CN113461674B

CN113461674B - Amide compound for promoting plant root growth and preparation method and application thereof

Info

Publication number: CN113461674B
Application number: CN202110908208.3A
Authority: CN
Inventors: 张世忠; 束靖; 雷康; 郑成超; 吴长艾; 马晓君; 李攀; 李菡
Original assignee: Shandong Agricultural University
Current assignee: Dongying Ligo Agricultural Technology Co ltd
Priority date: 2021-08-09
Filing date: 2021-08-09
Publication date: 2022-05-13
Anticipated expiration: 2041-08-09
Also published as: CN113461674A

Abstract

The invention provides an amide compound for promoting plant root growth, and a preparation method and application thereof. The amide compound has a structural general formula shown as the following, wherein X is selected from C, S or O; r is selected from furyl, phenyl, alkoxyphenyl, benzyl, halobenzyl or alkylbenzyl. The preparation method of the amide compounds is simple, and experimental verification shows that the amide compounds XA-9, XA-19 and EZ-12 have the effect of promoting the growth of plant roots, especially the amide compounds XA-9 and XA-19 can also improve SOD enzyme activity and POD enzyme activity to improve the stress tolerance of plants, and can improve various genes in a plant hormone signal transduction pathway to further improve the growth and development of the plants, thereby laying a foundation for the search of plant root regulation marker genes and the improvement of genetic breeding.

Description

Amide compound for promoting plant root growth and preparation method and application thereof

Technical Field

The invention belongs to the field of plant growth regulators, and particularly relates to an amide compound for promoting plant root growth, and a preparation method and application thereof.

Background

The apple is the first fruit in China, and the cultivation area and the yield of the apple are in the top of the world. The key of orchard management by regulating and controlling root system configuration is the core of high-quality and high-yield apples. The root system configuration is changed mainly by means of root system pruning and water and fertilizer regulation so as to achieve an ideal root system form. The chemical synthesis of green micromolecule regulating compound and its application in apple industry are the leading edge of apple engineering application technology.

The growth of the root system is closely related to the functions of absorption, storage, synthesis, fixation, perception and the like of the root system. The regulation of the growth of the root system is beneficial to the function of the root system, thereby promoting the growth of the overground part and improving the stress resistance of the plant. Because the root system of the fruit tree is complex, most of the root system is deep into the ground, the research on the root system is less, and the root system is far less than that of the overground part which is deep and comprehensive. Moreover, the root growth and physiological function of the apple are easily affected by the environment and sensitive to the environmental change. When the plants are stressed, the root length, the root surface area, the average root diameter, the total root volume, the number of root tips and the like of the roots are all reduced, so that the growth and development of the apples are influenced, and the yield and the economic benefit are further influenced.

Amide compounds are compounds produced by substituting hydrogen on nitrogen atoms of ammonia or amines with acyl groups, and are commonly used as herbicides, bacteriostats and pesticides. At present, the amide compounds with functions of promoting the growth and development of plants are only reported.

Disclosure of Invention

The invention provides an amide compound for promoting plant root growth, and a preparation method and application thereof. The amide compound has a novel structure and a simple preparation method, and has the effects of promoting the growth of apple roots and improving the stress tolerance of the apple roots, so that the better growth of apple plants is promoted, and the yield of apples is increased.

In order to realize the purpose of the invention, the invention adopts the following technical scheme to realize:

the invention provides an amide compound for promoting plant root growth, which has a structural general formula as follows:

，

wherein X is selected from C, S or O; r is selected from furyl, phenyl, alkoxyphenyl, benzyl, halobenzyl or alkylbenzyl.

Further, the amide compounds are compounds EZ-1, EZ-9, EZ-11, EZ-12, SZ-7, XA-2, XA-9, XA-12, XA-18 and XA-19, and the structural formula is as follows:

。

the invention also provides a preparation method of the amide compound, which is characterized by comprising the following steps:

(1) dissolving trimellitic anhydride a in glacial acetic acid, adding substituted amine b, heating to 120 ℃ for reaction for 12 h, cooling to room temperature after the reaction is finished, separating out a large amount of solids, performing suction filtration, washing with water, collecting the solids, and performing vacuum drying to obtain a compound c;

(2) dissolving the compound c in dichloromethane, adding oxalyl chloride and dimethylformamide, reacting at room temperature for 12 h, and draining the solvent to obtain acyl chloride d;

(3) dissolving acyl chloride d in dichloromethane, adding triethylamine, 4-dimethylaminopyridine and a compound e, reacting at room temperature for 12 h, after the reaction is finished, adding 50 mL of water into a reaction system, separating an organic phase, respectively washing the organic phase with HCl and saturated sodium chloride, finally drying with anhydrous sodium sulfate, and purifying an obtained crude product by using a silica gel column after drying to obtain amide compounds EZ-1, EZ-9, EZ-11, EZ-12, SZ-7, XA-2, XA-9, XA-12, XA-18 and XA-19;

wherein the structural formulas of the trimellitic anhydride a, the substituted amine b, the compound c, the acyl chloride d and the compound e are respectively as follows:

、

、

、

、

；

wherein R is selected from furyl, phenyl, methoxyphenyl, benzyl, chlorobenzyl or methylbenzyl; x is selected from C, S or O.

Further, the preparation method of the amide compound is characterized by comprising the following steps:

(1) dissolving trimellitic anhydride a in glacial acetic acid, adding p-methoxybenzylamine, 3-methylbenzylamine or chlorobenzylamine, heating to 120 ℃ for reaction for 12 hours, cooling to room temperature after the reaction is finished, separating out a large amount of solids, performing suction filtration, washing with water, collecting the solids, and performing vacuum drying to obtain a compound c;

(3) dissolving acyl chloride d in dichloromethane, adding triethylamine, 4-dimethylaminopyridine and a compound e, reacting at room temperature for 12 hours, after the reaction is finished, adding 50 mL of water into a reaction system, separating an organic phase, respectively washing the organic phase with HCl and saturated sodium chloride, finally drying with anhydrous sodium sulfate, and purifying the obtained crude product with a silica gel column to obtain amide compounds XA-9, XA-19 or EZ-12;

wherein the structural formulas of the trimellitic anhydride a, the compound c and the acyl chloride d are respectively as follows:

、

、

；

wherein the compound e is 2-oxazolone, 2-thiazolone or 2-pyrrolone;

wherein R is selected from 3-chlorobenzyl, 4-methoxybenzyl or 3-methylbenzyl.

The invention also provides application of the amide compound in preparation of a growth regulator for promoting plant root growth.

Further, the amide compound is used at a concentration of 2 nM to 50 nM.

Preferably, the optimal concentration of the amide compound is 10 nM.

Further, the amide compounds are compounds XA-9, XA-19 and EZ-12.

Further, the use method of the amide compound is as follows: the amide compounds and water or additives are prepared into uniform solution or suspension, the plants are watered once every 8 to 12 days, and the roots are watered with clear water at other times.

Further, the additives comprise fertilizers, trace elements, pesticides and bactericides.

Further, the amide compound promotes the growth of plants on the ground by promoting the growth of underground root systems of the plants.

The invention also provides application of the amide compound in preparation of a preparation for improving plant stress tolerance.

Further, the amide compounds XA-9 and XA-19 can improve the stress tolerance of plants by improving the activities of SOD and POD enzyme in root systems of the plants.

The invention also provides application of the amide compound in preparing an expression promoter for regulating and controlling a plant hormone signal transduction gene.

Further, the gene includesTIR1、IAA31、GH3、LAX2、ARR9、ERF1、BSK2、MYC2。

Further, the amide compounds XA-9 and XA-19 are up-regulatedTIR1The expression of the gene can improve the length of the main root and the density of the lateral root of the plant.

Further, the plant is apple.

Compared with the prior art, the invention has the following advantages and beneficial effects:

1. several amide compounds with novel structures capable of regulating the growth of apple roots are synthesized and screened, XA-9 can promote the elongation of main roots at three concentrations of 2 nM, 10 nM and 50 nM, the effect of low promotion and high inhibition is achieved on lateral roots, the density of the lateral roots is highest at 10 nM, and the lateral roots grow ectopically at 50 nM; XA-19 has low promoting and high inhibiting effect on main root elongation, and the main root length is increased and then decreased along with the increase of concentration; EZ-12 can promote root growth.

2. Experiments prove that XA-9 can promote tissue culture rooting, and increase the tissue culture rooting rate, the number of adventitious roots, the number of lateral roots, the root length and the root activity; XA-9 and XA-19 promote the root growth of the tissue culture transplanted seedling, increase the root length, the number of root tips, the activity of the root system, the SOD enzyme activity and the POD enzyme activity.

3. The invention also verifies that XA-9 and XA-19 regulate root growth through a phytohormone signal transduction pathway and regulate auxin signal pathwayTIR1The main root length and the lateral root density of the over-expression are increased, so that a foundation is laid for searching of apple root system regulation marker genes and genetic breeding improvement, the growth and development of overground apple plants are promoted, the early-term high yield of apples is realized, and the economic benefit is improved.

Drawings

FIG. 1 shows the influence of novel amide compounds on the root system configuration of seedlings of Malus hupehensis Rehd.

FIG. 2 is a graph showing the effect of varying concentrations of compounds XA-9 and XA-19 on the growth of the root system of Malus hupehensis, (A) 'Malus hupehensis' seedlings were grown for 10 days on 1/2 MS medium supplemented with varying concentrations of compounds; (B) counting the length of a main root; (C) the effect of XA-9 concentration on lateral root density; (D) root tip impaired phenotype.

FIG. 3 shows the effect of compounds XA-9 and XA-19 on rooting of Malus hupehensis tissue culture; (A) the tissue culture seedling of the Malus hupehensis Rehd is rooted for 50 days in a rooting culture medium added with a compound; (B) the number of adventitious roots; (C) the number of lateral roots; (D) total length of root system; (E) the root system is active.

FIG. 4 shows the effect of compounds XA-9 and XA-19 on the root growth of tissue-cultured seedlings of Malus hupehensis Rehd; (A) the phenotype of the root system of the Malus hupehensis Rehd after the compound treatment; (B) total length of root system; (C) the number of root tips; (D) the root system is active.

FIG. 5 is a graph showing the effect of compounds XA-9 and XA-19 on the enzyme activity of the root system of a tissue culture transplanted seedling; (A) influence on the SOD enzyme activity of the root system of the tissue culture transplanted seedlings; (B) influence on the activity of POD enzyme of the root system of the tissue culture transplanted seedling.

FIG. 6 shows the effect of compounds XA-9 and XA-19 on the expression of various genes.

FIG. 7 is a drawing showingTIR1The effect of overexpression on root architecture; (A) phenotype of control and over-expressed strains grown on 1/2 MS medium for 2 months; (B) control (empty vector transformation) and overexpression linesTIR1The expression level of the gene; (C) the length of the main root; (D) number of lateral roots.

Detailed Description

The technical solution of the present invention will be further described in detail with reference to the following specific examples. In the following examples, unless otherwise specified, the experimental methods used were all conventional methods, and materials, reagents and the like used were all available from biological or chemical reagents companies.

Example 1: preparation of novel amide compounds

The synthetic route of the novel amide compound is as follows:

The specific preparation method of the novel amide compound comprises the following steps:

(1) dissolving trimellitic anhydride a (5 mmol, 1.0 eq) in 100 mL glacial acetic acid, then adding corresponding amine b (5 mmol, 1.0 eq), heating to 120 ℃ and reacting for 12 h; and (3) tracking the reaction by thin-layer chromatography (TLC), cooling to room temperature after the reaction is finished, separating out a large amount of solid, performing suction filtration, washing with water, collecting the solid, and performing vacuum drying to obtain a compound c.

(2) Dissolving a compound c (1 mmol, 1.0 eq) in 50 mL dichloromethane, adding oxalyl chloride (2 mmol, 2.0 eq) and 1 drop of Dimethylformamide (DMF), reacting at room temperature for 12 h, and draining the solvent to obtain acyl chloride d; the acid chloride d was directly subjected to the next reaction without purification.

(3) The acid chloride d (1 mmol, 1.0 eq) was dissolved in 50 mL of Dichloromethane (DMC) and triethylamine (Et) was added₃N, 2 mmol, 2.0 eq), 4-dimethylaminopyridine (DMAP, 0.01mmol, 0.01 eq) and a compound e (selected from 2-oxazolone, 2-thiazolone or 2-pyrrolidone, 1mmol, 1.0 eq) react for 12 hours at room temperature, TLC tracks the reaction, after the reaction is finished, 50 mL of water is added into the reaction system, an organic phase is separated, and is respectively washed by 1 mol of HCl and saturated sodium chloride, and finally dried by anhydrous sodium sulfate.

(4) The solvent was spin-dried under reduced pressure, and the obtained crude product was purified by a silica gel column (petroleum ether: ethyl acetate =2: 1) to obtain the amide-based compound f.

10 novel amide compounds are prepared by the method, and the specific chemical structures are shown in table 1.

Table 1: chemical structure of 10 novel amide compounds

Numbering	Full scale	Structural formula (I)	Molecular weight
				EZ-1	5- (2-oxooxazolidine-3-carbonyl) -2-benzene Isoindoline-1, 3-dione	336.30
EZ-9	2- (4-methoxyphenyl) -5- (2-oxazole) Alkane-3-carbonyl) isoindoline-1, 3-dione		366.33
				EZ- 11	3-2-2-chlorobenzyl-3-methyl-1-oxy Substituted isoindoline-5-keto) oxazole azo-ketone 2-ketones	382.80
EZ- 12	2- (3-chlorobenzyl) -5- (2-oxazolidine-3- Carbonyl) isoindoline-1, 3-dione		384.77
				SZ-7	2- (furan-2-methyl) -5- (2-oxothia-2-ones Oxazolidine-3-carbonyl) is indoline-1, 3-bis Ketones	356.35
XA-2	2-benzyl-5- (2-oxapyrrolidine-1-carbonyl) Yl) isoindoline-1, 3-dione		348.36
				XA-9	2- (4-methoxybenzyl) -5- (2-oxo Thiazolidine-3-carbonyl) isoindoline-1, 3- Diketones	396.42
XA- 12	2-（3-Chlorobenzyl) -7- (2-oxopyrrole Alkyl-1-carbonyl) -2, 3-dihydroisoquinoline- 1, 4-diketones		396.83
				XA- 18	2- (2-methylbenzyl) -5- (2-oxopyrrole- 1-carbonyl) isoindoline-1, 3-diones	362.39
XA- 19	2- (3-methylbenzyl) -5- (2-oxypyridine) Pyridine-1-carbonyl) isoindoline-1, 3-dione		362.39

Example 2: influence of novel amide compounds on growth of Malus hupehensis Rehd root system

1. Cultivation of plant material

(1) Seedling raising of seedling

Sterilizing Malus hupehensis Rehd seed with sodium hypochlorite for 7 min, and repeating for 3 times; adding 75% alcohol, and washing for 1 time; finally, the mixture is washed for more than 6 times by using sterile water. After sterilization, the seeds were spread on agar plates under aseptic conditions, placed in the dark and stacked at 4 ℃ for 40 days. Taking out after germination, and culturing in an illumination incubator at 25 ℃ under 16 h illumination/8 h dark condition.

(2) Tissue culture seedling subculture

The tissue culture seedlings are subcultured once every 30 days, stem sections with axillary buds are cut off during subculture, the cut stem sections are transferred into a new subculture medium (MS culture medium + 6-benzylamino adenine 0.5 mg/L + indolebutyric acid 0.05 mg/L), and the subculture medium is placed in an illumination incubator at the temperature of 25 ℃ under the condition of 16 h illumination/8 h dark.

(3) Pot experiment

Transferring the rooted tissue culture seedlings to a greenhouse, and hardening the seedlings for 5 days without opening a bottle mouth under strong illumination; then uncovering the cover and hardening the seedlings for 2 days. Sterilizing the matrix and vermiculite, mixing according to the ratio of 2:1, pouring into a seedling culture plate, and adding carbendazim for soaking. Taking out the rooted seedlings, washing the culture medium with clear water, transplanting, covering a plastic film for moisturizing, shading, culturing in a constant-temperature culture chamber for two weeks, and transferring the rooted seedlings to a greenhouse.

2. Novel amide compounds capable of influencing root growth of Malus hupehensis Rehd are screened

Transferring the seedlings of the Malus hupehensis Rehd with basically consistent root length to 1/2 MS culture medium added with 10 nM novel amide compound to grow for 10 days, adding clean water with the same amount into a control group, analyzing and processing by using a plant magnetic resonance imaging technology and a Detta-T SCAN root system analysis system, and measuring the root length.

As shown in FIG. 1, the compounds XA-9, XA-19 and EZ-12 are all found to promote root growth, the root length is respectively increased by 52.9%, 112.5% and 24.8% compared with the control, and the influence of other amide compounds on the root length is not reached to a significant level. The increase in root length of XA-9 and XA-19 in these 3 compounds was over 50%, so that subsequent experiments were mainly developed with these two compounds.

3. Effect of concentration of Compounds XA-9 and XA-19 on root growth of Malus hupehensis

To investigate whether the compounds XA-9 and XA-19 have low-concentration promoting and high-concentration inhibiting effects on the root growth of Malus hupehensis, three concentrations of 2 nM, 10 nM and 50 nM were set for the experiments, respectively. Specifically, seedlings of the Malus hupehensis Rehd with basically consistent root system length are respectively transferred to 1/2 MS culture media added with 2 nM, 10 nM or 50 nM compounds XA-9 or XA-19 to grow for 10 days, the same amount of clear water is added to a control group, the plant magnetic resonance imaging technology and a Detta-T SCAN root system analysis system are utilized to carry out analysis processing, and the growth condition of the root system is detected.

As shown in FIG. 2, compounds XA-9 and XA-19 promoted elongation of the main roots at three concentrations of 2 nM, 10 nM and 50 nM, but had different effects on lateral root density. XA-9 started to promote lateral root development at 2 nM; the effect of promoting the growth of lateral roots is best when the molecular weight is 10 nM; the root tip growth of the main root was impaired when the concentration reached 50 nM, and lateral roots were born near the root tip. The compound XA-19 has the effects of promoting the growth of the main roots at low concentration and inhibiting the growth of the main roots at high concentration, namely the compound XA-19 promotes the growth of the main roots at 2 nM, and the increase is 76.9% compared with the control; the effect of promoting elongation of the main root is the best at 10 nM, which is increased by 136.2% compared with the control, and lateral roots begin to grow; the boosting effect completely disappeared when the concentration reached 50 nM, and the length of the main root decreased by 1.1% compared to the control.

4. Effect of Compounds XA-9 and XA-19 on rooting of tissue culture seedlings of Malus hupehensis

Transferring the tissue culture seedlings of the Malus hupehensis Rehd to a rooting culture medium for culture, applying a compound XA-9 or XA-19 with the concentration of 10 nM every 10 days, applying an equal amount of clear water to a control group, supplementing water to each group in the rest time by the clear water, taking out the tissue culture seedlings after 50 days of culture, counting the number of adventitious roots, calculating the rooting rate and determining the root activity by using a TTC reduction method.

As shown in FIG. 3, it was found that addition of compounds XA-9 and XA-19 to the rooting medium significantly promoted the generation of adventitious roots, but had a different effect on the density of lateral roots. Compared with a control, the compounds XA-9 and XA-19 respectively improve the rooting rate by 13.8 percent and 20.7 percent; the number of adventitious roots is respectively increased by 64.3 percent and 60.5 percent compared with the control. In contrast, on the adventitious roots induced by XA-9, the density of lateral roots is increased by 62.3 percent compared with that of the control, and the total root length is increased by 39.9 percent; and the adventitious roots induced by XA-19 are basically free of lateral roots, the number of the lateral roots on the adventitious roots is reduced by 95.0 percent and the root length is reduced by 44.5 percent compared with a control group. In addition, compared with the control, the root activity is improved by 21.8% after the XA-9 treatment, and the root activity is reduced by 9.9% after the XA-19 treatment, and the result is caused because the XA-9 treatment increases the growth of the adventitious roots and the lateral roots of the tissue culture seedlings, and a large amount of newly grown roots improve the root activity.

5. Effect of Compounds XA-9 and XA-19 on the growth of tissue culture transplanted seedlings

Transferring the rooted seedlings to a greenhouse, applying a compound XA-9 or XA-19 with the concentration of 10 nM once every 10 days, supplementing water with clear water for the rest of time, culturing for 60 days, completely taking out the roots of the Malus hupehensis Rehd, washing to be clean, and measuring the growth condition of the roots.

The result is shown in figure 4, and the results show that XA-9 and XA-19 both significantly promote the root growth of the tissue culture transplanted seedling of the Malus hupehensis Rehd. Compared to the control, XA-9 and XA-19 treatments increased the total root length by 86.5% and 15.2%, respectively; the number of the root tips is respectively increased by 75 percent and 17.8 percent; the root activity is respectively increased by 86.9 percent and 24.3 percent. The results show that XA-9 and XA-19 have promotion effect on the root growth of the Malus hupehensis Rehd, and the effect of XA-9 is superior to that of XA-19.

6. Effect of Compounds XA-9 and XA-19 on enzyme Activity in root systems of tissue culture transplanted seedlings

Under the normal growth condition of the plant, the generation and elimination of active oxygen in the body are in a dynamic equilibrium state. Under the adverse conditions, the capacity of an antioxidant enzyme system for removing active oxygen is reduced, and the accumulated active oxygen causes damage to plants and influences the normal growth and metabolism of the plants. SOD and POD are important antioxidant enzymes in plants, and can reduce the damage of active oxygen to the plants. Therefore, the SOD and POD enzyme activities can directly reflect the stress tolerance of plants.

Obtaining the root system of the Malus hupehensis Rehd cultured for 60 days, and detecting the activities of SOD and POD enzyme in the root system of the Malus hupehensis Rehd by referring to the experimental method in the plant physiological and biochemical experimental principle and technology.

The results are shown in fig. 5, the SOD enzyme activity in the root system of the Malus hupehensis Chun ' treated by XA-9 and XA-19 is respectively improved by 39.9% and 34.5% compared with the control, which shows that XA-9 and XA-19 can improve the SOD enzyme activity in the root system of the Malus hupehensis Chun ' and enhance the stress resistance of the Malus hupehensis Chun '. After the root system of the Malus hupehensis Rehd is treated by the compounds XA-9 and XA-19, the POD enzyme activity is higher than that of a control group, and is respectively increased by 110.3% and 124.2%, which indicates that the compounds XA-9 and XA-19 can induce the root system resistance of the Malus hupehensis Rehd, thereby promoting the growth of the Malus hupehensis Rehd. Therefore, XA-9 and XA-19 can promote the root growth of the tissue culture transplanted seedlings, and improve the activity of the root system, the SOD enzyme activity and the POD enzyme activity, so that the accumulation of active oxygen is reduced, the stress resistance of plants is enhanced, and the stress tolerance of the plants is improved.

Example 3: effect of novel amide Compounds on Gene expression in the auxin pathway

First, acquisition of transgenic root system

1. Extraction of plant RNA

(1) Grinding 100 mg of plant (Malus hupehensis Rehd) tissue in liquid nitrogen into powder, adding 700 muL Buffer RLS (adding beta-mercaptoethanol), immediately vortexing, violently shaking and mixing uniformly, and centrifuging at 12000 rpm at 4 ℃ for 10 min.

(2) Transferring the supernatant into a filter column FS, centrifuging at 4 ℃ and 12000 rpm for 5min, sucking the supernatant in a collecting tube, and transferring the supernatant into a new RNase-Free centrifuge tube.

(3) And slowly adding absolute ethyl alcohol with the volume of 0.5 time of the supernatant, uniformly mixing, and transferring the obtained solution and the precipitate into an adsorption column RM. Centrifuging at 12000 rpm at 4 deg.C for 5min, and discarding waste liquid.

(4) 350 μ L Buffer RW1 was added to the adsorption column RM and centrifuged at 12000 rpm at 4 ℃ for 1 min.

(5) Preparing DNase I mixed solution: taking 52 mu L RNase-Free Water, adding 8 mu L10 × Reaction Buffer and 20 mu L DNase I into the 52 mu L RNase-Free Water, preparing a Reaction solution of 80 mu L, and placing the Reaction solution at 4 ℃.

(6) Directly adding 80 muL of DNase I mixed solution into the adsorption column, incubating for 15 min at 20-30 ℃, and then

Adding 350 mu L Buffer RW1, centrifuging at 4 ℃ and 12000 rpm for 1 min, discarding the waste liquid, adding 500 mu L Buffer RW2, centrifuging at 4 ℃ and 12000 rpm for 1 min, discarding the waste liquid, and centrifuging at 4 ℃ and 12000 rpm for 2 min to completely remove the ethanol.

(7) And (3) putting the adsorption column RM into a new centrifugal tube, hanging and dropwise adding 50 muL RNase-Free Water to the middle part of the adsorption membrane, standing at room temperature for 2 min, and centrifuging at 4 ℃ and 12000 rpm for 1 min to obtain an RNA solution, and storing the RNA solution at-80 ℃.

2. Reverse transcription

After the concentration of the obtained RNA solution is determined, reverse transcription is carried out according to the amount of 1 mug. The components of the reaction system for removing the genome DNA are mixed and reacted at 42 ℃ for 2 min to remove the genome DNA. The reverse transcription system components were added to the RNA solution from which the gDNA component was removed, and the reaction was carried out at 37 ℃ for 15 min and 85 ℃ for 15S in PCR. The cDNA obtained was stored at-20 ℃.

The genome DNA removing reaction system comprises: 2 mu L5 XgDNA Evaser Buffer; 1 mu L gDNA Evaser; 1 mug of total RNA and 10 muL of RNase-Free water are supplemented;

the reverse transcription system comprises: 4 mu L5 × Primer Suript Buffer 2; 1 μ L Primer RT Enzyme Mix 1; 4 μ L RT Primer Mix; 1 μ L of RNase-Free water.

3. Fluorescent quantitative PCR

The RT-qPCR reaction system is as follows: 7.5 μ L SYBR; 10 μ M forward/reverse primers of 0.3 μ L each; 5 muL cDNA; 1.9 μ L RNase-Free water.

Setting an RT-qPCR program: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5s, annealing at 60 ℃ for 15s, extension at 72 ℃ for 20s, and repeating for 40 cycles; extension was 65 ℃ for 5 s.

The primers used are as follows in table 2:

table 2: primer sequences

Name of primer	Upstream primer (5 '-3')	Downstream primer (5 '-3')
			TIR1	GCTCTCAGGTTTAGAGAAA	GACTGTCATCACCATTTTC
IAA31	TCTGCTTTGATTTCAACG	ACGGTGGTCAAGAATATC
			GH3.17	CAGCATTATGGAGCAATG	CCATGAGTGCATCAAAAG
LAX2	GAGGATGGATAGGATCATAC	TGGTGTACAAAGTTCGTAA
			ARR9	CCTCCGTCACTATTCTTC	CTTCCTCCTGCTAATACC
ERF1	GAGTCTCTTCAGGAAATCA	GGCTAACTGGTTTATTACAC
			BSK2	CCAAGATATGTTGAACACAA	GCATCGCATCTCTTAAAG
MYC2	TCCGAGAATGTGAACTAC	CTCTCTTCACTTCTCATGTTA
			18S rRNA	TAACGAGGATCCATTGGAGG	CCTCCAATGGATCCTCGTTA
TIR1-pROKⅡ	ACGGGGGACTCTAGAGGATCCATGGATTCCCAAAGAAAGAAGGTTCTGG	GCCCTTGCTCACCATGGTACCGAAGGTGAGAACAAAAGCCGGGG

4. Expression vector construction

(1) Amplification of DNA of target Gene

Carrying out DNA amplification by using a DNA amplification reaction system, wherein the DNA amplification reaction system comprises: 25 mu L2 × Phanta Max Buffer; 1 mu L dNTP Mix; 2 muL of each upstream/downstream primer; 1 μ L Phanta Max Super-Fidelity DNA Polymerase; 2 muL cDNA template; and adding double distilled water to 50 mu L.

Setting a DNA amplification program: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 50-60 ℃ for 15s, extension at 72 ℃ for 30 s/kb, repeating 35 cycles; extension was carried out at 72 ℃ for 5 min.

After the reaction, 10 × Loading Buffer was added, 1% agarose gel electrophoresis was performed, the band of interest was cut off, and the cut band was placed in a 1.5 mL centrifuge tube for gel recovery.

(2) Transformation of E.coli

And (3) restriction enzyme digestion: carrying out restriction enzyme digestion on the DNA solution obtained by gel recovery, wherein the reaction system is as follows: 2 muL Buffer; 1 muL restriction enzyme; 10 μ L of vector/gene; and adding double distilled water to the volume of 20 mu L. After mixing uniformly, react for 2 h at 37 ℃. After the reaction was completed, the restriction enzyme was inactivated at 85 ℃ for 2 min.

Homologous recombination and connection: the homologous recombination reaction system is as follows: 5 μ L2 × Easyfusion Assembly Master mix; 10-50 ng of linearized vector; 20-50 ng of insert; and adding double distilled water to 10 mu L. The components of the system are mixed evenly and reacted for 30 min at 50 ℃.

Preparation of E.coli TOP 10 competence: taking TOP 10 competence preserved at-80 deg.C, streaking with sterile inoculating loop in LB solid medium in three zones, and inverting in 37 deg.C incubatorThe culture was carried out overnight. The well grown monoclonal colonies were selected and inoculated in 25 mL LB medium and shake-cultured at 37 ℃ for 6-8 h at 200 rpm. Inoculating 2 mL of the bacterial liquid into 250 mL of LB liquid medium, and shake-culturing OD at 18 ℃ and 200 rpm₆₀₀To about 0.55. The bacterial liquid is transferred to a 80 mL centrifuge tube, ice-cooled for 10 min, centrifuged at 4000 rpm at 4 ℃ for 10 min, and the supernatant is discarded. 50 mL of 0 ℃ Inoue transformation buffer was used for resuspension, centrifugation was carried out at 4 ℃ and 4000 rpm for 10 min, and the supernatant was discarded. The suspension was shaken by hand using 16 mL of 0 ℃ Inoue transformation buffer, and 1.2 mL of DMSO was added and shaken. And (3) subpackaging competence by using a 1.5 mL centrifuge tube, subpackaging each tube by 50 mu L and quickly putting the tube into liquid nitrogen, and storing the obtained competence at-80 ℃. Wherein, Inoue transformation buffer (1L): 10.88 g MnCl₂‧4H₂O，2.2 g CaCl₂‧2H₂O，18.65 g KCl，20 mL 0.5 mol/L PIPES。

Transformation of E.coli: taking the competence of the escherichia coli, and placing the competence on ice for thawing. And adding 10 mu L of plasmid to be transformed, sucking and beating the mixture gently and mixing the mixture evenly, and carrying out ice bath for 20-30 min. The mixture was heat-shocked at 42 ℃ for 90 s, immediately taken out, and ice-cooled for 2 min. 1 mL of LB liquid medium was added to a clean bench and cultured at 37 ℃ and 200 rpm for 1 hour. Centrifuging at 8000 rpm for 1 min, discarding part of supernatant, sucking the rest bacteria liquid, mixing, and spreading on LB solid culture medium containing corresponding antibiotics. Inverted culturing at 37 ℃ for 12-16 h, picking up spots, and screening positive colonies by bacterial liquid PCR.

(3) Plasmid extraction

And adding 200 mu L Buffer CBS into the DNA adsorption column, centrifuging at 12000 rpm for 1 min, pouring waste liquid in the collection pipe, and putting the adsorption column back into the collection pipe for later use. 2-4 mL of the bacterial solution is taken, centrifuged at 12000 rpm for 1 min, and the supernatant is discarded. Adding 250 mu L Solution I to fully suspend the thalli. Adding 250 mu L Solution II, immediately and gently and fully turning and mixing the mixture up and down for 6-8 times to fully crack the thalli until a transparent egg white-shaped Solution is formed. Adding 350 mu L Solution III, gently and fully overturning and mixing the mixture up and down for 8-10 times, standing the mixture at room temperature for 2-5 min, and centrifuging the mixture at 12000 rpm for 10 min. The supernatant was transferred to an adsorption column, centrifuged at 12000 rpm for 1 min, and the waste liquid was discarded. Adding 500 mu L W1 Solution, centrifuging at 12000 rpm for 1 min, and discarding the waste liquid. Adding 600 mu L of Wash Solution, centrifuging at 12000 rpm for 1 min, discarding the waste liquid, repeating the previous step, centrifuging at 12000 rpm for 2 min, completely removing the Wash Solution, and opening the cover to stand for 10 min. The adsorption column was placed in a 1.5 mL centrifuge tube, 50-100 μ L of precipitation Buffer was added to the center of the membrane of the adsorption column, placed at 37 ℃ for 2 min to remove ethanol, centrifuged at 12000 rpm for 1 min to collect plasmids, and stored at-20 ℃.

(4) Transformation of Agrobacterium rhizogenes

Preparation of agrobacterium rhizogenes K599 competence: taking K599 strain preserved in an ultralow temperature preservation box at minus 80 ℃, marking a three-region line on YEP solid culture medium containing 500 mg/L streptomycin by using a sterile inoculating loop, and inversely placing the streaked line in a constant temperature incubator at 28 ℃ for culturing for 36 h. Monoclonal plaques were picked and inoculated into 5 mL YEP broth and shake-cultured at 28 ℃ at 200 rpm for 4 h. 5 mL of the bacterial solution was added to 100 mL of YEP liquid medium containing no antibiotics, and shake-cultured at 200 rpm and 28 ℃ for 24 hours. And (3) subpackaging the cultured bacterial liquid into 80 mL centrifuge tubes, centrifuging at 5000 rpm for 10 min, suspending the thalli by using YEP liquid culture medium without antibiotics, sucking a proper amount of bacterial liquid into 200 mL YEP liquid culture medium, and performing shaking culture at 28 ℃ and 200 rpm. Measuring the concentration of the bacterial liquid by using an ultraviolet spectrophotometer, and selecting OD₆₀₀Subsequent experiments were performed with 0.5-0.8 bacteria. The bacterial solution was ice-cooled for 30 min, then centrifuged at 5000 rpm at 4 ℃ for 10 min, and the supernatant was decanted. 5-20 mL of TE was added, centrifuged at 5000 rpm for 10 min, and the supernatant was decanted. Adding 10-20 mL YEP liquid suspended thalli, subpackaging the thalli with a 1.5 mL centrifuge tube to obtain competence, subpackaging each tube with 50 mu L liquid nitrogen, and rapidly placing the tubes into liquid nitrogen to obtain competence for preserving at-80 ℃. For subsequent use. Wherein, TE (100 mL): 1 mL of 1 mol/L Tris-HCl, 200. mu.L of 0.5 mol/L EDTA (pH = 8.0).

And (3) transforming agrobacterium rhizogenes: the competence was removed from-80 ℃ and thawed on ice. Adding 1 muL expression vector plasmid, carrying out ice bath for 5min, carrying out liquid nitrogen quick freezing for 5min, carrying out heat shock at 37 ℃ for 5min, and carrying out ice bath for 5 min. Adding 1 mL YEP liquid culture medium into a clean bench, culturing at 28 deg.C and 200 rpm for 2 h, centrifuging at 8000 rpm for 1 min, discarding part of supernatant, sucking the rest bacteria liquid, mixing, spreading on YEP solid culture medium containing streptomycin (Agrobacterium rhizogenes resistance) and carrier resistance antibiotic, and culturing at 28 deg.C for 2-3 d.

5. Agrobacterium rhizogenes-mediated apple genetic transformation

(1) Cutting off stem sections with axillary buds of the tissue culture seedling with good growth state, transferring the stem sections into a subculture medium, and culturing for 30 days under the conditions of 25 ℃, 16 h of light and 8 h of darkness to obtain the subculture tissue culture seedling.

(2) 100 mu L of agrobacterium rhizogenes containing expression vector plasmids stored at-80 ℃ is added into 2 mL YEP liquid culture medium (500 mg/L streptomycin + plasmid resistance), and shake cultivation is carried out at 28 ℃ and 200 rpm for 8-12 h.

(3) 1 mL of the bacterial suspension was added to 20 mL of YEP liquid medium (500 mg/L streptomycin + plasmid resistance), and shake-cultured at 28 ℃ and 200 rpm for 4 hours.

(4) Adding 100 mu M acetosyringone, and continuously culturing for 2 h at 28 ℃ and 200 rpm by shaking.

(5) And (3) collecting thalli: centrifuging at 5000 rpm for 5min, discarding the supernatant,

(6) 20 mL of sterile water was added, and the mixture was centrifuged at 5000 rpm for 5min, and the supernatant was discarded.

(7) Preparing an infection liquid: adding 1/2 MS liquid culture medium with pH of 5.2 into 100 μ M acetosyringone, suspending thallus with a small amount of infection solution, adding the suspended thallus into the infection solution, and adding OD₆₀₀The control is between 0.2 and 0.3.

(8) Cutting off the front and back ends of the leaf of the tissue culture seedling, dipping the leaf in the staining solution once, spreading the leaf with the far axial surface downwards in 1/2 MS culture medium with pH of 5.2, and co-culturing with Agrobacterium rhizogenes at 22 ℃ for 3 d under dark condition.

(9) The co-cultured leaves were transferred to 1/2 MS medium pH 5.9 containing 500 mg/L timentin antibiotic and cultured at 25 ℃ for 16 h light/8 h dark. The medium with timentin antibiotic was changed every ten days until transgenic hairy root lines developed.

6. Transgenic root system identification

(1) Fluorescent identification

The fluorescence detection uses LUYOR-3415 excitation light source, blue light irradiation is used for observing green fluorescence, and LUV-30A yellow glasses are worn; the red fluorescence was observed using green illumination, with LUV-50A red glasses.

(2) PCR detection

After genome is extracted by adopting a CTAB method, PCR identification is carried out by utilizing a PCR identification system, wherein the PCR identification system is as follows: 2 mu L10 XTaq Buffer; 0.4 muL dNTP Mix; each 0.8 mu L upstream/downstream primer; 0.2 μ L of Taq DNA Polymerase; 1 muL of template DNA; and adding double distilled water to the volume of 20 mu L. Setting a PCR program: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30s, annealing at 50-60 ℃ for 30s, extension at 72 ℃ for 60 s/kb, and repeating for 35 cycles; extension was carried out at 72 ℃ for 5 min. After the reaction, 10 XLoading Buffer was added and 1% agarose gel electrophoresis was performed.

2. Effect of Compounds XA-9 and XA-19 on expression of multiple genes

The invention utilizes the transcriptome sequencing technology and RT-qPCR amplification to jointly detect the influence of the compounds XA-9 and XA-19 on various genes expressed in a plant hormone signal transduction pathway. As a result, as shown in FIG. 6, it was found that the compounds XA-9 and XA-19 were simultaneously upregulated in 8 genes, includingTIR1（Mh_030418）、IAA31（Mh_077331）、GH3.17（Mh_ 079914）、LAX2（Mh_077331）、ARR9（Mh_096771）、ERF1（Mh_032232）、BSK2（Mh_035118）、MYC2（Mh_002447). And the detection result of RT-qPCR shows that the trend of 8 gene expression changes is consistent with the sequencing data of the transcriptome, which shows that the detection result is accurate and has high reliability. The change of the gene expression can also influence the growth and development of the plant root system.

3、TIR1Influence on root growth

It was found by RT-qPCR that both XA-9 and XA-19 treatments induced auxin pathwaysTIR1Expression is up-regulated.TIR1Is located in the fifth chromosome (Mh _030418, Chr5B: 45914477-.

To verifyMhTIR1The invention has the function of root growth35S::MhTIR1-GFPAnd through rooting agricultureAnd transforming the 'Malus hupehensis Rehd' leaves by using the bacillus, and mixing, sampling, detecting and counting the generated transgenic roots. As a result, as shown in FIG. 7, it was found thatMhTIR1The length of the main root and the density of the lateral root of the overexpression strain are both higher than those of the control group. Thus, the compounds XA-9 and XA-19 can achieve the effect of promoting the growth of plant roots by up-regulating the expression of various genes in a plant hormone signal transduction pathway.

The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.

Claims

1. The amide compound for promoting the growth of plant roots is characterized by being a compound XA-9, XA-19 or EZ-12, and the structural formula of the amide compound is as follows:

、

、

。

2. the process for producing an amide-based compound according to claim 1, comprising the steps of:

(1) dissolving trimellitic anhydride a in an acid solution, adding substituted amine b, reacting at high temperature, filtering, washing with water, and drying the collected solid to obtain a compound c;

(2) dissolving the compound c in dichloromethane, adding oxalyl chloride and dimethylformamide for reaction, and draining the solvent to obtain acyl chloride d;

(3) dissolving acyl chloride d in dichloromethane, adding triethylamine, 4-dimethylaminopyridine and a compound e for reaction, then separating an organic phase, drying, and purifying a crude product to obtain amide compounds XA-9, XA-19 and EZ-12;

、

、

、

、

；

wherein R is as defined in claim 1; x is selected from C, S or O.

3. The use of amide compounds as claimed in claim 1 for the preparation of growth regulators for promoting the growth of plant roots.

4. The use according to claim 3, wherein the amide compound is used at a concentration of 2 nM to 50 nM.

5. The use according to claim 3, characterized in that the amide compound is used by a method comprising: the amide compounds and water or additives are prepared into uniform solution or suspension, the plants are watered once every 8 to 12 days, and the roots are watered with clear water at other times.

6. Use of the amide-based compound according to claim 1 for preparing a preparation for improving stress tolerance of plants.

7. The use as claimed in claim 6, wherein the amide compounds XA-9 and XA-19 are capable of increasing stress tolerance of plants by increasing SOD and POD enzyme activities in plant roots.

8. The use of the amide-based compound according to claim 1 for producing an expression promoter for regulating a plant hormone signal transduction gene.

9. Use according to claim 8, wherein said gene is TIR1, IAA31, GH3, LAX2, ARR9, ERF1, BSK2, MYC 2.