gene, and its Auele Specific Primer can adopt WNPT-2F and WNPT-2R, and wherein the sequence of primer WNPT-2F (5 ' → 3 ', lower same) is ATGACTGGGCACAACAGACAA, and the sequence of primer WNPT-2R is GCAAGGTGAGATGACAGGAGA.

The present invention is by Agrobacterium tumefaciens mediated transgenic technology, but the fast and easy acquisition can be educated the offspring, need not the independent tissue culture regeneration stage.

Description of drawings

Fig. 1 is that PCR detects transgenic line, adopts NPT II gene-specific primer WNPT-2F and WNPT-2R (M:DL2000; P: positive control; N: negative control);

Fig. 2 is that RT-PCR detects the positive transgenic line (M:DL2000 of evaluation PCR; P: positive control; N: negative control).

Embodiment

It comprises the steps: concrete application method of the present invention

(1) the Ti-plasmids carrier that carries goal gene that uses ordinary method to have built changes agrobacterium tumefaciens over to;

(2) transform thalline in the YEP substratum 25 ℃ of-30 ℃ of shaking culture to OD ₆₀₀Value is till 0.1-0.6;

(3) get the resuspended bacterium liquid of 2-6 μ l, behind peanut seeding, injected the over-ground part of peanut plant in 30-60 days, make Agrobacterium in peanut plant, infect, transform;

(4) behind the results seed, get the peanut cotylcdon tissue slice, rapid extraction testing sample DNA is as pcr template; (referring to " the easy rapid DNA extracting method of peanut health tissues and diseased tissues ", number of patent application: 200910255786.0)

(5) use the Auele Specific Primer according to the goal gene sequences Design to carry out PCR evaluation, electrophoresis detection result.

With method of the present invention four peanut varieties (being described in table 1 below) are carried out transgeneic procedure, contain NPT II gene in the purpose fragment of transfer.After the results, adopt direct PCR method to identify transgenic line (as shown in Figure 1) with NPT II Auele Specific Primer, PCR product sequencing result shows, there is no different from NPT II gene order.In four peanut varieties, except four the red transformation efficiencys in many type kind Faku County 2.08%, all the other 3 kinds are all more than 40%, flower was educated No. 20 even up to 86.51% (such as table 1).Large grain type kind and pearl beans type kind are the principal item types that domestic peanut is produced, and many type kind planting ranges are less.The seed of PCR test positive further is RT-PCR identifies, the result proves that NPT II can normal transcription (as shown in Figure 2), and ELI SA detects and confirms can obtain to expect protein product.

Four peanut varieties of table 1 use this method transgenosis effect

Claims (1)

1. an Agrobacterium tumefaciens mediated high-efficient transgenic method of peanuts is characterized in that, comprises the steps:

(1) the Ti-plasmids carrier that carries goal gene that uses ordinary method to have built changes agrobacterium tumefaciens over to;

(2) transform thalline shaking culture in the YEP substratum, culture temperature is 25 ℃-30 ℃, and shaking culture is to OD ₆₀₀Value is till 0.1-0.6;

(3) get the resuspended bacterium liquid of 2-6 μ l, the suitable phase at peanut growth is injected peanut plant, make Agrobacterium infect in peanut plant, transform, the suitable phase of peanut growth is behind the peanut seeding 30-60 days, and the position that bacterium liquid injects peanut plant is the over-ground part of peanut plant;

(4) behind the results seed, get the peanut cotylcdon tissue slice, rapid extraction testing sample DNA is as pcr template;

(5) use the Auele Specific Primer according to the goal gene sequences Design to carry out PCR evaluation, electrophoresis detection result.

Images