CN103789325B - Cotton cells wall extensin gene GbEXPATR and application - Google Patents

Abstract

The invention belongs to field of plant genetic, be specifically related to a separating clone from the cell walls expansion protein gene GbEXPATR of cotton and application.The present invention obtains the cell walls expansion protein gene GbEXPATR lacking second structural domain of Island Cotton Fiber specifically expressing from the cDNA library of Island Cotton Fiber different development stage, is its nucleotide sequence as SEQ? ID? shown in NO:1, wherein 52-306 for the region shown in base be coding region, it is specifically at Island Cotton Fiber elongating stage, transition period and secondary wall synthesis initial stage high expression.The total length ORF of acquisition is building up to plant overexpression carrier pCAMBIA2301 ^mon, transform upland cotton with agrobcterium-mediated transformation, the fibrous quality of transgenic progeny is analyzed, find that it effectively can promote the elongation of fiber; Mic value reduces; Fiber is made to rise to B2 level from C2 level; The rising of strength.Utilize the present invention can effective improving cotton fiber quality.

Description

Cotton cells wall extensin gene GbEXPATR and application

Technical field

The invention belongs to field of plant genetic.Be specifically related to a kind of cotton cells wall extensin gene GbEXPATR and application.Utilize the method for reverse genetics, by the analysis to Island Cotton Fiber different development stage cDNA library, find that this gene GbEXPATR lacks cell walls expansion albumen (α-expansin) second structural domain.The GbEXPATR gene of separating clone of the present invention is at Island Cotton Fiber elongating stage, transition period and secondary wall synthesis initial stage predominant expression.In cotton body, this gene of overexpression effectively can promote the elongation of fiber, the reduction of mic value make fiber rise to B2 level from C2 level, and strength raises.Utilize the present invention can effective improving cotton fiber quality.

Background technology

Cotton is one of most important cash crop in the world, and for textile industry provides topmost natural fiber, its quality quality is directly connected to the height of textile product quality, class.Cotton fiber is the unicellular epidermal hair differentiated by ovule exocuticle, and ripe fibrocyte length is generally 30-40mm, and thickness is 15 μm of (Qin, Y.M.; Zhu, Y.X., Howcottonfiberselongate:ataleoflinearcell-growthmode.Cur rentopinioninplantbiology2011,14 (1), 106-11.).Process (the Haigler that growth is divided into initial (Initiation), elongation (Elongation), conversion (Transition), secondary wall synthesis (Secondarycellwallbiosynthesis) and ripe (Maturation) five that dewater overlaps each other of fiber, C.H. etc., Cottonfiber:apowerfulsingle-cellmodelforcellwallandcellu loseresearch.FrontiersinPlantScience2012,3.).Cell walls plays an important role in Fibre Development process, from extend time primary wall be synthesized to secondary wall thicken time cellulosic synthesis, the conversion of this cell wall properties determines the quality of fiber (length, intensity, ripening degree).In recent years, along with the fast development of information biology, RNA, DNA sequencing technology perfect gradually, different Fibre Development cell walls in period genes involved is excavated out in a large number, verified by the function of transgenic technology to these genes, find that they have impact on the quality of fiber: after the xyloglucan inscribe transferase gene GhXTH overexpression of express elongate fiber phase a large amount, transgenic line fiber-length increase 15-20% compared with the control, and strength and mic value do not change (Lee, J. etc., Xyloglucanendotransglycosylase/hydrolasegenesincottonand theirroleinfiberelongation.Planta2010, 232 (5), 1191-205.).GhPEL is the pectin lyase that a 10DPA fiber a large amount is expressed, it can reduce the content of de-esterified pectin, after this gene inhibition, transgenic line staple length have dropped 16%(Wang, H. etc., TheessentialroleofGhPELgene, encodingapectatelyase, incellwalllooseningbydepolymerizationofthede-esterifiedp ectinduringfiberelongationincotton.Plantmolecularbiology 2010,72 (4-5), 397-406.).Sucrose synthase can generate fructose and UDPG by catalysing sucrose, and UDPG is the important substrate of cellulosic electrode, increase length, the intensity of fiber can be made after GhSusA1 overexpression, and improve the biomass (Jiang of seedling, Y. etc., OverexpressionofGhSusA1increasesplantbiomassandimprovesc ottonfiberyieldandquality.PlantBiotechnologyJournal2012,10 (3), 301-312.).

Cell walls expansion albumen is found from McQueen-Mason in 1992--expansin is the existing vicennial time till now, and it is considered to the cell wall protein that irreversible stretching, extension occurs a kind of wall of inducing cell in acid condition.Typical cell walls expansion albumen expansin is made up of 250-275 amino acid, comprise the signal peptide (20-30 amino acid) of a N end, two structural domain domain1(120-135 amino acid) and domain2(90-120 amino acid) (Cosgrove, D.J., Looseningofplantcellwallsbyexpansins.Nature2000,407 (6802), 321-326.).Found by the evolutionary analysis of sequence, four expansin families: α-expansin (EXPA) is there is in plant, β-expansin (EXPB), expansin-likeA (EXLA) and expansin-likeB (EXLB).α-expansin is present in dicotyledons, and β-expansin only exists grass.α-expansin and β-expansin has been proved the activity with Cell wall loosening, and the function of expansin-likeA and expansin-likeB also under study for action (Cosgrove, J.S.a.D.J., Theexpansinsuperfamily.2005.).Bioinformatic analysis shows, exist in grass one group only with the secretory protein of expansin second structural domain (domain2) homology, immunology is divided into Gramineae second group of pollen hypersensitivity source G2As(grassgroup-2pollenallergens).They may be evolved by β-expansin, reach 35-45%, but its biological function are not clear with the similarity of β-expansin.Two classes and expansin first structural domain similarity is also had to reach the vegetable-protein of 25-35%: p12 and plant urinate sodium peptide (PNP, plantnatriureticpeptide), their a large amount of being present in suffer from the oranges and tangerines xylem of verticillium, have semiotic function and do not possess the activity of Cell wall loosening.Class Barwin albumen is the member of antifungal protein PR4 family, only has 20-30% with the similarity of expansin.

Cell walls expansion albumen expansin is present in different tissues and organ, such as: between hypocotyl, the tip of a root, internode, stem, root hair, flower and mellow fruit, has participated in the growth of many plants, growth, breeding and to processes such as stress responses.Overexpression PhEXPA1 can increase the size of cell, affect cell wall constituent and the merismatic formation (Zenoni of axil, S. etc., OverexpressionofPhEXPA1increasescellsize, modifiescellwallpolymercompositionandaffectsthetimingofa xillarymeristemdevelopmentinPetuniahybrida.NewPhytologis t2011.), lower the formation (Noh, S.A. etc., Down-regulationoftheIbEXP1geneenhancedstoragerootdevelop mentinsweetpotato.JournalofExperimentalBotany2012.) that IbEXP1 can strengthen sweet potato storage root, CiEXPA1 and CiEXPA2 of overexpression form layers enrichment in tobacco, growing of plant can be affected, and increase the content of cellulose (Wang of stem stalk cell walls, G. etc., Overexpressionoftwocambium-abundantChinesefir (Cunninghamialanceolata) α-expansingenesClEXPA1andClEXPA2affectgrowthanddevelopment intransgenictobaccoandincreasetheamountofcelluloseinstem cellwalls.PlantBiotechnologyJournal2011, 9 (4), 486-502.).

Summary of the invention

The object of the invention is to overcome the deficiencies in the prior art, a kind of the GbEXPATR gene and the application that lack the cotton cells wall extensin (α-expansin) of second structural domain are provided.The present invention can adopt the GbEXPATR gene of having cloned to make probe, and from cDNA and genomic library, screening obtains gene of the present invention or homologous gene; Also can adopt PCR(polymerasechainreaction) method, from genome, mRNA and cDNA, amplification obtains GbEXPATR gene of the present invention and any interested section of DNA or the section of DNA molecule with its homology.Adopt above technology, the sequence obtaining comprising GbEXPATR gene can be separated, conversion of plant after being connected by the carrier that this sequence and any one can guide foreign gene to express in plant, can obtain the transfer-gen plant that maturation protein α-expansin content is higher; And a part of sequence of this sequence is built as target can produce RNA interference vector conversion of plant in plant materials, can obtain maturation protein α-expansin content reduce plant.Gene of the present invention, when being building up in plant expression vector, can add any one strong promoter, specific promoter or inducible promoter before its transcription initiation Nucleotide.Gene of the present invention, when being building up in plant expression vector, also can use enhanser, and these enhanser regions can be ATG initiator codon and neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to ensure the translation of whole sequence.

Another object of the present invention is to provide a kind of application of cotton α-expansin gene GbEXPATR in promoting cotton fiber cell elongation, mic value reduction, strength to raise lacking second structural domain.Applicant by the ORF region of GbEXPATR gene that obtains (see sequence table SEQ IDNO:2, sequence length is 567bp) construct overexpression, by genetic transformation overexpression in cotton plants of Agrobacterium, after utilizing the methods such as hybridization such as RT-PCR, Southern to filter out the high low copy transgenic line of expression amount, find that this gene of overexpression effectively can promote the growth of cotton fiber, thus the length that result in mature fibers increases about 7%; Mic value reduces about 6%, and (according to the size of mic value, cotton fiber is divided into following grade: A level: scope is 3.7-4.2 to make fiber be raised to B2 level from C2 level; B1 level: scope is 3.5-3.6; B2 level: scope is 4.3-4.9; C1 level: scope is less than 3.4; C2 level: scope be 5.0 and more than.Wherein, A level is optimum, and B1, B2 take second place, and C1, C2 are the poorest); Strength improves about 6%, realizes the object of improving cotton fiber quality further.

In order to realize above-mentioned object, the present invention by the following technical solutions:

In order to obtain a kind of cotton cells wall extensin (α-expansin) GbEXPATR gene lacking second structural domain, we have employed following separation method, and concrete steps are as follows:

Grow different times cDNA library from Island Cotton Fiber in the previous work of the State Key Laboratory of Crop Genetic Improvent at applicant place and isolate a cDNA(sequence higher with other plant α-expansin DNA homolog degree and see SEQIDNO:1), bioinformatic analysis shows, this cDNA comprises a complete ORF(and sees SEQIDNO:2), can translate by Bioinformatics Prediction this ORF known α-expansin the albumen (SEQIDNO:3) that one lacks second structural domain, applicant is by its called after GbEXPATR gene.This gene is at elongate fiber, conversion, secondary wall synthesis phase high expression, from sea island cotton kind 3-79, extracting 10DPA fiber total serum IgE, (extracting method is with reference to AnimprovedsimpleprotocolforisolationofhighqualityRNAfrom Gossypiumspp.suitableforcDNAlibraryconstruction.ActaAgro nomicaSinica.2005 such as Zhu, 31.1657-1659 the method for report), utilize ThermoScript II Superscript III (purchased from Invitrogen company) by its reverse transcription synthesis cDNA, reaction conditions is: 65 DEG C of 5min, 50 DEG C of 60min, 70 DEG C of 10min.Use primer GbEXPATR(5 ' ATGGCAACCAAAACGATGATGT3 ') and GbEXPATR(5 ' CATAAATATCATGCACCTCCCAC3 ') amplify the total length ORF(567bp of GbEXPATR gene).PCR reaction conditions is: 94 DEG C of denaturation 3min; 94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C of 30sec, 32 circulations; 72 DEG C extend 10min.The PCR primer that amplification obtains is connected into pGEM-T carrier (purchased from Promega company), and screening positive clone also checks order, the full length gene ORF needed for acquisition.Result shows: this gene grows from Island Cotton Fiber the full length sequence be isolated and cloned into different times cDNA library, the cDNA sequence of this gene is the nucleotide sequence shown in SEQIDNO:1, the sequence of the ORF of this gene is SEQIDNO:3, or at least 50% sequence of homology, and the albumen of above-mentioned DNA fragmentation coding: albumen corresponding after this gene translation is the sequence with the protein shown in SEQIDNO:3.The gene GbEXPATR gene of the present invention clone is grown in different times at Island Cotton Fiber and is all had a certain amount of expression, expression amount in the fiber of elongating stage is relatively high, along with the growth expression amount of fiber declines, but do not express in root, stem, leaf, petal, flower pesticide and column cap.

Overexpression primer is designed according to above-mentioned GbEXPATRcDNA, restriction enzyme site and the protection base of NcoI and BstE II is added respectively at primer two ends, we are respectively by this primer called after primer GbEXPATRPoef and GbEXPATRPoer, carry out pcr amplification with the cDNA of GbEXPATR gene for template again, the method that the PCR primer obtained cuts connection by enzyme is connected into the pCAMBIA2301 of same enzyme digestion ^m(pCAMBIA2301 on carrier ^mthe precursor of carrier is the pCAMBIA2301 be so kind as to give by Australian CAMBIA laboratory CenterfortheApplicationofMolecularBiologytoInternational Agriculture, the NcoI that sudden change method removes NPT II upstream of carrier pCAMBIA2301 is mediated by PCR, Bgl II two restriction enzyme site transformations form, directly can be provided by patent inventor Zhang Xianlong), structure obtains a kind of Overexpression vector p35S::GbEXPATR, described Overexpression vector p35S::GbEXPATR contains the expression vector of nucleotide fragments shown in SEQIDNO:1 or SEQIDN0:3, a kind of Overexpression vector p35S::GbEXPATR, described expression vector is plant expression vector pCAMBIA2301 ^m.The aminoacid sequence of answering containing sequence pair shown in SEQIDN0:2 is formed after it expresses translation.

The gene GbEXPATR of above-mentioned clone is in the application by the time in raising of the elongation of promotion cotton fiber cell, mic value reduction, strength, and its detailed process applied is:

The vector agrobacterium strains LBA4404(State Key Laboratory of Crop Genetic Improvent paddy rice group woods of structure is supported the army and provides), again by Agrobacterium-medialed transformation method converting cotton, to be that YZ-1(Inst. of Plant Protection, Henan Prov. Academy of Agricultural Sciences horse is very auspicious be so kind as to give the transformation receptor material adopted), document (the Identificationofanovelelitegenotypeforinvitrocultureandg enetictransformationofcotton.BiologiaPlantarum of the method reference Jin of Agrobacterium-medialed transformation cotton etc., 2006, 50:519-524).Efficient Conversion system (Anefficientgraftingsystemfortransgenicplantrecoveryincot ton (GossypiumhirsutumL.) .PlantCell that method for transformation and program are set up with reference to Jin etc., TissueandOrganCulture, 85:181-185,2006).

GbEXPATR gene overexpression transgenic lines obtains the higher family of 3 expression amounts.Genomic dna is extracted to transgenic line, is analyzed by Southernblot, identify its genetically modified effect and copy number.Extract transgenic line total serum IgE by individual plant, each strain at least three biology repeat, and carry out expression analysis by RealtimePCR, Realtime-PCR method is with embodiment 2.

Measured mature fibers length, mic value, strength by HFT9000 Large Copacity fiber tester, three strain OE2 of transgenosis overexpression, the mature fibers length vs wild-type of OE3 and OE4 significantly increase 1.6-2.1 millimeter; Mic value have dropped 0.23-0.38, makes fiber rise to B2 level from C2 level; Strength increases 1-1.73cN/tex.

Advantage of the present invention:

(1) by obtaining the cell walls expansion Protein G bEXPATR gene lacking second structural domain in Island Cotton Fiber growth different times cDNA library, method of the present invention is efficient, and accuracy is high.

(2) the expression vector carrier of GbEXPATR gene of the present invention will be carried by using Ti-plasmids, plant viral vector, directly delivered DNA, microinjection, the standard biologic technological methods such as electroporation import vegetable cell (Weissbach, 1998, MethodforPlantMolecularBiologyVIII, AcademyPress, NewYork, pp.411-463; GeisersonandCorey, 1998, PlantMolecularBiology (2ndEdition).

(3) by transgenosis, functional verification has been carried out to GbEXPATR gene, confirm that the high expression of this gene can significantly improve the expression amount of GbEXPATR in cotton fiber, thus promote further the elongation of cotton fiber cell, the reduction of mic value, the rising of strength, for cotton fiber quality improvement creates theoretical basis.

(4) host that the expression vector comprising GbEXPATR gene of the present invention can be used to transform comprises cotton various plants, promotes the elongation of cell; The overexpression vector host cotton comprising the connection 35S efficient promoter that GbEXPATR gene fragment of the present invention is target can be used, can be used for cultivating more long stapled cotton variety.

Accompanying drawing explanation

Sequence table SEQ IDNO:1 grows different times cDNA library from Island Cotton Fiber to isolate a cDNA sequence higher with other plant α-expansin DNA homolog degree, sequence is 820bp, wherein the section at the 52-306bp place of this sequence is the coding region of this gene, and it is encoded 85 amino acid.

Sequence table SEQ IDNO:2 is the sequence of the protein in above-mentioned GbEXPATR gene segment encodes district.

Sequence table SEQ IDNO:3 is the cotton α-expansin gene fragment that isolated complete ORF(lacks second structural domain from the cDNA sequence described in above-mentioned SEQIDNO:1), sequence length is 567bp.Sequence 1 comprises sequence SEQIDNO:3.

Fig. 1: adopt ClustalW software (openly using software) to the analytical results of GbEXPATR gene order.

Result shows: (AF512539 compared with 6 α-expansin genes of upland cotton, AF512540, AF512541, AF512542, AF512543 and AF512544), the α-expansin signal peptide that the aminoacid sequence of GbEXPATR gene is held at N and 6-8 cysteine residues and HFD primitive (His-Phe-Aap) are guarded completely.

Fig. 2: utilize Real-timePCR method to detect the expression level of GbEXPATR gene in cotton different tissues.Show in figure:

GbEXPATR gene only has expression in sea island cotton 3-79 Fibre Development different times, does not express in upland cotton TM-1.Expression amount in the fiber of elongating stage is relatively high, and declines along with the growth expression amount of fiber, but does not express at root, stem, leaf, petal, flower pesticide, column cap.Organizing for 24 that choose is sea island cotton 3-79 and upland cotton TM-1 respectively: 1. piece; 2. stem; 3. leaf; 4. petal; 5. flower pesticide; 6. column cap; 7.0DPA ovule; 8.5DPA fiber; 9.10DPA fiber; 10.15DPA fiber; 11.20DPA fiber; 12.25DPA fiber (DPA:daypostanthesis Post flowering number of days).

Fig. 3: be the original plasmid that utilizes of the present invention and improved plasmid figure.Wherein: the pCAMBIA2301m plasmid figure that Fig. 3 A to be the original plasmid figure of plasmid pCAMBIA2301, Fig. 3 B be overexpression carrier that the present invention builds is used, Fig. 3 C is that the Overexpression vector p35S::GbEXPATR that the present invention builds schemes.

Fig. 4: GbEXPATR transgene cotton Southern hybridization check result.In figure: OE is overexpression strain, wherein OE2 is two copies, OE3 and OE4 is single copy.

Fig. 5: the result of by Realtime-PCR method, being carried out to expression analysis GbEXPATR transgene cotton T4 generation.

The fiber getting 10DPA, 15DPA, 20DPA extracts total serum IgE and carries out expression analysis to GbEXPATR transgenic progeny.Carry out expression analysis by Realtime-PCR to GbEXPATR transgenic progeny, result shows that the expression amount in OE2, OE3 and OE4 tri-strains significantly improves.

Fig. 6: GbEXPATR transgene cotton picture, GbEXPATR can promote that fiber is elongated.

Below in conjunction with drawings and Examples, the invention will be further described.

Embodiment

Embodiment 1:GbEXPATR gene isolation clone and the expression characterization at cotton different tissues thereof

Different times cDNA library (Tu, L.L. is grown from the Island Cotton Fiber set up in the previous work of the crop genetic improvement National Key Laboratory of applicant, Deng Genesexpressionanalysesofsea-islandcotton (GossypiumbarbadenseL.) duringfiberdevelopment.Plantcellreports2007, 26 (8), isolate 1309-1320.) one with upland cotton cell walls expansion protein alpha-expansin gene (the gene number of logging in: AF043284) very high homology but the cDNA(lacking second structural domain is shown in SEQIDNO:1), bioinformatic analysis shows, this cDNA comprises a complete ORF(and sees SEQIDNO:3), an incomplete α-expansin albumen (aminoacid sequence of the protein of its coding is shown in SEQIDNO:2) can be translated by Bioinformatics Prediction this ORF known, we are by this fragment called after GbEXPATR gene.This gene at elongate fiber high expression in each in period, and from sea island cotton kind 3-79, extracting 10DPA fiber total serum IgE, (extracting method is with reference to the method for the reports such as Zhu: Zhu etc.AnimprovedsimpleprotocolforisolationofhighqualityRNAfrom Gossypiumspp.suitableforcDNAlibraryconstruction.ActaAgro nomicaSinica.2005,31.1657-1659.), utilize ThermoScript II Superscript III (purchased from Invitrogen company) by its reverse transcription synthesis cDNA, reaction conditions is: 65 DEG C of 5min, 50 DEG C of 60min, 70 DEG C of 10min.Use primer GbEXPATR(5 ' ATGGCAACCAAAACGATGATGT3 ') and GbEXPATR(5 ' CATAAATATCATGCACCTCCCAC3 ') amplify the total length ORF(567bp of GbEXPATR gene).PCR reaction conditions is: 94 DEG C of denaturation 3min; 94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C of 30sec, 32 circulations; 72 DEG C extend 10min.The PCR primer that amplification obtains is connected into pGEM-T carrier (purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd, i.e. U.S. Promega company soleagent), and screening positive clone also checks order, the full length gene ORF needed for acquisition.Result shows: this gene grows from Island Cotton Fiber the full length sequence be isolated and cloned into different times cDNA library, the cDNA sequence of this gene is as shown in SEQIDNO:1, wherein the section at the 52-306bp place encoder block that is this gene and ORF(are shown in aminoacid sequence corresponding shown in SEQIDNO:1, to encode 85 amino acid), the sequence of the protein of this genes encoding is shown in shown in SEQIDNO:3.

Embodiment 2: the structure of overexpression carrier and conversion

In order to verify the function of GbEXPATR gene in cotton, applicant constructs overexpression carrier and carrys out converting cotton.

Overexpression primer pair (DNA sequence dna of this primer pair is shown in the description after this section) is designed according to the ORF region (region see 52-306 base pair in SEQIDNO:1 is answered) obtaining GbEXPATRcDNA in embodiment 1; we add restriction enzyme site and the protection base of NcoI and BstE II respectively at primer pair two ends; respectively by this primer pair called after primer GbEXPATRPoef and GbEXPATRPoer; carry out pcr amplification with the cDNA of GbEXPATR gene for template again, the method that the PCR primer obtained cuts connection by enzyme is connected into the pCAMBIA2301 of same enzyme digestion ^m(pCAMBIA2301 on carrier ^mthe precursor of carrier is the pCAMBIA2301 be so kind as to give by Australian CAMBIA laboratory CenterfortheApplicationofMolecularBiologytoInternational Agriculture, and NcoI, Bgl II two the restriction enzyme sites transformations being removed NPT II upstream of carrier pCAMBIA2301 by PCR mediation sudden change method form (pCAMBIA2301 ^mcarrier figure is shown in Fig. 3 B), structure obtains an Overexpression vector p35S::GbEXPATR(and sees Fig. 3 C): substituted for pCAMBIA2301 by the gene fragment of GbEXPATR ^mgusSecondExon fragment in carrier.Overexpression carrier p35S::GbEXPATR contains the expression vector of one of them nucleotide fragments shown in SEQIDNO:2, and it forms the sequence containing SEQIDNO:2 after expressing translation.Fig. 3 C is shown in by the collection of illustrative plates of the overexpression carrier p35S::GbEXPATR that the present invention builds.

The DNA sequence dna of above-mentioned primer pair is as follows:

GbEXPATRPoef:5'gcgtCCATGGCAACCAAAACGATGATGT3'；

GbEXPATRPoer:5'gtcGGTCACCCATAAATATCATGCACCTCCCAC3'。

By the vector agrobacterium strains LBA4404 built, again by Agrobacterium-medialed transformation method converting cotton, the transformation receptor material adopted is cotton YZ-1, this material is the material (Jin etc. that the cotton seminar of crop genetic improvement National Key Laboratory at the applicant place one of finding through a large amount of screenings has very high embryo's generating ability, Identificationofanovelelitegenotypeforinvitrocultureandg enetictransformationofcotton.BiologiaPlantarum, 200650 (4): 519-524), document (the Identificationofanovelelitegenotypeforinvitrocultureandg enetictransformationofcotton.BiologiaPlantarum of the method reference Jin of Agrobacterium-medialed transformation cotton etc., 2006, 50:519-524).Efficient Conversion system (Anefficientgraftingsystemfortransgenicplantrecoveryincot ton (GossypiumhirsutumL.) .PlantCell that method for transformation and program are set up with reference to Jin etc., TissueandOrganCulture, 85:181-185,2006), and done corresponding adjustment and amendment, concrete grammar and flow process as follows:

1, the cultivation of aseptic seedling

By upland cotton YZ-1) cotton seed hulls removes, and first use the mercuric chloride solution sterilizing ten minutes of 0.1%, aseptic water washing three times, is inoculated on Aseptic seedling culture base and (fills a prescription as follows: 2/1MS macroelement+glucose 15g.L ^-1+ vegetable jelly phytagel2.5g.L ^-1), the pH to 7.0 of adjustment substratum before sterilizing, under the high pressure steam of 121 DEG C, sterilizing 30min, is placed in culturing room by postvaccinal culture vessel, 28 DEG C, light culture 3-6 days.

2.. the activation of Agrobacterium and preservation

2..1 the preparation of substratum and associated materials:

Agrobacterium LBA4404; Preparation is containing kantlex 50mg.L ^-1mGL liquid nutrient medium (formula of substratum: tryptone 5g/L, sodium-chlor 5g.L ^-1, MgSO4.7H2O0.1g.L ^-1, KH2PO40.25g.L ^-1, N.F,USP MANNITOL 5g.L ^-1, glycine 1.0g.L ^-1, with distilled water supplemental medium to 1L, before sterilizing, adjust the pH to 7.0 of substratum); The triangular flask of sterilizing; LB substratum (solid, liquid) (formula: tryptone 10g/L+ yeast extract 5g/L+ sodium-chlor 5g/L+ agar powder 15g/L, the pH to 7.0 of adjustment substratum before sterilizing, sterilizing under the high pressure steam of 121 DEG C; Kantlex 50mg.L ^-1; Sterile glycerol; Rifle head; 5mL centrifuge tube.Postvaccinal culture vessel is placed in culturing room.

2..2 operation:

2..2..1 activate, suspend:

The glycerine pipe with the agrobacterium strains LBA4404 of overexpression vector of preservation is taken out at thawed on ice in Ultralow Temperature Freezer, LB plate is rule, 26.5 DEG C of light culture 36-48hr, treat to grow in ware single bacterium colony clearly, picking list bacterium colony is rule at other LB plate, 26.5 DEG C of light culture 36-48hr, treat that growing enough bacterium colonies in ware terminates to cultivate, media surface bacterium colony is scraped in the MGL substratum in triangular flask, 28 DEG C, 200rpm cultivates 2hr, makes OD value namely can be used for infecting between 0.5-1.5.

2..2..2 the preservation of bacterial strain:

In culture dish, picking list bacterium colony is connected to 150rpm LB liquid nutrient medium, and 26 DEG C are shaken 48hr, is that 1:1 joins the mixing of 1.5mL centrifuge tube ,-70 DEG C of preservations by bacterium liquid and glycerine volume ratio.

3.. contaminate, Dual culture:

3..1 prepare:

The YZ-1 seedling of the young tender stalwartness of light culture about 5 days, activated Agrobacterium, sterile petri dish and aseptic filter paper etc.

3..2 operation:

Under aseptic condition, the sharp blade of YZ-1 seedling hypocotyl is cut into the long segment of 0.5-1cm, be transferred in activated Agrobacterium bacterium liquid, stir evenly, leave standstill 5-10 minute, outwell bacterium liquid, filter paper blots remaining bacterium liquid, blow and within 5 minutes, make surface dry a little, thin layer divides to intersperse among to be lined with in the Dual culture substratum of filter paper (fills a prescription: MS inorganic salt+B5 organism+2,4-D0.1mg/L+KT (kinetin) 0.1mg/L+ magnesium chloride 1g/L+ glucose 30g/L+phytagel2.5g/L, adjust pH to 7.0), in 19-21 DEG C of light culture 38-42 hour.

4.. the induction of callus

(formula: MS inorganic salt+B5 organism+2 on inducing culture is inoculated in by infecting the hypocotyl segment after Dual culture, 4-D0.1mg/L+KT (kinetin) 0.1mg/L+ glucose 30g/L+phytagel2.5g/L), adjust the pH to 7.0 of substratum before sterilizing.

5, the propagation of non embryogenic callus

The proliferated culture medium of non embryogenic callus is as follows: (wherein the amount of saltpetre doubles MS inorganic salt, the amount of ammonium nitrate reduces by half)+B5 organism+2,4-D0.05mg/L+KT0.1mg/L+ glucose 30g/L+phytagel2.5g/L, adjusts the pH to 7.0 of substratum before sterilizing.

6, the differentiation of callus

Callus through subculture (a month subculture once) several times after, some Transformation of Callus become rice granular particle, proceeded to (formula: MS minimum medium+B5 organism+kinetin (KT) 0.15mg/L+ indolebutyric acid (IBA) 0.5mg/L+ glucose 30g/L+phytagel2.5g/L) on division culture medium, adjust the pH to 7.0 of substratum before sterilizing, make it be divided into embryoid further.

7, the subculture of embryo callus

The subculture medium of embryo callus is as follows:

(wherein the amount of saltpetre doubles MS inorganic salt, the amount of ammonium nitrate reduces by half)+B5 organism+KT0.15mg/L+IBA0.5mg/L+Gln (glutamine) 1.0mg/L+ l-asparagine (Asn) 0.5mg/L+ glucose 30g/L+phytagel2.5g/L, adjusts the pH to 7.0 of substratum before sterilizing.

8, seedling root culture

The seedling subculture differentiated (is filled a prescription: 1/2MS inorganic salt+B5 organism+glucose 15g/L+phytagel2.5g/L on seedling growth medium in 1/2MS substratum, adjusted the pH to 7.0 of substratum before sterilizing).

9, acclimatization and transplants

By taking root, good seedling opens triangular flask sealed membrane, hardening 2-3 days, is then transplanted in little native alms bowl, and the slow seedling about a week that shades transplants land for growing field crops.

The correlation analysis of embodiment 3:GbEXPATR transgenic line

1, GbEXPATR transgenic line Molecular Identification

3 transgenic lines are obtained, respectively called after: OE2, OE3 and OE4 by GbEXPATR gene overexpression transgenic lines.From obtained transgenic lines, extract genomic dna (according to a conventional method), analyzed by Southernblot, identify its genetically modified effect and copy number.Transgenic lines genome DNA extracting method and Southern experiment are with reference to works such as J. Pehanorm Brookers, and Huang Peitang etc. translate, Molecular Cloning: A Laboratory guide (third edition), Science Press, the method for 2002 editions reports.The results are shown in Figure shown in 4.

2, GbEXPATR transgenic line expression analysis

Transgenic line total serum IgE (the work such as J. Pehanorm Brooker is extracted by individual plant, Huang Peitang etc. translate, Molecular Cloning: A Laboratory guide (third edition), Science Press, 2002 editions), each strain at least three biology repeat, expression analysis is carried out by RealtimePCR, Realtime-PCR method is identical with embodiment 2, specific analytical method with reference to be coated with gift jasmine report method (Tu Lili. the excavation of island cotton fiber development related gene expression spectrum analysis and functional gene. [Ph.D. Dissertation]. Wuhan. Library of Hua Zhong Agriculture University, National IP Network's network address in 2007.: http://www.cnki.net/KCMS/detail/detail.aspx dbcode=CDFD & QueryID=11 & CurRec=3 & dbname=CDFD9908 & filename=2007209600.nh & urlid=& yx=& uid=WEEvREcwSlJHSldTTGJhYlRaSXUwTVpZUXF0cnY5WGVoUWR6R25P VTVRYUtudHZHUi8xKzNtbFhqaUJSTGZjeg==), the results are shown in Figure 5.

3, GbEXPATR transgenic line phenotype analytical

Get mid or late October in field and carry out Fibre Quality in the cotton of Wuhan City, Hubei Province Hua Zhong Agriculture University test cotton field results, adopt model to be that HFT9000 Large Copacity fiber tester carries out mature fibers attributional analysis (according to a conventional method), result shows: three strain OE2 of transgenosis overexpression, mature fibers length vs wild-type (non-transgenic) plant of OE3 and OE4 significantly increase 1.6-2.1 millimeter; Mic value have dropped 0.23-0.38, makes fiber rise to B2 level from C2 level; Strength increases 1-1.73cN/tex.Detailed results is in table 1.

Table 1 transgene cotton fiber quality parameters

Sample	Staple length (mm)	Mic value	Intensity (cN/tex)
				YZ1	26.99±0.07	5.05±0.07	27.20±0.39
OE2	29.09±0.15**	4.82±0.10**	28.93±0.75**
				OE3	28.87±0.38**	4.73±0.13**	28.20±0.24**
OE4	28.63±0.91**	4.67±0.18**	28.90±0.14**

Claims (1)

1. the application of cotton cells wall extensin gene GbEXPATR in regulation and control sea island cotton transition period and secondary wall synthesis initial stage predominant expression, is characterized in that the nucleotide sequence of this gene is as shown in SEQIDNO:1.