CN108220292A - Rice microRNA os-miR171b genes and the application in rice yield is increased - Google Patents
Rice microRNA os-miR171b genes and the application in rice yield is increased Download PDFInfo
- Publication number
- CN108220292A CN108220292A CN201611156326.9A CN201611156326A CN108220292A CN 108220292 A CN108220292 A CN 108220292A CN 201611156326 A CN201611156326 A CN 201611156326A CN 108220292 A CN108220292 A CN 108220292A
- Authority
- CN
- China
- Prior art keywords
- rice
- microrna
- mir171b
- yield
- increase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Application the invention discloses rice microRNA os miR171b and in adjusting and controlling rice spike length and in increasing yield.Present invention high-flux sequence from rice Nipponbare obtains microRNA osa miR171b, is building up in precursor-gene pre miR528 sequences with the microRNA.The microRNA precursors in rice after overexpression os miR171b, with wild type control compare by transgenic line, and overexpression strain fringe is elongated, and hip number increases.Therefore, for overexpression os miR171b for rice yield raising is promoted to be of great significance, this provides new resource and research method for rice high yield molecular breeding in rice.
Description
Technical field：
The present invention relates to plant genetic engineering fields, and in particular to a kind of rice microRNA osa-miR171b is in water
Application in rice.
Background technology
MicroRNA (microRNA) is prevalent in animal and plant body, and the weight of post-transcriptional control is played to its target gene
It acts on, so as to regulate and control the character of organism
Rice (Oryza sativa L.) is a kind of important cereal crops, and hybrid rice is in agricultural production in recent years
Successful application substantially increase rice yield, however improving rice yield by the method for hybridization has certain limit.In order to
Rice yield is further improved, transgene method provides new approach.
Invention content
Group of the present invention finds, can increase spike length and solid number by transgenosis overexpression rice microRNA to improve
Rice yield.
On the one hand, the present invention obtains length as 21nt rice maturation microRNA by high-flux sequence, is named as osa-
MiR171b sequences, sequence are：5’UGAUUGAGCCGUGCCAAUAUC 3’,(SEQ ID NO：1).With the microRNA,
Osa-miR528 sequences in osa-MIR528 precursor sequences known to the replacement of osa-miR171b sequences, obtain artificial miR171b
Sequence osa-miR171b (SEQ ID NO：2).After the chemical synthesis sequence DNA, which is connected to double base expression
Carrier pCAMBIA1300UR (Fig. 1).The carrier is converted to EHA105 Agrobacteriums, using Agrobacterium tumefaciens-mediated Transformation in water
After the microRNA is overexpressed in rice, which overexpresses strain compared with wild type, and overexpression strain fringe is elongated, solid
More.Therefore, overexpression os-miR171b can improve rice yield in rice, and new side is improved for high-yield rice molecular breeding
Method.
On the other hand, the present invention provides one section of rice microRNA osa-miR171b sequence, the nucleosides of the microRNA
Acid sequence is SEQ ID NO:Shown in 1, feature exists, the microRNA by transgenosis water method can prepare spike length increase,
The solid number of Rice Panicle increases or the increased rice of yield.
On the other hand, present invention offer is a kind of prepares spike length increase, the solid number increase of Rice Panicle or the increased water of yield
The method of rice, wherein, microRNA nucleotides sequences is allowed to be classified as SEQ ID NO:Gene order shown in 1 is transferred in rice.
On the other hand, the present invention provides one section of rice microRNA os-miR171b sequence and is preparing spike length increase, water
Purposes in the solid number increase of spike of rice or the increased rice of yield, wherein, the RNA os-miR171b are SEQ ID
NO:Sequence shown in 1.
On the other hand, the present invention provides the artificial microRNA osa-miR171b sequences of rice, the nucleosides of the microRNA
Acid sequence is SEQ ID NO:Shown in 2, which is characterized in that the microRNA can be prepared by transgenic method spike length increase,
The solid number of Rice Panicle increases or the increased rice of yield.
On the other hand, present invention offer is a kind of prepares spike length increase, the solid number increase of Rice Panicle or the increased water of yield
The method of rice, wherein, nucleotides sequence is allowed to be classified as SEQ ID NO:Gene order shown in 2 is transferred in rice.
On the other hand, the present invention provides the artificial small molecule gene order of rice and is preparing spike length increase, the solid number of Rice Panicle
Purposes in increase or the increased rice of yield, wherein, the gene order is SEQ ID NO:Sequence shown in 2.
Those of ordinary skill in the art are it is believed that any transgene method is all suitable for disclosed base
Because of the transfer of sequence, any rice varieties can be applicable in the gene of the present invention.Group of the present invention finds, different rice varieties or
The different transgenic method of person, although there may be the phenotype of other various traits, for being successfully transferred to announcement of the present invention
Target gene, can show that strain stem diameter is thicker, and stem wall is thickening, fracture resistence force enhancing.
Advantageous effect
Transgenosis, which is carried out, using sequence provided by the invention obtains rice positive plant, the spike length of rice is significantly allowed to increase,
The solid number of Rice Panicle increases or yield increases.
Description of the drawings
Fig. 1 is the pCAMBIA1300UR-osa-miR171b expression vector structure diagrams of the present invention.
Fig. 2 detects osa-miR171b for Northern blot and overexpresses transgenic paddy rice positive plant os-miR171b tables
Up to level view.
Fig. 3 detects osa-miR171b for Real-Time PCR and overexpresses transgenic paddy rice positive plant os-miR171b phases
To expression.
Fig. 4 overexpresses transgenic paddy rice positive plant fringe for osa-miR171b.
Fig. 5 overexpresses the solid several statistical charts of transgenic paddy rice positive plant list fringe for osa-miR171b
Specific embodiment
It needs to specialize, specific embodiment of the invention is used for the purpose of how realizing progress in order to illustrate the present invention
For example, such explanation can not form the present invention any limitation.The scope of the present invention obtains body in claim
It is existing.In order to achieve the object of the present invention, it is carried out using way of example as described below.
According to the sequence for the osa-miR171b that high-flux sequence obtains, particular sequence information is as shown:
5’UGAUUGAGCCGUGCCAAUAUC 3’,(SEQ ID NO：1), with the microRNA, osa-miR171b sequences
Osa-miR528 sequences in osa-MIR528 precursor sequences known to replacement obtain artificial miR171b sequences osa-miR171b
(SEQ ID NO：2), wherein, dashed part replaces the corresponding sequence to be formed for sequence 1 in sequence 2, and replacement here is not
It is simply to replace, but 1 corresponding DNA sequence dna of RNA sequenceTGAT TGAGCCGTGC CAATATCReplace original osa-
Osa-miR528 sequences in MIR528 precursor sequences, italicized item are the complementary series of 1 corresponding DNA sequence dna of sequence:G ATATTGGGGC GGTTCAATCA, new sequence 2 is then synthesized by the way of artificial synthesized：
1 GAGCTCTTTG GCTGTAGCAG CAGCAGTGAT TGAGCCGTGC CAATATCCAG
51 GAGATTCAGT TTGAAGCTGG ACTTCACTTT TGCCTCTCTG ATATTGGGGC
101 GGTTCAATCATTCCTGCTGC TAGGCTGTTC GGATCC(SEQ ID NO：2).
The sequence is through the artificial microRNA osa-miR171b precursor DNA sequences of chemical synthesis.The DNA is through Sac I, BamH I
PCAMBIA1300UR carriers are connected to after digestion, are named as pCAMBIA1300UR-osa-miR171b (Fig. 1).
Convert Agrobacterium
The Agrobacterium EHA105 competence of -70 DEG C of preservations is taken to put on ice to melt, draws 1 μ lpCAMBIA1300UR-osa-
In miR171b plasmids to 100 μ l competence, mixing adds to precooling 1mm electric shock cups；Voltage 2.3kv, 25 μ F of capacitance, resistance are set
200 Ω are electroporated；900 μ l LB fluid nutrient mediums, 28 DEG C of 200rpm shaking table culture 2h are added in, bacterium solution is applied to mould containing that is blocked
On plain 50mg/L, rifampin 50mg/L LB tablets, 28 DEG C of cultures to formation single bacterium colony.
Be conducted into rice by agriculture bacillus mediated rice transformation, rice paddy seed callus induction, squamous subculture,
It co-cultures, screening and differentiation obtain transgenic paddy rice seedling.
It is as follows：
1. the induction of Rice Callus
Take ripe Nipponbare rice paddy seed, the seed of full bright and clean no bacterial plaque is selected in artificial decladding, seed be put into 25ml without
In tube, add in 75% alcohol and impregnate 1min, it is sterile to wash 3 times；30% liquor natrii hypochloritis is added in, impregnates 30min；It outwells secondary
Sodium chlorate solution, with sterile water wash seed 5 times, sterile water impregnates 30min；Seed is put and is blotted on aseptic filter paper, is transferred to induction
On culture medium, per 6-7, ware；Medical adhesive tape seals culture dish, 27 DEG C of illumination box temperature, and humidity 50% is cultivated about 27 days；
It in the callus that super-clean bench is induced with tweezers picking, is transferred on subculture medium, 27 DEG C of illumination box, humidity 50% is cultivated
7 days.
2. callus and the co-cultivation of Agrobacterium
Picking Agrobacterium single bacterium is dropped down onto in 5ml LB fluid nutrient mediums (50mg/L containing Kan, Rif 50mg/L), 28 DEG C,
180rpm shaking table cultures are to orange-yellow；It draws in 2ml bacterium solutions to 2ml EP pipes, 5,000rpm, centrifuges 5min, abandon supernatant；With suitable
It measures AAM culture mediums to suspend, be transferred in the sterile triangular flasks of 100ml, by 50ml AAM fluid nutrient mediums.It is preferable to select state, color
The callus of the squamous subculture of the micro- Huang in pool is transferred in sterile triangular flask, is shaken up, is placed at room temperature for 30min.Culture medium is outwelled, it will more
Injured tissue, which is gone on aseptic filter paper, sucks extra bacterium solution, is transferred to and co-cultures on base, 27 DEG C of dark culturings 2.5 days.
3. the screening and differentiation of Rice Callus
Callus after co-cultivation is transferred on Selective agar medium, 27 DEG C, 50% illumination cultivation of humidity.It was with 10 days
A cycle co-cultures 3 periods.The callus of picking color cadmium yellow is transferred to the plastic bottle equipped with about 60ml differential mediums
In, every bottle puts 5.27 DEG C in incubator, humidity 50%, illumination cultivation is until differentiate seedling.
4. hardening of taking root and transplanting
When the seedling that callus differentiates is grown to about 10cm, seedling is extracted, removes culture medium, root is cut off, be inserted into
In root media, cultivate 5 days.It treats that root long goes out, washes away culture medium, 27 DEG C of illumination Aquaponics 5 days are transplanted to paddy field.
5. rice transformation used medium：
Inducing culture：N6 is a large amount of, and MS-Fe salt, B5 is micro, and B5 is organic, 2,4-D 2.5mg/L, proline 2800mg/L,
L-Glutamine 500mg/L, caseinhydrolysate 300mg/L, inositol 2g/L, sucrose 30g/L, plant gel 3.0g/L, pH=5.8
7. subculture medium：N6 is a large amount of, and MS-Fe salt, B5 is micro, and B5 is organic, 2,4-D 2.0mg/L, proline 2800mg/
L, L-Glutamine 500mg/L, caseinhydrolysate 300mg/L, inositol 2g/L, sucrose 30g/L, plant gel 3.0g/L, pH=
5.8
8.AAM culture mediums：AA is a large amount of, and MS-Fe salt, B5 is micro, and B5 is organic, 2-morpholine ethane sulfonic acid 3.9g/L, casein ammonia
Base acid 500mg/L, inositol 2g/L, barley-sugar 30g/L PH=5.5,200 μM of acetosyringone
9. co-culture culture medium：N6 is a large amount of, and MS-Fe salt, B5 is micro, and B5 is organic, caseinhydrolysate 500mg/L, inositol 2g/
L, sucrose 30g/L, plant gel 3.0g/L, 2-morpholine ethane sulfonic acid 3.9g/L pH=5.5,100 μM of acetosyringone
10. Selective agar medium：N6 is a large amount of, and MS-Fe salt, B5 is micro, and B5 is organic, 2,4-D 2.0mg/L, proline 500mg/
L, glutamine 500mg/L, caseinhydrolysate 300mg/L, inositol 100mg/L, sucrose 30g/L, plant gel 3.0g/L pH=
5.8, carbenicillin 250mg/L, hygromycin 50mg/L
11. differential medium：N6 is a large amount of, and MS-Fe salt, B5 is micro, and B5 is organic, methyl α-naphthyl acetate 0.5mg/L, proline 500mg/
L, glutamine 500mg/L, caseinhydrolysate 300mg/L, 6-benzyl aminopurine 3mg/L, inositol 100mg/L, sucrose 30g/L,
D-sorbite 20g/L, plant gel 3.0g/L pH=5.8, carbenicillin 250mg/L, hygromycin 50mg/L
12. root media：1/2N6 is a large amount of, and MS-Fe salt, B5 is micro, sucrose 30g/L, inositol 100mg/L, agar
0.8%pH=5.8
The specific proportioning of Transgenic Rice used medium：
N6 a great number of elements (20X)
MS molysite (200X)
Na2.EDTA 7460 mg
FeSO4·7H2O 5560 mg
Water is added to be settled to 1000mL
B5 trace elements (100X)
B5 organic (100X)
AA a great number of elements (10X)
The molecular Biological Detection of transgenic paddy rice
1) Northern blot are analyzed
To confirm that the artificial microRNA being transferred to is overexpressed, Trizol Reagent reagents extract 3 and turn base respectively
Because of positive strain (OE-#1, OE-#2, OE-#3) total serum IgE, probe (5 ' GATATTGGCACGGCTCAATCA 3 ' of sequence is used
SEQ ID NO：3) Northern blot analyses are carried out.Concrete operations flow is with reference to the DIG High Prime of Roche companies
DNA Lebeling and Detection Starter Kit II specifications.Testing result shows that the overexpression of detection turns base
Because os-miR171b expression raises (Fig. 2).
2) Real-Time PCR are analyzed
To confirm the expression of artificial microRNA being transferred to, the transgenic paddy rice seedling transplanted to paddy field was bred into for two generations
Afterwards, Trizol Reagent reagents extract 3 transgenic positive strain (OE-#1, OE-#2, OE-#3) total serum IgEs, reverse transcription respectively
5 ' GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAAC of primerGATATT3’(SEQ ID NO：4) it reverses
Record obtains cDNA.With 5 ' GCATCGG of sense primerTGATTGAGCCGTGCC3’(SEQ ID NO：And downstream primer 5 ' 5)
GTGCAGGGTCCGAGGT 3’(SEQ ID NO：6) real-time PCR are carried out, os-miR171b is in transgenic paddy rice for analysis
Internal expression.The result shows that expressions of the os-miR171b in transgenic paddy rice body respectively higher than compares wild type
30 times, 19 times and 39 times of rice plant (Fig. 3)
Transgenic paddy rice fringe
Os-miR171b after two generations of breeding is overexpressed into transgenic paddy rice seedling, is transplanted into paddy field, observes os-
MiR171b overexpresses transgenic paddy rice phenotype.The result shows that os-miR171b overexpressions transgenic paddy rice fringe is shown compared with the control
Work is longer than wild rice plant, and the average solid number of single fringe increases by 69% (P<0.01), it is significantly higher than wild rice (figure
4,5).Illustrate that os-miR171b overexpressions can increase the yield of rice.
Organization Applicant
----------------------
Street :
City :
State :
Country :
PostalCode :
PhoneNumber :
FaxNumber :
EmailAddress :
<110> OrganizationName :Zhejiang Academy of Agricultural Science
Application Project
-------------------
<120> Title :Rice microRNA os-miR171b genes and the application in rice yield is increased
<130> AppFileReference :
<140> CurrentAppNumber :
<141> CurrentFilingDate : _ - -
Sequence
--------
<213> OrganismName :Rice（Oryza sativa）
<400> PreSequenceString :
ugauugagcc gugccaauau c 21
<212> Type : RNA
<211> Length : 21
SequenceName :Rice microRNA os-miR171b sequences
SequenceDescription :
Sequence
--------
<213> OrganismName :It is artificial synthesized
<400> PreSequenceString :
gagctctttg gctgtagcag cagcagtgat tgagccgtgc caatatccag gagattcagt 60
ttgaagctgg acttcacttt tgcctctctg atattggggc ggttcaatca ttcctgctgc 120
taggctgttc ggatcc 136
<212> Type : DNA
<211> Length : 136
SequenceName :The precursor sequence of the artificial microRNA osa-miR171b of rice
SequenceDescription :
Sequence
--------
<213> OrganismName :It is artificial synthesized
<400> PreSequenceString :
gatattggca cggctcaatc a 21
<212> Type : DNA
<211> Length : 21
SequenceName :Probe
SequenceDescription :
Sequence
--------
<213> OrganismName :It is artificial synthesized
<400> PreSequenceString :
gttggctctg gtgcagggtc cgaggtattc gcaccagagc caacgatatt 50
<212> Type : DNA
<211> Length : 50
SequenceName :Reverse transcriptase primer
SequenceDescription :
Sequence
--------
<213> OrganismName :It is artificial synthesized
<400> PreSequenceString :
gcatcggtga ttgagccgtg cc 22
<212> Type : DNA
<211> Length : 22
SequenceName :Sense primer
SequenceDescription :
Sequence
--------
<213> OrganismName :It is artificial synthesized
<400> PreSequenceString :
gtgcagggtc cgaggt 16
<212> Type : DNA
<211> Length : 16
SequenceName :Downstream primer
SequenceDescription :
Claims (6)
1. one section of rice microRNA osa-miR171b gene order, the nucleotides sequence of the microRNA are classified as SEQ ID
NO:Shown in 1, feature exists, the microRNA by transgenosis water method can prepare spike length of rice increase, Rice Panicle it is solid
Number increases or the increased rice of yield.
2. a kind of method for preparing spike length increase, the solid number increase of Rice Panicle or the increased rice of yield, wherein, it allows
MicroRNA nucleotides sequences are classified as SEQ ID NO:Gene order shown in 1 is transferred in rice.
3. one section of rice microRNA os-miR171b gene order prepare spike length increase, Rice Panicle it is solid number increase or
Purposes in the increased rice of yield, wherein, the RNA os-miR171b are SEQ ID NO:Sequence shown in 1.
4. the artificial microRNA osa-miR171b gene orders of rice, the nucleotides sequence of the microRNA are classified as SEQ ID
NO:Shown in 2, which is characterized in that the microRNA can be prepared by transgenic method spike length increase, Rice Panicle it is solid
Number increases or the increased rice of yield.
Prepare that spike length increases, the solid number of Rice Panicle increases or the method for the increased rice of yield 5. a kind of, wherein, allow nucleotide
Sequence is SEQ ID NO:Gene order shown in 2 is transferred in rice.
6. the artificial small molecule gene of rice allows spike length of rice to increase, in the solid number increase of Rice Panicle or yield increase in preparation
Purposes, wherein, the gene order is SEQ ID NO:Sequence shown in 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611156326.9A CN108220292B (en) | 2016-12-14 | 2016-12-14 | Rice micromolecule RNAosa-miR171b gene and application thereof in increasing rice yield |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611156326.9A CN108220292B (en) | 2016-12-14 | 2016-12-14 | Rice micromolecule RNAosa-miR171b gene and application thereof in increasing rice yield |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108220292A true CN108220292A (en) | 2018-06-29 |
| CN108220292B CN108220292B (en) | 2021-07-06 |
Family
ID=62651064
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611156326.9A Active CN108220292B (en) | 2016-12-14 | 2016-12-14 | Rice micromolecule RNAosa-miR171b gene and application thereof in increasing rice yield |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108220292B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102604962A (en) * | 2011-01-20 | 2012-07-25 | 中国科学院华南植物园 | Gene OsPTR9 capable of improving nitrogen absorption efficiency and yield of rice and application thereof |
| WO2015185862A1 (en) * | 2014-06-03 | 2015-12-10 | Universite Toulouse Iii-Paul Sabatier | Use of micropeptides in order to stimulate mycorrhizal symbiosis |
| CN106119262A (en) * | 2016-07-28 | 2016-11-16 | 武汉生物工程学院 | Improve Oryza sativa L. nitrogen use efficiency and the gene OsPTR10 of yield and purposes |
-
2016
- 2016-12-14 CN CN201611156326.9A patent/CN108220292B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102604962A (en) * | 2011-01-20 | 2012-07-25 | 中国科学院华南植物园 | Gene OsPTR9 capable of improving nitrogen absorption efficiency and yield of rice and application thereof |
| WO2015185862A1 (en) * | 2014-06-03 | 2015-12-10 | Universite Toulouse Iii-Paul Sabatier | Use of micropeptides in order to stimulate mycorrhizal symbiosis |
| CN106119262A (en) * | 2016-07-28 | 2016-11-16 | 武汉生物工程学院 | Improve Oryza sativa L. nitrogen use efficiency and the gene OsPTR10 of yield and purposes |
Non-Patent Citations (1)
| Title |
|---|
| MATTHEW W.JONES-RHOADES等: "Computational Identification of Plant MicroRNAs and Their Targets,Including a Stress-Induced miRNA", 《MOLECULAR CELL》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108220292B (en) | 2021-07-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104877993B (en) | Two kinds of plant eIF4A genes and its application for the water-fast cercosporiosis of rice poisonous plant body of prepare transgenosis | |
| CN102485897A (en) | Method for changing petal colors by using cotton gene GbF3H | |
| CN110117320A (en) | Cotton GhCAL-D07 gene is promoting the application in flowering of plant | |
| CN105585619B (en) | With rice grain grain length and grain weight GAP-associated protein GAP and its encoding gene GL3-3 and application | |
| CN114014918B (en) | Upstream regulatory factor IbEBF2 and application thereof in regulation and control of IbbHLH2 expression of purple sweet potato | |
| CN108085334A (en) | A kind of Agrobacterium-mediated Transformation barley microspore method of improvement | |
| CN104593381B (en) | A kind of corn resistant gene of salt and its application | |
| CN102094021A (en) | Corn callus specific promoter and cloning method and application thereof | |
| CN104593380B (en) | For the gene ZmHKT1 for the coding corn HKT transport proteins for improving plant salt endurance;1a and its application | |
| CN104593383A (en) | Gene TaFBK1 with F-box structure field, and expression vector and application thereof | |
| CN108220290A (en) | Applications of the rice microRNA osa-miR171b in water resistant rice stripe | |
| CN109456969B (en) | Rice brown planthopper-harming inducible promoter and application thereof | |
| CN104372019B (en) | Turn cultivation, authentication method and the application of CmWRKY48 gene Cut Flower Chrysanthemum Morifoliums | |
| CN110373417A (en) | Cotton GhMADS41-A04 gene is promoting the application in flowering of plant | |
| CN110205333A (en) | Construction method and the application of corn dwarfing induced gene P3a and its genetic conversion system | |
| CN115772212A (en) | Alfalfa chloroplast MsSAP22 gene and application thereof in improving drought resistance of plants | |
| CN113461674B (en) | Amide compound for promoting plant root growth and preparation method and application thereof | |
| CN110106269A (en) | Bna-miR156d is in the control developmental application of cabbage type rape branch | |
| CN102643829B (en) | Rice yield gene GY6 clone and application thereof | |
| CN108220292A (en) | Rice microRNA os-miR171b genes and the application in rice yield is increased | |
| CN109929850A (en) | Anti- nematode Cotton Transformation event GHP10 | |
| CN108220291A (en) | Rice microRNA os-miR171b and the application in lodging resistance in rice | |
| CN104513831B (en) | Method for promoting plant growth | |
| CN105886527A (en) | Agrobacterium tumefaciens mediated transformation system for efficiently obtaining transgenic plants of paspalum vaginatum and application thereof | |
| CN111793624A (en) | Oligo DNA group of sgRNA for site-directed knockout of rice Osaurora1 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |