CN103789325A - Cotton cell wall extensin gene GbEXPATR and application - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering and particularly relates to cell wall extensin gene GbEXPATR separated and cloned from cotton and application. The cell wall extensin gene GbEXPATR which is obtained through sea island cotton fiber specific expression in a cDNA library at different sea island cotton fiber development stages and lack of a second structural domain, and a nucleotide sequence is represented by SEQ ID NO:1, wherein 52-306 represents a basic group region which is a coding region and exceptionally and efficiently expressed in a sea island cotton fiber elongation period, a conversion period and a secondary wall synthesis initial stage. An obtained overall-length ORF is established on a plant excessive expression vector Pcambia2301M, sea island cotton is converted into upland cotton by using an agrobacterium-mediated transformation genetic transformation method, the quality of transgenic offspring fiber is analyzed, and the cell wall extensin gene GbEXPATR can effectively promote fiber elongation is proved. A Micron-aire reduced. The fiber quality is improved from the grade C2 to the grade B2. The breakage ratio and the strength are improved. The cotton fiber quality can be effectively improved by utilizing the cell wall extensin gene GbEXPATR.

Description

Cotton cells wall extensin gene GbEXPATR and application

Technical field

The invention belongs to plant gene engineering technology field.Be specifically related to a kind of cotton cells wall extensin gene GbEXPATR and application.Utilize the method for reverse genetics, by the analysis to Island Cotton Fiber different development stage cDNA library, find that this gene GbEXPATR lacks second structural domain of cell walls expansion albumen (α-expansin).The GbEXPATR gene of separating clone of the present invention is at the synthetic initial stage predominant expression of Island Cotton Fiber elongating stage, transition period and secondary wall.In cotton body this gene of overexpression can effectively promote fiber elongation, mic value reduction and make fiber rise to B2 level from C2 level, strength raises.Utilize effectively improving cotton fiber quality of the present invention.

Background technology

Cotton is one of most important cash crop in the world, and for textile industry provides topmost natural fiber, its quality quality is directly connected to the height of textile product quality, class.Cotton fiber is the unicellular epidermal hair being differentiated by ovule exocuticle, and ripe fibrocyte length is generally 30-40mm, and thickness is 15 μ m(Qin, Y.M.; Zhu, Y.X., How cotton fibers elongate:a tale of linear cell-growth mode.Current opinion in plant biology2011,14 (1), 106-11.).The growth of fiber is divided into the process (Haigler that initial (Initiation), elongation (Elongation), conversion (Transition), secondary wall synthetic (Secondary cell wall biosynthesis) and ripe (Maturation) five of dehydration overlap each other, C.H. etc., Cotton fiber:a powerful single-cell model for cell wall and cellulose research.Frontiers in Plant Science2012,3.).Cell walls plays an important role in Fibre Development process, when extending primary wall to be synthesized to secondary wall when thickening cellulosic synthetic, the conversion of this cell walls character has determined the quality (length, intensity, ripening degree) of fiber.In recent years, along with the fast development of information biology, RNA, DNA sequencing technology perfect gradually, different Fibre Development cell walls in period genes involveds are excavated out in a large number, by transgenic technology, the function of these genes is verified, find that they have affected the quality of fiber: after the xyloglucan inscribe transferase gene GhXTH overexpression that elongate fiber phase a large amount is expressed, transgenic line fiber-length increased compared with the control 15-20%, and strength and mic value do not change (Lee, J. etc., Xyloglucan endotransglycosylase/hydrolase genes in cotton and their role in fiber elongation.Planta2010, 232 (5), 1191-205.).GhPEL is the pectin lyase that a 10DPA fiber a large amount is expressed, it can reduce the content of de-esterified pectin, by after this gene inhibition, the transgenic line staple length 16%(Wang that declined, H. etc., The essential role of GhPEL gene, encoding a pectate lyase, in cell wall loosening by depolymerization of the de-esterified pectin during fiber elongation in cotton.Plant molecular biology2010,72 (4-5), 397-406.).Sucrose synthase can generate fructose and UDPG for catalysis sucrose, and UDPG is the synthetic important substrate of Mierocrystalline cellulose, length, the strength increase of fiber will can be made after GhSusA1 overexpression, and improve the biomass (Jiang of seedling, Y. etc., Overexpression of GhSusA1increases plant biomass and improves cotton fiber yield and quality.Plant Biotechnology Journal2012,10 (3), 301-312.).

Find cell walls expansion albumen from McQueen-Mason in 1992--expansin is the existing vicennial time till now, it be considered to a kind of under acidic conditions inducing cell wall there is the cell wall protein of irreversible stretching, extension.Typical cell walls expansion albumen expansin is made up of 250-275 amino acid, comprise the signal peptide (20-30 amino acid) of a N end, two structural domain domain1(120-135 amino acid) and domain2(90-120 amino acid) (Cosgrove, D.J., Loosening of plant cell walls by expansins.Nature 2000,407 (6802), 321-326.).Evolutionary analysis by sequence is found, in plant, there are four expansin family: α-expansin (EXPA), β-expansin (EXPB), expansin-like A (EXLA) and expansin-like B (EXLB).α-expansin is present in dicotyledons, and β-expansin only exists grass.α-expansin and β-expansin have been proved the activity with Cell wall loosening, and the function of expansin-like A and expansin-like B (Cosgrove, J.S.a.D.J., The expansin superfamily.2005.) also under study for action.Bioinformatic analysis shows, in grass, exist one group only with the secretory protein of second structural domain of expansin (domain2) homology, in immunology, be divided into second group of pollen hypersensitivity source G2As(grass group-2pollen allergens of Gramineae).They may be to be evolved by β-expansin, reach 35-45%, but its biological function are not clear with the similarity of β-expansin.Also have two classes and first structural domain similarity of expansin to reach the vegetable-protein of 25-35%: p12 and plant urine sodium peptide (PNP, plant natriuretic peptide), what they were a large amount of is present in the oranges and tangerines xylem of suffering from verticillium, has semiotic function and does not possess the activity of Cell wall loosening.Class Barwin albumen is the member of antifungal protein PR4 family, only has 20-30% with the similarity of expansin.

Cell walls expansion albumen expansin is for example present in, in different tissue and organ: between hypocotyl, the tip of a root, internode, stem, root hair, flower and mellow fruit, participated in the growth of many plants, growth, breeding and to processes such as stress responses.Overexpression PhEXPA1 can increase the size of cell, affect the merismatic formation (Zenoni of cell wall constituent and axil, S. etc., Overexpression of PhEXPA1 increases cell size, modifies cell wall polymer composition and affects the timing of axillary meristem development in Petunia hybrida.New Phytologist2011.), lower the formation (Noh that IbEXP1 can strengthen sweet potato storage root, S.A. etc., Down-regulation of the IbEXP1gene enhanced storage root development in sweetpotato.Journal of Experimental Botany2012.), CiEXPA1 and the CiEXPA2 of the enrichment of overexpression form layers in tobacco, can affect growing of plant, and increase the content of cellulose (Wang of stem stalk cell walls, G. etc., Overexpression of two cambium-abundant Chinese fir (Cunninghamia lanceolata) α-expansin genes ClEXPA1and ClEXPA2affect growth and development in transgenic tobacco and increase the amount of cellulose in stem cell walls.Plant Biotechnology Journal2011, 9 (4), 486-502.).

Summary of the invention

The object of the invention is to overcome the deficiencies in the prior art, a kind of GbEXPATR gene and application of the cotton cells wall extensin (α-expansin) that lacks second structural domain are provided.The present invention can adopt the GbEXPATR gene of having cloned to make probe, and from cDNA and genomic library, screening obtains gene of the present invention or homologous gene; Also can adopt PCR(polymerase chain reaction) method, from genome, mRNA and cDNA, amplification obtains GbEXPATR gene of the present invention and any interested section of DNA or the section of DNA molecule with its homology.Adopt above technology, can separate and obtain the sequence that comprises GbEXPATR gene, conversion of plant after this sequence is connected with any carrier that can guide foreign gene to express in plant, can obtain the higher transfer-gen plant of maturation protein α-expansin content; And using a part of sequence of this sequence as target build can in plant materials, produce RNA interference vector conversion of plant, can obtain maturation protein α-expansin content reduce plant.Gene of the present invention, in the time being building up in plant expression vector, can add any strong promoter, specific promoter or inducible promoter before its transcription initiation Nucleotide.Gene of the present invention, in the time being building up in plant expression vector, also can use enhanser, and these enhanser regions can be ATG initiator codon and neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to guarantee the translation of whole sequence.

Another object of the present invention is to be to provide a kind of cotton α-expansin gene GbEXPATR that lacks second structural domain in the application promoting in cotton fiber cell elongation, mic value reduction, strength rising.Applicant (sees sequence table SEQ ID NO:2 by the ORF region of the GbEXPATR gene obtaining, sequence length is 567bp) build overexpression, by genetic transformation overexpression in cotton plants of Agrobacterium, utilize the methods such as the hybridization such as RT-PCR, Southern to filter out after the low copy transgenic line that expression amount is high, find that this gene of overexpression can effectively promote the growth of cotton fiber, thereby caused the length of mature fibers to increase by 7% left and right; Mic value reduces by 6% left and right, and (according to the size of mic value, cotton fiber is divided into following grade: A level: scope is 3.7-4.2 to make fiber be raised to B2 level from C2 level; B1 level: scope is 3.5-3.6; B2 level: scope is 4.3-4.9; C1 level: scope is below 3.4; C2 level: scope be 5.0 and more than.Wherein, A level optimum, B1, B2 take second place, C1, C2 are the poorest); Strength improves 6% left and right, further realizes the object of improving cotton fiber quality.

In order to realize above-mentioned object, the present invention by the following technical solutions:

In order to obtain a kind of cotton cells wall extensin (α-expansin) GbEXPATR gene that lacks second structural domain, we have adopted following separation method, and concrete steps are as follows:

In the previous work of the State Key Laboratory of Crop Genetic Improvent at applicant place, grow and different times cDNA library, isolate one and see SEQ ID NO:1 with the higher cDNA(sequence of other plant α-expansin DNA homolog degree from Island Cotton Fiber), bioinformatic analysis shows, this cDNA comprises a complete ORF(and sees SEQ ID NO:2), can translate α-expansin albumen (SEQ ID NO:3) that lacks second structural domain by known this ORF of Bioinformatics Prediction, applicant is by its called after GbEXPATR gene.This gene is at elongate fiber, conversion, secondary wall synthesis phase high efficient expression, from sea island cotton kind 3-79, extract the total RNA(extracting method of 10DPA fiber with reference to An improved simple protocol for isolation of high quality RNA from Gossypium spp.suitable for cDNA library construction.Acta Agronomica Sinica.2005 such as Zhu, 31.1657-1659 the method for report), utilize ThermoScript II Superscript III (purchased from Invitrogen company) by synthetic its reverse transcription cDNA, reaction conditions is: 65 ℃ of 5min, 50 ℃ of 60min, 70 ℃ of 10min.Use primer GbEXPATR(5 ' ATGGCAACCAAAACGATGATGT3 ') and GbEXPATR(5 ' CATAAATATCATGCACCTCCCAC3 ') amplify the total length ORF(567bp of GbEXPATR gene).PCR reaction conditions is: 94 ℃ of denaturation 3min; 94 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 30sec, 32 circulations; 72 ℃ are extended 10min.The PCR product that amplification is obtained is connected into pGEM-T carrier (purchased from Promega company), and screening positive clone order-checking, obtain required full length gene ORF.Result shows: this gene is to grow from Island Cotton Fiber the full length sequence being isolated and cloned into different times cDNA library, the cDNA sequence of this gene is the nucleotide sequence shown in SEQ ID NO:1, the sequence of the ORF of this gene is SEQ ID NO:3, or the sequence of at least 50% homology, and the albumen of above-mentioned DNA fragmentation coding: corresponding albumen after this gene translation, for the sequence of the protein shown in SEQ ID NO:3.The present invention clone's gene GbEXPATR gene is grown in different times and is all had a certain amount of expression at Island Cotton Fiber, expression amount in the fiber of elongating stage is relatively high, along with the growth expression amount of fiber declines, but do not express in root, stem, leaf, petal, flower pesticide and column cap.

According to above-mentioned GbEXPATR cDNA design overexpression primer, add respectively restriction enzyme site and the protection base of NcoI and BstE II at primer two ends, we are respectively by this primer called after primer GbEXPATRPoef and GbEXPATRPoer, carry out pcr amplification take the cDNA of GbEXPATR gene as template again, the method that the PCR product obtaining is cut connection by enzyme is connected into the pCAMBIA2301 with same enzyme digestion ^m(pCAMBIA2301 on carrier ^mthe precursor of carrier is the pCAMBIA2301 being so kind as to give by Australian CAMBIA laboratory Center for the Application of Molecular Biology to International Agriculture, mediate sudden change method and remove the Nco I of the NPT II upstream of carrier pCAMBIA2301 by PCR, two restriction enzyme site transformations of Bgl II form, can directly be provided by patent inventor Zhang Xianlong), structure obtains a kind of Overexpression vector p35S::GbEXPATR, the expression vector that described Overexpression vector p35S::GbEXPATR contains nucleotide fragments shown in SEQ ID NO:1 or SEQ ID N0:3, a kind of Overexpression vector p35S::GbEXPATR, described expression vector is plant expression vector pCAMBIA2301 ^m.After it expresses translation, formation contains aminoacid sequence corresponding to sequence shown in SEQ ID N0:2.

During above-mentioned clone's gene GbEXPATR extends at promotion cotton fiber cell, mic value reduces, strength raises, by the time apply, the detailed process of its application is:

The carrier conversion agrobacterium strains LBA4404(State Key Laboratory of Crop Genetic Improvent paddy rice group woods of structure is supported the army and provided), again by agriculture bacillus mediated method for transformation converting cotton, the transformation receptor material adopting is strange auspicious being so kind as to give of YZ-1(Inst. of Plant Protection, Henan Prov. Academy of Agricultural Sciences horse), the method of agriculture bacillus mediated converting cotton is with reference to document (the Identification of a novel elite genotype in vitro culture and genetic transformation of cotton.Biologia Plantarum of Jin etc., 2006, 50:519-524).Efficient Conversion system (An efficient grafting system for transgenic plant recovery in cotton (Gossypium hirsutum L.) the .Plant Cell that method for transformation and program are set up with reference to Jin etc., Tissue and Organ Culture, 85:181-185,2006).

GbEXPATR gene overexpression transgenic lines obtains 3 familys that expression amount is higher.Transgenic line is extracted to genomic dna, analyze by Southern blot, identify its genetically modified effect and copy number.Press individual plant and extract the total RNA of transgenic line, at least three biology of each strain repeat, and carry out expression analysis by Realtime PCR, and Realtime-PCR method is with embodiment 2.

By the large capacity fiber of HFT9000 tester, mature fibers length, mic value, strength are measured, three strain OE2, OE3 of transgenosis overexpression and the phenomenal growth of the mature fibers length of OE4 contrast wild-type 1.6-2.1 millimeter; The mic value 0.23-0.38 that declined, makes fiber rise to B2 level from C2 level; The strength 1-1.73cN/tex that raise.

Advantage of the present invention:

(1) grow by Island Cotton Fiber the cell walls expansion Protein G bEXPATR gene that obtains lacking second structural domain in different times cDNA library, method of the present invention is efficient, and accuracy is high.

(2) can be by using Ti-plasmids by the expression vector carrier that carries GbEXPATR gene of the present invention, plant viral vector, directly delivered DNA, microinjection, the conventional biotechnological means such as electroporation imports vegetable cell (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp.411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).

(3) by transgenosis, GbEXPATR gene has been carried out to functional verification, confirm that the high efficient expression of this gene can significantly improve the expression amount of GbEXPATR in cotton fiber, thereby further promote the elongation of cotton fiber cell, the reduction of mic value, the rising of strength, for theoretical basis has been created in cotton fiber quality improvement.

(4) can use the host who transforms including the expression vector of GbEXPATR gene of the present invention to comprise various plants cotton, promote the elongation of cell; Can use the overexpression carrier of the connection 35S efficient promoter that comprises that GbEXPATR gene fragment of the present invention is target to transform host cotton, can be used for cultivating more long stapled cotton variety.

Accompanying drawing explanation

Sequence table SEQ ID NO:1 grows different times cDNA library and isolates a cDNA sequence higher with other plant α-expansin DNA homolog degree from Island Cotton Fiber, sequence total length is 820bp, wherein the section at the 52-306bp place of this sequence is the coding region of this gene, its 85 amino acid of encoding.

Sequence table SEQ ID NO:2 is the sequence of the protein of above-mentioned GbEXPATR gene fragment coding region.

Sequence table SEQ ID NO:3 is cotton α-expansin gene fragment that isolated complete ORF(lacks second structural domain from the cDNA sequence described in above-mentioned SEQ ID NO:1), sequence length is 567bp.Sequence 1 comprises sequence SEQ ID NO:3.

Fig. 1: adopt the analytical results of ClustalW software (openly using software) to GbEXPATR gene order.

Result shows: (AF512539 compared with 6 α-expansin genes of upland cotton, AF512540, AF512541, AF512542, AF512543 and AF512544), the aminoacid sequence of GbEXPATR gene is guarded completely at α-expansin signal peptide of N end and 6-8 cysteine residues and HFD primitive (His-Phe-Aap).

Fig. 2: utilize Real-time PCR method to detect the expression level of GbEXPATR gene in cotton different tissues.In figure, show:

GbEXPATR gene only has expression in sea island cotton 3-79 Fibre Development different times, in upland cotton TM-1, does not express.Expression amount in the fiber of elongating stage is relatively high, and along with the growth expression amount of fiber declines, but do not express at root, stem, leaf, petal, flower pesticide, column cap.Choose 24 organizing is respectively sea island cotton 3-79 and upland cotton TM-1: 1. piece; 2. stem; 3. leaf; 4. petal; 5. flower pesticide; 6. column cap; 7.0DPA ovule; 8.5DPA fiber; 9.10DPA fiber; 10.15DPA fiber; 11.20DPA fiber; 12.25DPA fiber (DPA:day post anthesis bloom after number of days).

Fig. 3: be original plasmid and the improved plasmid figure that the present invention utilizes.Wherein: Fig. 3 A is the original plasmid figure of plasmid pCAMBIA2301, Fig. 3 B is the overexpression carrier pCAMBIA2301m plasmid figure used that the present invention builds, and Fig. 3 C is the Overexpression vector p35S::GbEXPATR figure that the present invention builds.

Fig. 4: GbEXPATR transgene cotton Southern hybridization check result.In figure: OE is overexpression strain, wherein OE2 is two copies, and OE3 and OE4 are single copy.

Fig. 5: the result of by Realtime-PCR method, being carried out expression analysis GbEXPATR transgene cotton T4 generation.

The fiber of getting 10DPA, 15DPA, 20DPA extracts total RNA GbEXPATR transgenic progeny is carried out to expression analysis.By Realtime-PCR, GbEXPATR transgenic progeny is carried out to expression analysis, result shows that the expression amount in OE2, OE3 and tri-strains of OE4 significantly improves.

Fig. 6: GbEXPATR transgene cotton picture, GbEXPATR can promote that fiber is elongated.

Below in conjunction with drawings and Examples, the invention will be further described.

Embodiment

Embodiment 1:GbEXPATR gene isolation clone and at the expression characterization of cotton different tissues

In the previous work of applicant's crop genetic improvement National Key Laboratory, grow different times cDNA library (Tu, L.L. from the Island Cotton Fiber of setting up, Deng Genes expression analyses of sea-island cotton (Gossypium barbadense L.) during fiber development.Plant cell reports2007, 26 (8), the cDNA(that isolates one 1309-1320.) with upland cotton cell walls expansion protein alpha-expansin gene (the gene number of logging in: AF043284) height homology but lack second structural domain is shown in SEQ ID NO:1), bioinformatic analysis shows, this cDNA comprises a complete ORF(and sees SEQ ID NO:3), can translate incomplete α-expansin albumen (aminoacid sequence of the protein of its coding is shown in SEQ ID NO:2) by known this ORF of Bioinformatics Prediction, we are by this fragment called after GbEXPATR gene.This gene, at elongate fiber high efficient expression in each period, extracts the method for the total RNA(extracting method of 10DPA fiber with reference to reports such as Zhu: Zhu etc. from sea island cotton kind 3-79.An improved simple protocol for isolation of high quality RNA from Gossypium spp.suitable for cDNA library construction.Acta Agronomica Sinica.2005,31.1657-1659.), utilize ThermoScript II Superscript III (purchased from Invitrogen company) by synthetic its reverse transcription cDNA, reaction conditions is: 65 ℃ of 5min, 50 ℃ of 60min, 70 ℃ of 10min.Use primer GbEXPATR(5 ' ATGGCAACCAAAACGATGATGT3 ') and GbEXPATR(5 ' CATAAATATCATGCACCTCCCAC3 ') amplify the total length ORF(567bp of GbEXPATR gene).PCR reaction conditions is: 94 ℃ of denaturation 3min; 94 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 30sec, 32 circulations; 72 ℃ are extended 10min.The PCR product that amplification is obtained is connected into pGEM-T carrier (purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd, the i.e. soleagent of U.S. Promega company), and screening positive clone order-checking, obtain required full length gene ORF.Result shows: this gene is to grow from Island Cotton Fiber the full length sequence being isolated and cloned into different times cDNA library, the cDNA sequence of this gene is as shown in SEQ ID NO:1, the encoder block that wherein section at 52-306bp place is this gene is that ORF(is shown in aminoacid sequence corresponding shown in SEQ ID NO:1,85 amino acid of encoding), the sequence of the protein of this genes encoding is shown in shown in SEQ ID NO:3.

Embodiment 2: the structure of overexpression carrier and conversion

In order to verify the function of GbEXPATR gene in cotton, applicant has built overexpression carrier and has carried out converting cotton.

According to ORF region (seeing the region that in SEQ ID NO:1,52-306 base pair is answered) the design overexpression primer pair (DNA sequence dna of this primer pair is shown in the description after this section) that obtains GbEXPATR cDNA in embodiment 1; we add respectively restriction enzyme site and the protection base of NcoI and BstE II at primer pair two ends; respectively by this primer pair called after primer GbEXPATRPoef and GbEXPATRPoer; carry out pcr amplification take the cDNA of GbEXPATR gene as template again, the method that the PCR product obtaining is cut connection by enzyme is connected into the pCAMBIA2301 with same enzyme digestion ^m(pCAMBIA2301 on carrier ^mthe precursor of carrier is the pCAMBIA2301 being so kind as to give by Australian CAMBIA laboratory Center for the Application of Molecular Biology to International Agriculture, mediates sudden change method remove two restriction enzyme sites of Nco I, Bgl II transformation of the NPT II upstream of carrier pCAMBIA2301 and form (pCAMBIA2301 by PCR ^mcarrier figure is shown in Fig. 3 B), build and obtain an Overexpression vector p35S::GbEXPATR(and see Fig. 3 C): pCAMBIA2301 replaced by the gene fragment of GbEXPATR ^mgus Second Exon fragment in carrier.The expression vector that overexpression carrier p35S::GbEXPATR contains one of them nucleotide fragments shown in SEQ ID NO:2, it forms the sequence that contains SEQ ID NO:2 after expressing translation.Fig. 3 C is shown in by the collection of illustrative plates of the overexpression carrier p35S::GbEXPATR that the present invention builds.

The DNA sequence dna of above-mentioned primer pair is as follows:

GbEXPATRPoef:5'gcgtCCATGGCAACCAAAACGATGATGT3'；

GbEXPATRPoer:5'gtcGGTCACCCATAAATATCATGCACCTCCCAC3'。

The carrier building is transformed to agrobacterium strains LBA4404, again by agriculture bacillus mediated method for transformation converting cotton, the transformation receptor material adopting is cotton YZ-1, this material is the material (Jin etc. that of a large amount of screening discovery of cotton seminar of the crop genetic improvement National Key Laboratory process at the applicant place has very high embryo's generating ability, Identification of a novel elite genotype in vitro culture and genetic transformation of cotton.Biologia Plantarum, 200650 (4): 519-524), the method of agriculture bacillus mediated converting cotton is with reference to document (the Identification of a novel elite genotype in vitro culture and genetic transformation of cotton.Biologia Plantarum of Jin etc., 2006, 50:519-524).Efficient Conversion system (An efficient grafting system for transgenic plant recovery in cotton (Gossypium hirsutum L.) the .Plant Cell that method for transformation and program are set up with reference to Jin etc., Tissue and Organ Culture, 85:181-185,2006), and done corresponding adjustment and modification, concrete grammar and flow process are as follows:

1, the cultivation of aseptic seedling

By upland cotton YZ-1) cotton seed hulls removes, and first uses 0.1% mercuric chloride solution sterilizing ten minutes, and aseptic water washing three times, is inoculated on Aseptic seedling culture base and (fills a prescription as follows: 2/1MS macroelement+glucose 15g.L ^-1+ vegetable jelly phytagel2.5g.L ^-1), the pH to 7.0 of adjustment substratum before sterilizing, sterilizing 30min under the high pressure steam of 121 ℃, is placed in postvaccinal culture vessel in culturing room, 28 ℃, secretly cultivates 3-6 days.

2.. the activation of Agrobacterium and preservation

2..1 the preparation of substratum and associated materials:

Agrobacterium LBA4404; Preparation is containing kantlex 50mg.L ^-1the MGL liquid nutrient medium (formula of substratum: tryptone 5g/L, sodium-chlor 5g.L ^-1, MgSO4.7H2O0.1g.L ^-1, KH2PO40.25g.L ^-1, N.F,USP MANNITOL 5g.L ^-1, glycine 1.0g.L ^-1, to 1L, before sterilizing, adjust the pH to 7.0 of substratum with distilled water supplemental medium); The triangular flask of sterilizing; LB substratum (solid, liquid) (formula: tryptone 10g/L+ yeast extract 5g/L+ sodium-chlor 5g/L+ agar powder 15g/L, the pH to 7.0 of adjustment substratum before sterilizing, sterilizing under the high pressure steam of 121 ℃; Kantlex 50mg.L ^-1; Sterile glycerol; Rifle head; 5mL centrifuge tube.Postvaccinal culture vessel is placed in culturing room.

2..2 operation:

2..2..1 activation, suspends:

Melting on ice from the glycerine pipe that takes out the agrobacterium strains LBA4404 with overexpression vector preserving in Ultralow Temperature Freezer, on LB plate, rule, 26.5 ℃ of dark 36-48hr that cultivate, treat to grow in ware single bacterium colony clearly, picking list bacterium colony is in other LB plate line, 26.5 ℃ of dark 36-48hr that cultivate, treat that in ware, growing enough bacterium colonies finishes to cultivate, media surface bacterium colony is scraped in the MGL substratum in triangular flask, 28 ℃, 200rpm are cultivated 2hr, make OD value between 0.5-1.5, can be used for infecting.

2..2..2 the preservation of bacterial strain:

In culture dish, picking list bacterium colony is connected to 150rpm LB liquid nutrient medium, and 26 ℃ are shaken 48hr, is that 1:1 joins 1.5mL centrifuge tube and mixes by bacterium liquid and glycerine volume ratio ,-70 ℃ of preservations.

3.. contaminate, cultivate altogether:

3..1 prepare:

The dark YZ-1 seedling of cultivating about 5 days young tender stalwartnesses, activated Agrobacterium, sterile petri dish and aseptic filter paper etc.

3..2 operation:

Under aseptic condition, YZ-1 seedling hypocotyl is cut into the long segment of 0.5-1cm with sharp blade, be transferred in activated Agrobacterium bacterium liquid, stir evenly, leave standstill 5-10 minute, outwell bacterium liquid, filter paper blots remaining bacterium liquid, blow and within 5 minutes, make surface dry a little, thin layer divides to intersperse among in the common culture medium that is lined with filter paper (fills a prescription: MS inorganic salt+B5 organism+2,4-D0.1mg/L+KT (kinetin) 0.1mg/L+ magnesium chloride 1g/L+ glucose 30g/L+phytagel2.5g/L, adjust pH to 7.0), in the 19-21 ℃ of dark 38-42 hour that cultivates.

4.. the induction of callus

The hypocotyl segment infecting after common cultivation is inoculated in to (formula: MS inorganic salt+B5 organism+2 on inducing culture, 4-D0.1mg/L+KT (kinetin) 0.1mg/L+ glucose 30g/L+phytagel2.5g/L), the pH to 7.0 of tune substratum before sterilizing.

5, the propagation of non-embryonic callus tissue

The proliferated culture medium of non-embryonic callus tissue is as follows: (wherein the amount of saltpetre doubles MS inorganic salt, the amount of ammonium nitrate reduces by half)+B5 organism+2,4-D0.05mg/L+KT0.1mg/L+ glucose 30g/L+phytagel2.5g/L, the pH to 7.0 of tune substratum before sterilizing.

6, the differentiation of callus

Callus through subculture (a month subculture once) several times after, some Transformation of Callus become rice granular particle, proceeded to (formula: MS minimum medium+B5 organism+kinetin (KT) 0.15mg/L+ indolebutyric acid (IBA) 0.5mg/L+ glucose 30g/L+phytagel2.5g/L) on division culture medium, the pH to 7.0 that adjusts substratum before sterilizing, makes it further be divided into embryoid.

7, the subculture of embryo callus

The subculture medium of embryo callus is as follows:

(wherein the amount of saltpetre doubles MS inorganic salt, the amount of ammonium nitrate reduces by half)+B5 organism+KT0.15mg/L+IBA0.5mg/L+Gln (glutamine) 1.0mg/L+ l-asparagine (Asn) 0.5mg/L+ glucose 30g/L+phytagel2.5g/L, the pH to 7.0 of tune substratum before sterilizing.

8, seedling root culture

By the seedling subculture differentiating to seedling growth medium in 1/2MS substratum (formula: 1/2MS inorganic salt+B5 organism+glucose 15g/L+phytagel2.5g/L, adjust the pH to 7.0 of substratum before sterilizing).

9, acclimatization and transplants

The good seedling of taking root is opened to triangular flask sealed membrane, and hardening 2-3 days, is then transplanted in little native alms bowl, and the slow seedling that shades is transplanted land for growing field crops for about one week.

The correlation analysis of embodiment 3:GbEXPATR transgenic line

1, GbEXPATR transgenic line Molecular Identification

Obtain 3 transgenosis familys by GbEXPATR gene overexpression transgenic lines, respectively called after: OE2, OE3 and OE4.From obtained transgenosis family, extract genomic dna (according to a conventional method), analyze by Southern blot, identify its genetically modified effect and copy number.Transgenosis family genome DNA extracting method and Southern experiment are with reference to works such as J. Pehanorm Brookers, and Huang Peitang etc. translate, molecular cloning experiment guide (third edition), Science Press, the method for 2002 editions reports.The results are shown in Figure shown in 4.

2, GbEXPATR transgenic line expression analysis

Press individual plant and extract the works such as the total RNA(J. Pehanorm of transgenic line Brooker, Huang Peitang etc. translate, molecular cloning experiment guide (third edition), Science Press, 2002 editions), at least three biology of each strain repeat, carry out expression analysis by Realtime PCR, Realtime-PCR method is identical with embodiment 2, specific analytical method with reference to be coated with gift jasmine report method (Tu Lili. the excavation .[doctorate paper of island cotton fiber development related gene expression spectrum analysis and functional gene]. Wuhan. Library of Hua Zhong Agriculture University, National IP Network's network address in 2007.: http://www.cnki.net/KCMS/detail/detail.aspx dbcode=CDFD & QueryID=11 & CurRec=3 & dbname=CDFD9908 & filename=2007209600.nh & urlid=& yx=& uid=WEEvREcwSlJHSldTTGJhYlRaSXUwTVpZUXF0cnY5WGVoUWR6R25P VTVRYUtudHZHUi8xKzNtbFhqaUJSTGZjeg==), the results are shown in Figure 5.

3, GbEXPATR transgenic line phenotype analytical

Get mid or late October in field and carry out Fibre Quality in the cotton of Wuhan City, Hubei Province Hua Zhong Agriculture University test cotton field results, adopting model is that the large capacity fiber of HFT9000 tester carries out mature fibers attributional analysis (according to a conventional method), and result shows: three strain OE2, OE3 of transgenosis overexpression and the phenomenal growth of the mature fibers length of OE4 contrast wild-type (non-transgenic) plant 1.6-2.1 millimeter; The mic value 0.23-0.38 that declined, makes fiber rise to B2 level from C2 level; The strength 1-1.73cN/tex that raise.Detailed results is in table 1.

Table 1 transgene cotton fibrous quality parameter

Sample	Staple length (mm)	Mic value	Intensity (cN/tex)
				YZ1	26.99±0.07	5.05±0.07	27.20±0.39
OE2	29.09±0.15**	4.82±0.10**	28.93±0.75**
				OE3	28.87±0.38**	4.73±0.13**	28.20±0.24**
OE4	28.63±0.91**	4.67±0.18**	28.90±0.14**

Claims (3)

1. separate, clone the synthetic initial stage predominant expression cotton cells wall extensin gene GbEXPATR of regulation and control Island Cotton Fiber elongating stage, transition period and secondary wall from cotton, its nucleotide sequence is as shown in sequence table SEQ ID NO:1.

2. separate, clone the synthetic initial stage predominant expression cotton cells wall extensin gene GbEXPATR of regulation and control Island Cotton Fiber elongating stage, transition period and secondary wall from cotton, the sequence of its protein is as shown in sequence table SEQ ID NO:2.

3. the application of the cotton cells wall extensin gene GbEXPATR described in claim 1 or 2 in regulation and control Island Cotton Fiber elongating stages, transition period and the synthetic initial stage predominant expression of secondary wall.

Images