CN105802922A

CN105802922A - Establishing method of bacterial artificial chromosome recombinant duck plague virus rescue system platform and application

Info

Publication number: CN105802922A
Application number: CN201610244190.0A
Authority: CN
Inventors: 吴英; 汪铭书; 程安春
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2016-04-19
Filing date: 2016-04-19
Publication date: 2016-07-27

Abstract

The invention discloses an establishing method of a bacterial artificial chromosome recombinant duck plague virus rescue system platform and application of the platform. A bacterial artificial chromosome recombinant duck plague virus is obtained by inserting a recombinant duck plague virus transfer vector pUC18/EGFP-TKAB-BAC11 in a TK domain, wherein the recombinant duck plague virus transfer vector contains a TK gene left-right homologous arm, a reporter gene EGFP and a bacterial artificial chromosome core function component. By means of the platform, the in-vitro biologics characteristics of a UL55 gene-deleted strain established through an inside-bacterium two-step RED recombination method and a back mutation strain and parent strain of the UL55 gene-deleted strain are quite close; the functions are not related to positioning of a UL26.5 gene in a cell. The method is beneficial to development of pathogenic mechanism and gene function research of DPV CHv and is beneficial to the duck plague virus prevention and the research and application of recombinant duck plague virus vaccines of other poultry infectious diseases based on the platform; in addition, due to the fact that the recombinant virus carries a TK deletion mark and an EGFP gene, a mark vaccine can be developed to clinically distinguish a wild virus and a recombinant vaccine virus.

Description

A kind of construction method of bacterial artificial chromosome restructuring duck plague virus rescue system platform And application

Technical field

The application belongs to field of animal medicine, specifically, relates to a kind of bacterial artificial chromosome restructuring duck plague virus and saves Rescue construction method and the application of system platform.

Background technology

Duck pestilence (Duck Plague) is also known as duck viral enteritis (Duck viral enteritis, DVE), in China's custom Claim " epidemic infection with swollen head ", be duck, goose, swan, wild goose and other Anseriformes birds caused by duck plague virus (Duck Plague Virus) Acute, hot, septic, contagious disease.It is characterized in that blood vessel injury, organize hemorrhage, some is specific for alimentary canal mucous membrane Position has rash shape to damage, and specific lesions and the change of organa parenchymatosum's degeneration occurs in lymphoid organ.Ill duck faces examines performance Delaying for high heat, the green loose stool of row, bipod is benumbed, and sheds tears and the sick Caput Anas domestica swollen neck of part is big；Esophageal mucosa has hemorrhage, often has sallow Color pseudomembrane covers or ulcer, and cloaca mucosa is congested, hemorrhage, edema and pseudomembrane cover；Liver has the petechia and ash differed in size White necrosis region.Duck pestilence causes society's extensive concern with the mortality rate of up to 90% for many years.This disease spread speed quickly, adds Intensive duck culturing industry duck population density is high, flowing frequently, easily causes popular, and this disease at the after date that is very popular often in place Property popular, long-term hazards duck culturing industry, cause huge economic loss, oneself is through becoming the main epidemic disease of puzzlement China duck culturing industry development One of.

Duck plague virus China virulent strain (DPV CHv) as a member of herpes virus group, have huge genome and Complicated genome structure, encoding gene reaches 76 more than, and it is carried out the work of genetic manipulation and construction of recombinant virus particularly Difficulty.It is limited to most of gene merits of the restriction of research platform, the mechanism of causing a disease of current duck plague virus and its genome encoding Can still belong to unknown.The rise of functional genomics in recent years is greatly promoted the list copy bacteria artificial dye that big genome inserts The development of colour solid (Bacteria Artificial Chromosome, BAC) plasmid gene engineering.Hsv gene group The vast capacity that the existence of upper massive duplication dispensable gene and bacterial artificial chromosome can accommodate up to 300kb foreign DNA is excellent Potential energy is enough well matched with, and once the BAC of herpesvirus successfully constructs, and just can realize easily dashing forward any of viral gene Become.And all of mutation process can be effectively controlled in escherichia coli and analyze, cell classical by contrast Interior recombination analysis can only be fabricated at recombinant virus and carry out after purification.Meanwhile, the building process letter of BAC molecular cloning virus Single efficiently, cloning procedure that need not be complicated so that BAC becomes us and builds the optimum selection of restructuring duck plague virus.

At present, this technology is in multiple herpesvirus successful Application in succession, such as herpes simplex types 1 virus (Stavropoulos T A,Strathdee C A.An enhanced packaging system for helper- Dependent herpes simplex virus vectors [J] .J Virol, 1998,72:7137-7143.), people big and small Cellular virus (HCMV) (Wagner M, Ruzsics Z, Koszinowski U H.Herpesvirus genetics has come Of age [J] .Trends Microbiol, 2002,10 (7): 318 324.), cattle I type herpesvirus (is deposited, Ye Weicheng, king One one-tenth, etc. building and the cell proliferation characteristic of gN gene delection virus of cattle Ⅰpattern herpesvirus infectious bacteria artificial chromosome [J]. Science Bulletin, 2009,54 (24): 3823-3829.), Pseudorabies virus (Yin Wenling, Yin Longbo, Ye Weicheng, etc. pig is pseudo- The structure [J] of rabies virus Zhejiang strain infectious bacteria artificial chromosome clone. virus journal, 2010,26 (4): 331- 335.), (Cui Hongyu, Wang Yunfeng, Shi Xingming, etc. chicken Marek's disease virus 814 strain bacterial artificial chromosome for Marek's disease virus The structure [J] of body. biological engineering journal, 2008,24 (4): 569-575.) etc..

Recombinant virus for DPV builds, the most successful story.The required function element of BAC such as Wang J replaces DPV 2085 strain UL44 (gC) gene, successfully constructs the restructuring duck plague virus of gC disappearance, and with as vector expression HA gene (Wang J, the Osterrieder N.Generation of an infectious clone of H5N1 bird flu virus of duck enteritis virus(DEV)and of a vectored DEV expressing hemagglutinin of H5N1 avian influenza virus[J].Virus research,2011,159(1):23-31.).Zou Z etc. are respectively Insert the mini-F sequence of BAC in SORF3-US2 and the gB-UL26 region of DPV China Vaccine strain C-KCE, construct restructuring duck Pestivirus and with the envelope protein E of duck tembusu virus as vector expression and HA gene (1. Zou Z, the Liu of bird flu Z,Jin M.Efficient strategy to generate a vectored duck enteritis virus delivering envelope of duck tembusu virus[J].Viruses,2014,6(6):2428-2443；② Zou Z,Hu Y,Liu Z G,et al.Efficient strategy for constructing duck enteritiss virus-based live attenuated vaccine against homologous and heterologous H5N1avian influenza virus and duck enteritis virus infection[J].Vet Res,2015, 46(1):42.).Chen L etc. then insert BAC's between UL15B and the UL18 gene of duck plague virus China Vaccine strain C-KCE Mini-F sequence, and it has been internal protest test (Chen L, Yu B, Hua J, et al.Construction of a full-length infectious bacterial artificial chromosome clone of duck enteritis virus vaccine strain[J].Virology journal,2013,10(1):1.).But, the most still Have no the structure utilizing duck plague virus China virulent strain (DPV CHv) nonessential neurovirulence gene TK to carry out restructuring duck plague virus Report in terms of it carries out duck plague virus pathogenesis and gene functional research with application.

TK gene is early gene in known herpesvirus, and its product thymidine kinase is in thymus pyrimidine building-up process The enzyme of salvage pathway, is dTMP by phosphorylation thymus pyrimidine, and continue phosphorylation obtain dTTP with participate in DNA synthesis (Al- Madhoun etc., 2004；S K etc., 1985).In addition the major virulence gene of TK gene or herpesvirus, in herpesvirus man Race guards and is the dispensable gene of virus replication, and TK gene mainly appears on (Han during nervous tissue infects the earliest Deng, 2002；Mettenleiter etc., 2000；Redaelli etc., 2008；Gill etc., 2009).Numerous studies show TK gene Disappearance does not affect duplication and the function of virus, and the functional deficiency of TK additionally aids the virulence reducing virus simultaneously, develops into The potentiality of vaccine, additionally due to lack labelling with TK, it is also possible to develops into marker vaccine and distinguishes wild poison and restructuring clinically Vaccine virus.Therefore TK gene is used for building the bacteria artificial dye of duck plague virus China virulent strain TK gene delection as target gene Colour solid recombinant virus rescue system platform, in addition to beneficially carry out pathogenesis and the gene functional research of DPV deeper into ground, Also contribute to solve the virulence that attenuated vaccine strain itself exists and return the series of problems such as strong and lifelong viremia, novel for developing Bigeminy or multi-joint live vector vaccine lay the foundation, and have important application prospect.

Summary of the invention

In view of this, the application is for the problems referred to above, it is provided that a kind of bacterial artificial chromosome restructuring duck plague virus rescue The construction method of system platform, by by duck plague virus China virulent strain (DPV CHv) genomic clone up to about 162kb In bacterial artificial chromosome (BAC), the positive colony that electricity obtains after converting escherichia coli DH10B transfects duck embryo after extracting plasmid Fibroblast (DEF), saves out the bacterial artificial chromosome restructuring that can produce green fluorescence and plaque on host cell DEF Duck plague virus DEV CHv-BAC-G.Obtained recombinant virus DEV CHv-BAC-G, it is possible to virus form in intracellular existence, also Can replicate in escherichia coli with the form of plasmid so that we can use the genetic manipulation means that E. coli system is ripe The optional position of DPV CHv genome is modified, transforms, studied, the pathogenesis of beneficially DPVCHv and gene function Carrying out of research；Utilize the indicative function of recombinant virus EGFP fluorescent reporter gene, the beneficially screening of in-vivo recombination virus And purification.The restructuring duck plague virus of obtained TK functional deficiency replication capacity fall in the Unseparated Cells such as neurocyte simultaneously Low so that the virus in nervous tissue of hiding is difficult to activate, and is substantially reduced the neurovirulence of duck plague virus recombinant vaccine strain, thus Ensure that this restructuring duck plague virus has more excellent safety as vaccine.Additionally due to TK disappearance labelling and EGFP gene, Marker vaccine can also be developed into and distinguish wild poison and recombiant vaccine poison clinically.

In order to solve above-mentioned technical problem, this application discloses a kind of restructuring duck plague virus, including duck plague virus full genome Group sequence, described duck plague virus whole genome sequence has been inserted into transfer vector pUC18/EGFP-TKAB-BAC11 sequence, described Transfer vector pUC18/EGFP-TKAB-BAC11 sequence include bacterial artificial chromosome Core Feature element (BAC mini-F), Selection markers green fluorescent protein EGFP, Cm resistance marker and two loxp sites；Described transfer vector sequence such as SEQ ID Shown in NO.1；The nucleotide sequence in described loxp site is as shown in SEQ ID NO.24.

Further, the insertion point of transfer vector pUC18/EGFP-TKAB-BAC11 is DPV CHv TK gene Between 250-251 nucleotide, the left and right sides homology arm of transfer vector is respectively designated as TKA and TKB；The nucleotide sequence of TKA As shown in SEQ ID NO.22, the nucleotide sequence of TKB is as shown in SEQ ID NO.23.

Further, restructuring duck plague virus preserves with antibacterial and two kinds of forms of virus.

Disclosed herein as well is a kind of transfer vector construction method, comprise the following steps:

1) with plasmid pEGFP-Δ MCS as template, PCR expands EGFP expression cassette and by its sub-clone to pUC18, it is thus achieved that pUC18/EGFP；

2) with the DPV DNA that extracts as template, TK gene insertion site left and right sides homology arm TKA, TKB are expanded, and one by one Sub-clone is to pUC18/EGFP, it is thus achieved that pUC18/EGFP-TKAB；The nucleotide sequence of described TKA as shown in SEQ ID NO.22, The nucleotide sequence of described TKB is as shown in SEQ ID NO.23；

3) by Sph I linearization for enzyme restriction pBeloBAC11 plasmid, and the pUC18/ that itself and identical enzyme action were processed EGFP-TKAB is attached, Amp/Cm Double recombinant celo virus transfer vector pUC18/EGFP-TKAB-BAC11.

Disclosed herein as well is the construction method of a kind of bacterial artificial chromosome restructuring duck plague virus rescue system platform, will Including bacterial artificial chromosome (BAC) Core Feature element (mini-F) and the transfer vector sequence of green fluorescent protein (EGFP) It is inserted into the TK district of duck plague virus China virulent strain (NCBI Accession NO.JQ647509) genome up to 162kb Territory, the positive colony that electricity obtains after converting escherichia coli DH10B transfects DEF (DEF), rescue after extracting plasmid Go out to produce on host cell DEF the bacterial artificial chromosome restructuring duck plague virus DEVCHv-BAC-G of green fluorescence.

Further, construction method is specifically implemented according to following steps:

1) TK gene left and right homology arm, EGFP green fluorescence expression cassette, pBeloBAC11 are included by multistep clone's structure The restructuring duck plague virus transfer vector pUC18/EGFP-TKAB-BAC11 of Core Feature element three part composition；

2) extracting restructuring duck plague virus metastasis transplanting physique grain and jointly transfect DEF cell with DPV DNA, screening can send green The restructuring duck plague virus DPV CHv-BAC-G of color fluorescence；

3) integrity of DPV and BAC primary functional elements during PCR identifies restructuring duck plague virus DPV CHv-BAC-G；

4) extracting the DPV CHv-BAC-G in cyclisation period, electricity converts to escherichia coli DH10B competent cell, Cm resistance Plate screening positive colony pBAC-DPV；Wherein, cyclisation refers to 30-50% cytopathy period period；

5) extract PCR and restriction enzyme mapping identifies correct pBAC-DPV plasmid, transfect DEF cell, save out and include DPV The infection clones of CHv full-length genome.

Further, bacterial artificial chromosome restructuring duck plague virus rescue platform the primer is built as follows:

TKAF:5 '-3 ', GAATTCATGCTTGCCATCATAACCGTATTCTC, nucleotide sequence such as SEQ ID NO.2 institute Show；

TKAR:5 '-3 ', TCTAGAATAACTTCGTATAATGTATGCTATACGAAGTTATCACCTCGAGCTTTTCT TT CCTGTG, nucleotide sequence is as shown in SEQ ID NO.3；

TKBF:5 '-3 ', GCATGCACATAGCAACAACTGACGCAAAAGC, nucleotide sequence such as SE Q ID NO.4 institute Show；

TKBR:5 '-3 ', AAGCTTTCCCAGAAAGCTCGCCTAGGTCCTC, nucleotide sequence such as SE Q ID NO.5 institute Show；

EGFPF:5 '-3 ', TCTAGATAGTTATTAATAGTAATCAATTACG, nucleotide sequence such as SEQ ID NO.6 institute Show；

EGFPR:5 '-3 ', GTCGACATGCAGTGAAAAAAATGCT, nucleotide sequence such as SEQ ID N is O.7 shown；

SopBF:5 '-3 ', ATTCGTTAATTGCGCGCGTAGG, nucleotide sequence is as shown in SEQ ID NO.8；

SopBR:5 '-3 ', GAATATTCAGGCCAGTTATGCT, nucleotide sequence is as shown in SEQ ID NO.9；

RepAF:5 '-3 ', CATGGCGGAAACAGCGGTTATC, nucleotide sequence is as shown in SEQ ID NO.10；

RepAR:5 '-3 ', ATGTATGAGAGGCGCATTGGAG, nucleotide sequence is as shown in SEQ ID NO.11；

TKF:5 '-3 ', CGCGGATCCCACTGAATGTCACTGC, nucleotide sequence is as shown in SEQ ID NO.12；

TKR:5 '-3 ', CGCGGATCCCACTGAATGTCACTGC, nucleotide sequence is as shown in SEQ ID NO.13.

Present invention also provides and a kind of utilize above-mentioned bacterial artificial chromosome restructuring duck plague virus rescue system platform structure The restructuring duck plague virus UL55 gene-deleted strain built and back mutation strain thereof.

Present invention also provides a kind of bacterial artificial chromosome restructuring duck plague virus rescue system platform at duck plague virus base Because of function, viral pathogenesis mechanism and duck plague virus based on this platform prevention and other birds infectious disease restructuring duck plague virus Application in terms of vaccine research, including by site any on other birds infectious disease genes and DPV CHv-BAC-G genome Replacing or insert, other birds infectious disease described are viral include can cause the Anseriformes birds that includes including chicken, duck, goose Infectious disease.

Compared with prior art, the application can obtain and include techniques below effect:

1) the restructuring duck plague virus DPV CHv-BAC-G infection clones constructed by the present invention, compared with the poison parent plant of open country, The plaque size produced on host cell DEF is close, but the TCID50 that its different time points is on DEF is compared with the poison of parent open country Have dropped about 100 times, but within the whole observation cycle, its growth curve trend is as parent plant.Virulence is described The functional deficiency of gene TK reduces virus titre on host cell, but its disappearance does not affect the replicative cycle of virus, Recombinant virus rule of proliferation host cells infected in malicious with parent is consistent.

2) present invention is on the basis of duck plague virus China virulent strain bacterial artificial chromosome recombinant virus rescue system platform On, carry out knocking out and back mutation by UL55 gene in conjunction with Red E/T recombinant technique, the UL55 saved after transfection DEF cell Gene-deleted strain and back mutation strain can produce the cytopathogenic effect identical with parent.Further RFLP, IFA, plaque examination Test to compare with one step growth curve and show constructed UL55 gene-deleted strain and back mutation strain, can produce and parent plant DPV CHv- Similar for BAC-G cytopathic effect, in infection cell show identical proliferating cycle and it is to host cell Pathogenic it is very close to parent plant DPV CHv-BAC-G.Speculate that the function of UL55 gene is unrelated with the duplication of virus, its function Disappearance does not affect virus breeding on host cell and plaque test, does not the most change the virus titre to cell.

3) the UL55 gene that bacterial artificial chromosome based on present invention restructuring duck plague virus rescue system platform builds lacks The common location losing strain and back mutation strain and UL26.5 gene shows, UL55 gene does not affect UL26.5 albumen in infection cell Location.

4) the bacterial artificial chromosome restructuring duck plague virus rescue system platform constructed by the present invention is also equipped with development and attaches most importance to Group carrier bigeminy or the potentiality of multiple vaccines, can be used for duck plague virus and the prevention of other avian viral infectious disease.Including inciting somebody to action Other birds infectious disease genes are the replacement in any site, other birds infectious disease bags described with on DPV CHv-BAC-G genome Include the viral infectious that can cause the Anseriformes birds including chicken, duck, goose.

Certainly, the arbitrary product implementing the application it is not absolutely required to reach all the above technique effect simultaneously.

Accompanying drawing explanation

Accompanying drawing described herein is used for providing further understanding of the present application, constitutes the part of the application, this Shen Schematic description and description please is used for explaining the application, is not intended that the improper restriction to the application.In the accompanying drawings:

Fig. 1 is the purification of the application bacterial artificial chromosome restructuring duck plague virus；Wherein, A: after transfection, blind passage three generations observes The recombinant virus fluorescence arrived；The plaque purification 1-8 generation of B-I: recombinant virus；

Fig. 2 is the application pBAC-DPV restriction endonuclease map analysis；Wherein, A:pBAC-DPV BamHI, EcoRI restriction enzyme digestion and electrophoresis figure；B: BamHI, EcoRI restriction enzyme digestion and electrophoresis figure of simulation pBAC-DPV；M1:M1:DL15000；M2:1kb plus ladder；

Fig. 3 is that the application recombinates the qualification of DPV molecular cloning virus, wherein, M1:DL5000；M2:DL15000；1- 17: and insert using the pBAC-DPV plasmid extracted or DPV CHv cell DNA as the DPV genomic gene in the table 5 of template amplification Enter functional nucleotide sequence element genes EGFP, repA, sopB；

Fig. 4 is the IFA qualification that the application saves recombinant virus DPV CHv-BAC-G, wherein, A-D:DPV CHv-BAC-G Infection cell；E-H:DPV CHv infection cell；I-L:DEF cell；

Fig. 5 is that the application saves recombinant virus DPV CHv-BAC-G and parent's poison CHv plaque assays and one step growth curve Relatively；Wherein, A: parent's poison CHv infection cell；B: rescue recombinant virus DPV CHv-BAC-G infection cell；

Fig. 6 is the one step growth on the application parent poison CHv and rescue recombinant virus DPV CHv-BAC-G in cleer and peaceful cell Curve；Wherein, A: parent's poison CHv infection cell；B: rescue recombinant virus DPV CHv-BAC-G infection cell；

Fig. 7 is the application Red restructuring plasmid-bearing strains pKD46, pKD4, pCP20 collection of illustrative plates used；

Fig. 8 is that the application UL55 gene delection second takes turns RED restructuring qualification；M1:DL15000；M2:DL5000；1: the first UL55 gene region fragment before wheel restructuring；2: first round RED recombinant PCR product；Take turns RED recombinant PCR product at 3: the second；

Fig. 9 is the qualification that the application saves UL55 gene-deleted strain DPV CHv-BAC-G Δ UL55；M:DL5000；1-3: Respectively using DPV CHv, DPV CHv-BAC-G, DPV CHv-BAC-G Δ UL55 infection cell DNA as template with identifying primer Amplification UL55 gene region；

Figure 10 be the application build UL55 gene delection back mutation strain DPV CHv-BAC-G Δ UL55R second take turns RED weight Group is identified；M1:DL5000；M2:DL15000；1: UL55 gene region fragment before first round restructuring；2: with DPV CHv-BAC-G Δ UL55 is template amplification UL55 gene region fragment；3: build the back mutation strain DPV CHv-BAC-G Δ UL55R first round RED recombinates qualification；4: build back mutation strain DPV CHv-BAC-G Δ UL55R second and take turns RED restructuring qualification；

Figure 11 is that the application saves recombinant virus DPV CHv-BAC-G, DPV CHv-BAC-G Δ UL55, DPV CHv- BAC-G Δ UL55R rflp analysis；A:BamHI, EcoRI restriction enzyme digestion and electrophoresis figure；B: simulation BamHI, EcoRI restriction enzyme digestion and electrophoresis figure.M: 1kb plus ladder；M1:DL15000；1:DPV CHv-BAC-G；2:DPV CHv-BAC-GΔUL55；3:DPV CHv- BAC-GΔUL55R.*: the band lacking or having more；

Figure 12 is the IFA qualification that the application saves recombinant virus DPV CHv-BAC-G Δ UL55R；A-D:DPV CHv- BAC-G infection cell；E-H:DPV CHv-BAC-G Δ UL55 infection cell；I-L:DPV CHv-BAC-G Δ UL55R infects thin Born of the same parents；

Figure 13 is that the application saves recombinant virus DPV CHv-BAC-G, UL55 gene-deleted strain DPV CHv-BAC-G Δ Plaque assays and the one step growth curve of UL55 and UL55 gene delection back mutation strain DPV CHv-BAC-G Δ UL55R compare； A: parent's poison CHv infection cell；B: rescue recombinant virus DPV CHv-BAC-G infection cell；C:UL55 gene-deleted strain DPV CHv-BAC-GΔUL55；D:UL55 gene delection back mutation strain DPV CHv-BAC-G Δ UL55R；

Figure 14 is that the application saves recombinant virus DPV CHv-BAC-G, UL55 gene-deleted strain DPV CHv-BAC-G Δ One step growth curve in cleer and peaceful cell on UL55 and UL55 gene delection back mutation strain DPV CHv-BAC-G Δ UL55R；Its In, A: supernatant curve；B: cell curve；

Figure 15 is UL55 albumen and the positioning scenarios of UL26.5 albumen in the application DPV CHv host cells infected.A-D: Mouse-anti UL55IgG is as the location of UL55 albumen in an anti-detection DPV CHv host cells infected；The anti-UL26.5IgG of E-H: rabbit As the positioning scenarios of UL26.5 albumen in an anti-detection DPV CHv host cells infected；I-L: mouse-anti UL55IgG and rabbit resist UL26.5IgG is as the common positioning scenarios of UL55 and UL26.5 albumen in an anti-detection DPV CHv host cells infected；

Figure 16 is that the application saves the positioning scenarios of UL26.5 albumen in recombinant virus infection host cell.A-D: rabbit resists UL26.5IgG is as the positioning scenarios of UL26.5 albumen in an anti-detection DPV CHv-BAC-G host cells infected；E-H: rabbit resists UL26.5IgG is as the positioning scenarios of UL26.5 albumen in an anti-detection DPV CHv-BAC-G Δ UL55 host cells infected；I- The anti-UL26.5IgG of L: rabbit is as the location of UL26.5 albumen in an anti-detection DPV CHv-BAC-G Δ UL55R host cells infected Situation.

Detailed description of the invention

Describe presently filed embodiment in detail below in conjunction with drawings and Examples, thereby how the application is applied Technological means solves technical problem and reaches the process that realizes of technology effect and can fully understand and implement according to this.

Embodiment 1 bacterial artificial chromosome restructuring duck plague virus rescue system platform builds

1, design of primers: according to TK gene and left and right sides gene order, pEGFP-C1 sequence and pBeloBAC11 sequence It is as shown in table 1 that row are designed for building bacterial artificial chromosome restructuring duck plague virus rescue platform the primer:

Table 1 builds bacterial artificial chromosome restructuring duck plague virus rescue platform the primer

2 bacterial artificial chromosome restructuring duck plague virus transfer vectors build

The insertion point building bacterial artificial chromosome restructuring duck plague virus rescue system platform external source BAC sequence is The TK region of DPVCHv.The design construction one the bacterial artificial chromosome transfer vector containing TK gene left and right homology arm, passes through With the duck plague virus that the restructuring of DPV cotransfection cell-isogenic obtains restructuring.Transfer vector include TK gene left and right homology arm, EGFP, PBeloBAC11mini-F sequence three part forms.Wherein TK left arm includes part UL24 and TK sequence, and right arm includes part TK Sequence.And design in the homology arm A downstream primer of left side on the loxP site of 34bp, direction and pBeloBAC11 plasmid In the same direction, the size of homology arm is respectively 1357bp, 1039bp in loxP site.

The sub-clone of 2.1EGFP egfp expression box

EGFP egfp expression box is the plasmid pEGFP-Δ eliminating pEGFP-C1 plasmid multiple clone site MCS.The main process built includes, with after Bgl II and Sma I double digestion pEGFP-C1, reclaiming linearizing carrier, warp Klenow Fragment filling-in, after T4DNA ligase connects, converts in Eco.li DH5a competent cell, it is thus achieved that delete The plasmid pEGFP-Δ MCS of multiple clone site.PEGFP-Δ MCS conventional method Zengjing Granule also extracts plasmid, with this plasmid is Template, utilizes the primer EGFPF/EGFPR expanding EGFP in table 1 to carry out PCR amplification, amplification system and response procedures such as table 2, table Shown in 3:

Table 2 expands EGFP PCR reaction system

Table 3 expands EGFP PCR reaction condition

After amplification terminates, amplified production point sample is carried out electrophoresis, obtains the amplified production that size is 1571bp.Glue reclaims examination After agent box carries out cutting glue recovery EGFP amplified production, it is connected to successively on pMD18-T and pUC18 plasmid vector carry out T gram Grand and sub-clone, through PCR and enzyme action, sub-clone identifies that correct Hou Song company carries out order-checking and identifies, the correct cloned plasmids of gained is named For pUC18/EGFP.

The sub-clone of 2.2DPV CHv TK region left and right sides homology arm

2.2.1DPV the extraction of CHv infection cell STb gene

2.2.1.1 the preparation of DEF (DEF)

(1) take 8-11 age in days health duck embryo, candler marks air chamber and the position of embryo head with pencil.With 37 DEG C 0.1% bromo geramine cleans eggshell surface, after the bromo geramine of eggshell surface is rinsed well completely and dried by eggshell surface Successively respectively with 5% iodine tincture and 75% alcohol disinfecting eggshell surface, it is placed in the egg rack in superclean bench.

(2) open air chamber under aseptic technique, by idiosome take out and with sterilizing PBS, idiosome is cleaned, decaptitate, wing, lower limb, Internal organs etc., then wash idiosome 2-3 all over thoroughly to remove blood stains with PBS.With the eye scissors of sterilizing, idiosome is cut into the little of 1mm size Block, adds PBS appropriate, then adds pancreatin 150 μ l/ embryo, digests about 1min until embryo block becomes cotton-shaped in 37 DEG C of water-baths；

(3) immediately with 5000r/min, cell suspension being centrifuged 5min, tipping supernatant, after cell precipitation is suspended in appropriate MEM By 6 layers of filtered through gauze, filtrate add 10% calf serum and 100IU/ml dual anti-after and fully after piping and druming uniformly, be sub-packed in cell bottle In, horizontal rest is cultivated in 37 DEG C of cell culture incubators.

2.2.1.2 the propagation of duck plague virus

Take the DEF just growing up to fine and close monolayer, abandon growth nutrient solution, add with after sterilizing PBS cell surface 2 times 0.1MOI virus covers cell surface and adsorbs, and abandons virus liquid after 37 DEG C of effect 120min, then add containing 5% calf serum and MEM maintenance nutritional solution dual anti-for 100IU/ml is in 37 DEG C of cultivations, until pathological changes occurs.

2.2.1.3DPV CHv DNA extraction

(1), when occurring the pathological changes of 80-90% in the cell bottle of DPV to be seeded, harvesting ,-20 DEG C of multigelations crush Cell, under the conditions of 4 DEG C, 5000r/min × 30min removes cell debris.

(2) take the supernatant 400 μ l after being centrifuged, add E.C. 3.4.21.64 (10mg/mL) to final concentration of 200 μ g/ml, gentleness After ground mixing, 56 DEG C of water-bath 1h, the gentleest rotation viscous solution；

(3) 10%SDS to final concentration of 1%, 37 DEG C of water-bath 30min are added；

(4) the 400 saturated phenol of μ l are added: chloroform (1:1) gentle inversion mixes 5min, afterwards 4 DEG C of 5000r/min × 5min, Supernatant is carefully drawn along tube wall with cutting off the TIP head of end.Repeat extracting 2-3 time with phenol chloroform again, finally take out with 400 μ l chloroforms Carry 1 time (whole extractive process gentle manipulation), after being centrifuged, take supernatant.

(5) taking supernatant, add 3M NaAc (pH4.8) and the dehydrated alcohol of 2 times of volumes of 1/10 volume ,-20 DEG C are overnight sunk Shallow lake nucleic acid.

(6) 4 DEG C of 13000r/min are centrifuged 10min, precipitation 70% cold washing with alcohol twice, carefully outwell after washing every time Or suck supernatant.

(7) after having washed for the last time, suck surplus liquid, slightly air-dry in fume hood or use DNA concentrate drying Instrument is dried, then with 20 μ l TE buffer (pH8.0) dissolving DNAs ,-20 DEG C of standby or direct electroresis appraisal of Refrigerator store.

2.2.2TK the amplification of gene left and right homology arm

With extract virus genom DNA as template, utilize primer TKAF/TKAR, TKBF/TKBR that TK left and right arms is carried out PCR expands, and PCR reaction condition and program are with table 2, table 3.Amplification obtains about the TK gene that size is 1357bp, 1039bp same Source arm amplified production.

2.2.3 the sub-clone pUC18/EGFP-TKAB of TK gene left and right homology arm is built

With reference to the cloning process of the sub-clone of EGFP expression cassette, amplification gained TKA, TKB are carried out T clone, warp respectively PCR, enzyme action and order-checking identify that correct positive T clone designation is pMDT-TKA, pMDT-TKB.Then T is cloned gained PMDT-TKA, pMDT-TKB with after EcoRI/XbaI, SphI/HindIII enzyme action, are successively connected to process with identical enzyme action respectively On the pUC18-EGFP crossed, construct pUC18/EGFP-TKA, pUC18/EGFP-TKAB sub-clone plasmid.

The structure of 2.3 recombinant virus transfer vector pUC18/EGFP-TKAB-BAC11

2.3.1BAC the preparation of carrier core sequence fragment

The pBeloBAC11 that-70 DEG C preserve is lined the LB solid medium containing chloromycetin (Cm, 34 μ g/ml) resistance put down On plate, after incubated overnight, picking monoclonal, it is inoculated in the LB/Cm fluid medium of 100ml sterilizing, 37 DEG C, 220rpm cultivation 18h, extracts test kit explanation according to amount in Qiagen plasmid Midi kit plasmid and extracts low copy plasmid PBeloBAC11, is dissolved in the ddH of 50 μ l sterilizings₂In O.The pBeloBACll extracted with Sph I enzyme action, glue reclaims molecular weight about The linear DNA fragments of 7.5kb, is BAC carrier basic function gene linearized fragment, is used for building bacterial artificial chromosome Recombinant virus transfer vector.

2.3.2 the structure of recombinant virus transfer vector pUC18/EGFP-TKAB-BAC11

Streak culture recombiant plasmid pUC18/EGFP-TKAB on LB/Amp flat board, selects monoclonal inoculation liquid training next day Foster base carries out conventional Zengjing Granule.Axygen Plasmid Mini Extraction kit extraction plasmid pUC18 in a small amount/ EGFP-TKAB, Sph I enzyme action also reclaims fragment, be attached with the Sph I enzyme action pBeloBACll linearized fragment reclaimed, Convert, the LB health culture medium that coating Amp/Cm is Double, be inverted for 37 DEG C and cultivate.Identify through bacterium colony PCR, enzyme action and order-checking, Two loxP sites of picking lay respectively at the positive colony conservation of BAC core sequence both sides named pUC18/EGFP-TKAB- BAC11.As the transfer vector building DPV recombinant virus with DPV genomic DNA cotransfection.

The structure of 3 bacterial artificial chromosome restructuring duck plague viruses

The extraction of 3.1 metastasis transplanting physique grain pUC18/EGFP-TKAB-BAC11

From refrigerator, take out the transfer vector pUC18/EGFP-TKAB-BAC11 positive colony built, line containing Cm Resistance LB culture medium flat plate on, after 37 DEG C of overnight incubation, in picking monoclonal, amount shakes bacterium 100ml, presses QIAGEN after cultivating 16h Plasmid Midi Kit description extracts metastasis transplanting physique grain pUC18/EGFP-TKAB-BAC11.After aquesterilisa dissolves naturally, Take a small amount of plasmid DNA ultraviolet spectrophotometer and quantitatively and identify purity.

3.2 metastasis transplanting physique grain pUC18/EGFP-TKAB-BAC11 and DPV DNA cotransfection

Conventional method prepares primary DEF, cultivates to forming monolayer in six porocyte culture plates, inoculation DPV CHv cell toxicant, after 37 DEG C hatch 1h, removes virus liquid, washes cell twice with the MEM without serum, and every hole adds 1.5ml Serum-free MEM.Transfecting according to the description of Lipofectamine 3000, every hole transfects 2.5 μ g pUC18/EGFP- TKAB-BAC11 metastasis transplanting physique grain DNA.Transfect a hole pEGFP-Δ MCS as comparison simultaneously.37 DEG C, in 5%CO2 incubator Effect 6h, sucks transfection liquid, adds the maintenance liquid containing serum；37 DEG C, 5%CO2 incubator is cultivated 2-3 days, every day observes glimmering , until there is recombinant virus fluorescent spot in light.

Preliminary screening, enrichment and the purification of 3.3 recombinant virus DPV CHv-BAC-G

(1) collecting and occur the cell of fluorescence in 3.2 after transfection, after multigelation three times, inoculation is covered with the duck embryo of monolayer and is become Fibrocyte, blind passage three generations, expand the yield of recombinant virus.

(2) plant in six porose discs into DEF cell, after it grows up to fine and close monolayer, inoculate the restructuring after blind passage three generations sick Poison, 37 DEG C, 5%CO2 incubator cultivates 24-48h after, observe fluorescence under fluorescence inverted microscope.Fluorescence to appear After, suck maintenance liquid, six orifice plates cover Nutrient agar (2 × MEM and the mixing of 2% low melting-point agarose equal-volume), every hole Add 2ml, be inverted after agar solidification and cultivate about 24h.Observe under fluorescence inverted microscope and the cell collection of labelling band fluorescence Fall, with pasteur pipet by its sucking-off, be placed in 500 μ l cell culture maintenance mediums, three releasing virus of-70 DEG C of multigelations.

(3) by the virus liquid after multigelation, with different extension rates, (first 5 times of dilutions, after fluorescence volume significantly increases 10 times of dilutions) infect the DEF on 24 porocyte culture plates, after 37 DEG C of effect 2h, suck virus liquid, cover battalion Support agar, after agar solidification, overturn Tissue Culture Plate.37 DEG C, 5%CO2 incubator continues cultivate to bigger fluorescence occurs Speckle, then be purified with bus suction pipe absorption fluorescent spot, be enriched with.

(4) repetition step (3) is until fluorescence (Fig. 1) all occurs in all of plaque, the named DPV of recombinant virus that will obtain CHv-BAC-G。

The qualification of 3.4 recombinant virus DPV CHv-BAC-G

Results recombinant virus DPV CHv-BAC-G extraction cell DNA after purification, as template, expands with the primer in table 1 Increase transfer vector function element repA (shown in SEQ ID NO.26), sopB (shown in SEQ ID NO.25), EGFP gene (SEQ Shown in ID NO.27) and the TK region (shown in SEQ ID NO.28) of DPV genome.PCR amplification system and program are with table 2, table 3 Shown in.PCR qualification result shows that recombinant virus can amplify transfer vector function element repA, sopB, EGFP gene, but not The TK region of DPV genome can be amplified, show to be successfully obtained the sublimed bacteria artificial inserting BAC at TK gene region Chromosome recombination duck plague virus DPV CHv-BAC-G.

The acquisition of 4 restructuring duck plague virus electricity transformed clones

The preparation of 4.1 escherichia coli DH10B Electroporation-competent cells

(1) from-70 DEG C of refrigerators, take out the DH10B strain of preservation, line on LB flat board, be inverted for 37 DEG C and cultivate 16- 24h。

(2) during picking monoclonal is inoculated in 5ml nonresistant LB fluid medium.37 DEG C, 220rpm, cultivate 14～16h As seed liquor.

(3) seed liquor is inoculated in 50ml LB fluid medium with the ratio of 1:50,37 DEG C, 220rpm acutely shakes Cultivate, take a small amount of bacterium solution every half an hour after cultivating 1h and survey OD₆₀₀.Work as OD₆₀₀When reaching 0.5-0.7, take out immediately, be placed on ice Cooling 30min.The most all of operation should be maintained at and carry out on ice.

(4) proceed to thalline, in the centrifuge tube of pre-cooling, put in the centrifuge of pre-cooling in advance, 4 DEG C, 5000r/min be centrifuged 5min, collects thalline.

(5) with the sterilizing ultra-pure water 20ml suspension thalline that ice is precooled, softly blow and beat, and the moment keeps on ice, 6000r/ Min is centrifuged 5min.Outwell supernatant immediately after centrifugal end, thalline is placed on ice.

(6) repeat step (5) 3-5 time, thoroughly remove the salt ion composition in bacterium solution.

(7) after last washing, outwell supernatant, add the most ice-cold sterilizing ultra-pure water depending on the amount of thalline and suspend and divide Dress up 50 μ l/ to prop up, carry out electricity conversion immediately.If wouldn't convert, then after outwelling supernatant, carry out with sterilizing 30% glycerol of pre-cooling Suspend, put into-70 DEG C of Refrigerator stores after being distributed into aliquot standby.

The extraction of 4.2DPV CHv-BAC-G cyclisation genomic DNA

The recombinant virus genomes DNA electricity containing BAC sequence being only cyclized proceeds to that electricity turns in competence DH10B could be as BAC plasmid is the same to be replicated in antibacterial.DPV genomic DNA is only in cyclisation within the ofest short duration time at the initial stage of infection cell State.The restructuring DPV virus genom DNA of cyclisation to be obtained, the time of results virus is particularly critical.Conventional method is bred Restructuring DPV virus DPV CHv-BAC-G, when pathological changes occurs in the cell of about 30%-50%, extracts viral genome.All Operation in, in order to ensure the integrity of genome, action wants soft, the rifle draught animals is cut big and with the flame of alcohol burner with shears It is allowed to smoothing.When dissolving with sterilizing ultra-pure water so that it is naturally dissolving, period does not rock, in case DNA chain rupture.4 DEG C of temporary transient guarantors Depositing, the restructuring DPV infection cell STb gene ultraviolet spectrophotometer taking a small amount of extraction measures concentration, is immediately available for electricity and turns.

4.3 electroporated screening restructuring BAC clones

(1), before on-test, open electricity conversion instrument, and set parameter 1.8kV, 200 Ω, 25 μ F (1mm electricity revolving cup).

(2) the recombinant virus cyclisation genomic DNA extracted 4.2, is placed in 5-10min on ice so that it is cooling.Add 1-5 μ L (100ng) recombinant virus dna, in 50 μ l DH10B electricity transformed competence colibacillus of fresh preparation, is gently agitated for cell so that it is mixed Even.Continue to be placed in left and right in 10min on ice.

(3) with in the competence-DNA mixture in rifle head aspiration step (2) of pre-cooling to the 1mm electricity revolving cup of pre-cooling, gently Tapping desktop, makes mixture be sunken at the bottom of pipe.

(4) blot the moisture around electricity revolving cup with absorbent paper, be immediately placed in electric shock tank, carry out electricity by the program set Hit.

(5), after having shocked by electricity, it is rapidly added the LB culture medium of 1ml 37 DEG C preheating, gently after re-suspended cell, rapid sucking-off, Transfer in test tube, put into recovery about 2h in 37 DEG C of shaking baths.

(6) 8000r/min room temperature is centrifuged 1min, stays the 200 μ resuspended precipitations of l LB, suspension is transferred to LB/Cm solid culture On base, put room temperature after the coating uniformly of antibacterial spreading rod until liquid absorbs, be inverted agarose plate, put in 37 DEG C of incubators and train Support about 24h.

The qualification of 4.4BAC transformant

In the clone obtained from 4.3, random choose 2 carries out bacterium colony PCR qualification, bacterium colony PCR result display restructuring DPV Electricity transformed clone success.Select further one of them clone Zengjing Granule after according to Qiagen Plasmid Midi kit Description method in amount extract BAC molecular cloning DPV virus positive colony pBAC-DPV.Take the pBAC-DPV of extraction Plasmid 1 μ g, carries out enzyme action with restricted enzyme BamHI, EcoRI according to the system of table 4 respectively, after enzyme action completes, uses 1% fine jade Sepharose electrophoretic analysis, the whole loading of digestion products, 15V electrophoresis 16-19h.Result display pBAC-DPV plasmid BamHI, EcoRI restriction enzyme mapping is consistent with intended restriction analysis result (Fig. 2).

Table 4pBAC-DPV enzyme action system

Identifying that correct pBAC-DPV plasmid is template with enzyme action further, PCR identifies and inserts DPV virus TK region BAC transfer vector fragment, including fluorescent labeling EGFP gene and BAC basic function gene order, primer sequence is shown in Table 1.Simultaneously Primer, amplification DPV inside and outside propagation indispensable gene, virulence base is designed according to pBAC-DPV parent plant DPV CHv strain full-length genome Cause and structural protein gene (using the existing primer sequence of this laboratory, it is not necessary to additionally synthesis), to confirm in pBAC-DPV The integrity of DPV genome structure.Extract DPV CHv cell DNA same primers simultaneously and carry out amplification as comparison.14 The present embodiment is used for identify that the gene of pBAC-DPV molecular cloning DPV viral genome integrity is as shown in table 5.Result table The Core Feature element of bright listed DPV genomic gene and insertion exogenous array is complete (Fig. 3), DPV electricity transformed clone structure of recombinating Build up merit, it is thus achieved that the restructuring DPV pBAC-DPV of electricity transformed clone that can replicate in antibacterial.

The gene of pBAC-DPV molecular cloning DPV viral genome integrity identified by table 5

The rescue of the 5 restructuring complete genome infectious clones of DPV

The extraction of 5.1 transfection pBAC-DPV

By identifying and check order identify correct BAC bacterial clone through Cleavage Map, PCR, line LB/Cm training Supporting on base flat board, cultivate 18h for 37 DEG C, picking monoclonal, middle amount shakes bacterium 100ml, by saying of Qiagen Plasmid Midi kit Bright book extracts pBAC-DPV plasmid, with the aquesterilisa dissolving DNA of 50 μ l in superclean bench.After taking a small amount of pBAC-DPV dilution Concentration is measured with ultraviolet spectrophotometer.PBAC-DPV concentration is controlled at 0.2 μ g～1 μ g/ μ l, preserve in 4 DEG C of refrigerators.

PBAC-DPV is transfected into DEF by 5.2

Conventional method prepares DEF cell, when cell is fused to 80-90%, washes with the MEM not containing antibiotic and serum Wash cell, repeated washing more than 3 times, be used for transfecting.Take freshly extd pBAC-DPV 2.5 μ g to transfect, transfection concrete Operation is with reference to lipofectamine box Lipofectalnine^TMThe operation instruction of 3000 is carried out.Set up transfection pEGFP-simultaneously The cell hole of Δ MCS plasmid as the cell hole of transfection control and not transfected plasmids as blank.Transfect latter second day, Suck transfection cocktail, after washing with PBS, change 5%MEM into and maintain liquid, be placed in 37 DEG C, 5%CO2 incubator continue cultivate 2- 3d, observes FLuorescent speckle under fluorescence inverted microscope.

The 5.3 rescue complete genome infectious clones of DPV

After the plaque that band fluorescence occurs in the transfection hole in 2.4.2, harvesting, after multigelation, blind passage three generations is to remove The plasmid of transient transfection, expands the yield of recombinant virus, when there is the plaque of band fluorescence in rear a large amount of cells to be seeded, and Ji Keshou Obtain, conservation, recombinant virus named DPV CHv-BAC-G will be obtained.

The qualification of 5.4 rescue recombinant virus DPV CHv-BAC-G

5.4.1DPV CHv-BAC-G extracting genome DNA

Conventional method prepares primary DEF, after DEF grows up to fine and close cell monolayer, by sick for the restructuring of rescue Poison DPV CHv-BAC-G is inoculated on the Tissue Culture Dish of own confluent monolayers DEF.Cultivate to producing CPE, under trypsinization for 37 DEG C After Laiing, add 5% growth-promoting media terminate digestion, take out 1ml containing virus Digestive system, 13,000x 1min, precipitate-20 DEG C preservations or It is directly used in extraction viral DNA.

In viral pellet, add 1ml lysis buffer, after suspension, add the E.C. 3.4.21.64 of 20 μ l 20mg/ml, 56 DEG C After effect 1h, with phenol chloroform extraction 3 times, it is eventually adding 3M sodium acetate and the dehydrated alcohol of 2 times of volumes of 1/10 volume ,-20 DEG C After effect 2h, 4 DEG C 13,000x 20min, finally by time precipitation of 1ml 70% washing with alcohol, it is dissolved in after ethanol volatilization is clean In 100 μ l aquesterilisa.

5.4.2PCR identify

Using extract rescue recombinant virus DPV CHv-BAC-G infection cell DNA as template detection insertion sequence core US2 gene on element repA, sopB, EGFP and DPV genome.The clone 8 that electricity converts is extracted plasmid and is expanded accordingly As positive control, the DEF being uninfected by DPV carries out PCR as negative control as template simultaneously.Result display repA, sopB, US2 gene on EGFP and DPV genome can obtain specific amplification products.

5.4.3IFA identify

(1) with recombinant virus DPV CHv-BAC-G infection cell culture dish covering with the creep plate of monolayer DEF cell, simultaneously Set up and infect the DEF cell climbing sheet of DPV CHv and do not infect the DEF cell climbing sheet of any virus as comparison.

(2) discard culture fluid, wash 2 times cells with PBS, thoroughly remove PBS, but do not allow cell kill.

(3) with the ice-cold fixing cell 30min of 4% paraformaldehyde 4 DEG C of 1ml, discard mixed liquor and slightly air-dried (this step can Air-dried cell climbing sheet sealed membrane is sealed and with masking foil seal be stored in-20 DEG C frozen, operate after a while.)

(4) PBS washes cell 3 times, each 1-2ml, room temperature effect 5min；

(5) 30min is thoroughly changed with the PBS containing 0.2%Triton.

(6) adding 200 μ l confining liquids (with 5% skim milk of PBS preparation), 1h closed by 37 DEG C of wet boxes.

(7) one anti-hatch: blotting liquid, the rabbit anti-TK antibody adding 200 μ l purification is (the dilutest with the PBS containing 1%BSA Release), 37 DEG C of wet box effect 1h or 4 DEG C of overnight incubation.

(8) blot liquid, wash cell 3 times with the PBS containing 0.1%Tween-20, each 1-2ml, room temperature effect 5min；

(9) two anti-hatch: adding the goat anti-rabbit igg (1:100 dilution) of 200 μ l TRITC labellings, masking foil wraps up lucifuge, 37 DEG C of wet box effect 1h.

(10) step (8) is repeated.

(11) blotting liquid, every hole adds 200 μ l DAPI (1:1000 dilution) lucifuge dye core 5-10min.

(12) step (8) is repeated.

(13) blotting liquid, press from both sides out cell climbing sheet, reversion is placed on the microscope slide added with glycerol.

(14) fluorescence microscopy Microscopic observation fluorescence.

It can be seen that recombinant virus EGFP expresses sends green fluorescence (Fig. 4 B), and the parent poison DPV of correspondence CHv infection cell and DEF cell the most do not observe fluorescence (Fig. 4 F, J).After one anti-binding, lacked TK recombinant virus and DEF cell (Fig. 4 C, K) does not has specificity fluorescent to occur, parent poison DPV CHv is then it is observed that bright red fluorescence (Fig. 4 G), illustrates that recombinant virus is saved successfully.

The extracorporeal biology specificity analysis of 6 rescue recombinant virus DPV CHv-BAC-G

6.1 Viral Quantification (TCID50 mensuration)

(1) from-70 DEG C of refrigerators, take out frozen DPV CHv-BAC-G, DPV CHv, in EP pipe, virus liquid is connected Continuous 10 times of doubling dilutions, from 10^-1-10^-8。

(2) virus diluted being inoculated in 96 hole microtest plates by every hole 100 μ l, each dilution factor inoculation one is horizontal Row totally 10 hole.

(3) conventional method prepares DEF suspension, adds cell suspension 100 μ l in the Zhong Mei hole, hole added with virus dilution liquid, makes Cell concentration reaches 2～3 × 10⁵Individual/ml.

(4) simultaneously, normal cell controls (100 μ l growth-promoting media+100 μ l cell suspension) is done by remaining 2 tandems.

(5) add and be placed on 37 DEG C, 5%C2O incubator is cultivated 7-9 days.

(6) basis of microscopic observation record pathological changes situation, is calculated by Reed-Muench Liang Shi method or Karber method TCID50。

6.2 plaque assays

(1) frozen DPV CHv-BAC-G and DPV CHv is made respectively continuously 10 times of doubling dilutions with MEM.

(2) taking the virus liquid of doubling dilution, every hole 100 μ l is inoculated in 24 orifice plates the fine and close duck embryo fibroblast growing into monolayer Dimension cell.

After (3) 37 DEG C of absorption 1h, sucking-off virus liquid, every hole adds 500 μ l and adds 0.5% methylcellulose medium covering Cell, 37 DEG C, 5%CO2 incubator continues cultivate 3-5d.

(4) sucking-off methylcellulose, every hole adds 4% paraformaldehyde of 500 μ l pre-coolings, and room temperature fixes 15min；

(5) sterilizing PBS washes cell twice, adds 500 μ l 0.5% violet staining 5min, and tap water washes except dyeing Liquid, observes and counts plaque.

Result display parent poison CHv and rescue recombinant virus DPV CHv-BAC-G, after host cells infected DEF, is formed Plaque size close, form the most closely similar (Fig. 5 A, B).

6.3 one step growth curve

(1) DPV CHv-BAC-G and the DPV CHv strain determining TCID50 is arrived inoculation respectively with the dosage of 0.02MOI In 24 porocyte culture dishs of the fine and close DEF having grown up to monolayer, each dilution factor inoculates 3 holes.

(2) virus during 6h, 12h, 24h, 36h, 48h, 72h the most after inoculation divides out the upper cleer and peaceful cell of results.On Virus in Qing: directly take 500 μ l viral supernatants, be placed in EP pipe；Virus in cell: after sucking supernatant, washes cell with PBS 3 times, every hole adds 0.05% pancreatin 100 μ l peptic cell, adds 400 μ l5%MEM and maintain liquid to terminate after cell dissociation gets off Digestion, transfers in EP pipe after piping and druming uniformly.

(3) by the viral multigelation three times in the upper cleer and peaceful cell of the different time points of results, 100 μ l different times are taken The virus sample of point takes turns doing 10 times and is diluted to suitable dilution factor (10^-1～10^-8)。

(4) virus diluted being inoculated in 96 hole microtest plates by every hole 100 μ l, each dilution factor inoculation one is horizontal Row totally 5 hole.

(5) conventional method prepares DEF suspension, adds cell suspension 100 μ l in the Zhong Mei hole, hole added with virus dilution liquid, makes Cell concentration reaches 2～3 × 10⁵Individual/ml.

(6) simultaneously, normal cell controls (100 μ l growth-promoting media+100 μ l cell suspension) is done by remaining 2 tandems.

(7) add and be placed on 37 DEG C, 5%C2O incubator is cultivated 7-9 days.

(8) basis of microscopic observation record pathological changes situation, calculates TCID50 by Reed-Muench Liang Shi method or Karber method And draw growth curve (Fig. 6 A, B).

It can be seen that in after infection 72 hours, either supernatant or intracellular recombinant virus content The substantially lower than virus quantity of parent poison DPV CHv, the content maximum at both the different times infected differs about 100 times. In parent's poison and restructuring poison front 24h after infection, the upper cleer and peaceful cell of infection cell all can't detect the increasing of viral level Add, illustrate that it is in latency.After infecting 24h, the two content in upper cleer and peaceful cell all dramatically increases, and arrives During 48h.p.i, the virus in cell is not further added by, and the content in supernatant is continuing to increase, and the duplication of now virus has been described Through entering cracking release period.Thus it is concluded that due to the insertion in TK region of the BAC-EGFP transfer vector sequence, drop The low recombinant virus CPE for cell so that it is the infection titer on cell reduces.

Embodiment 2 is recombinated the structure of duck plague virus UL55 gene-deleted strain and extracorporeal biology characteristic research thereof

1 bacterial strain/plasmid

Red restructuring plasmid-bearing strains pKD46, pKD4, pCP20 collection of illustrative plates used is as shown in Figure 7.

2 design of primers

The present embodiment is used for build UL55 gene delection and back mutation strain primer is as shown in table 6.

Table 6 is for the relevant primer of RED restructuring

3 first round RED restructuring knock out UL55 gene

The amplification of 3.1UL55 DNA homolog target practice fragment, recovery

The design kalamycin resistance gene seat target practice fragment of both sides band UL55 DNA homolog arm and FRT sequence replaces UL55 sequence to be knocked out.With plasmid pKD4 as template, expand kalamycin resistance gene.This primer 3 ' holds 20 base sources In kalamycin resistance gene, being used for expanding this resistant gene, 5 ' 50 bases of end derive from DPV CHv, lay respectively at and to strike The both sides of the UL55 gene order removed, for homologous recombination, Kana gene both sides respectively include a FRT, take turns RED weight for second Group.PCR system and reaction condition with fidelity enzymatic amplification kana resistant gene are as shown in table 2, table 3.Obtained UL55 DNA homolog Target practice sheet segment length 1577bp.Glue reclaims after purification, is dissolved in 30 μ l aquesterilisa, takes ultraviolet spectrophotometer after a small amount of suitably dilution Measure the concentration reclaiming kana fragment.

PKD46 is converted to the DH10B comprising DPV CHv-BAC-G infection clones by 3.2

From-70 DEG C of refrigerators, take out the pKD46 strain of preservation, line LB/Amp flat board, be inverted flat board and be placed in 30 DEG C of trainings Support in case and cultivate 16-24 hour.Select monoclonal next day to carry out increasing bacterium, routine side after 13-16h in LB/Amp fluid medium Method extracts plasmid in a small amount.Meanwhile, taking out the strain of the DH10B comprising DPV CHv-BAC-G infection clones, activation is made after increasing bacterium Standby Competent cell is also transformed into pKD46, the conversion bacterium solution coating LB/Cm/Amp flat board after recovering 30 DEG C, 30 DEG C of trainings Support carton upside down and cultivate 24-48h.

The 3.3 DH10B electricity comprising pKD46 and DPV CHv-BAC-G infection clones turn the preparation of competent cell

3.3.1RED the abduction delivering of recombination system

Select the single bacterium colony comprising pKD46 and DPV CHv-BAC-G that LB/Cm/Amp flat board grows, overnight train at 30 DEG C Support.Overnight culture is inoculated in fresh LB/Cm/Amp culture medium by next day in the ratio of 1:50,30 DEG C, 220rpm violent Concussion is cultivated, and every 20min surveys an OD600, adds the L-arabinose induction of final concentration of 100mM as OD600=0.1 The expression of pKD46 upper exo, Beta, Gam albumen.The bacterium adding L-arabinose is put back in shaking bath, continues to cultivate, often 30min surveys an OD600, until OD600 is 0.5 0.7, stops cultivating, is immediately placed on 15-30min on ice, makes culture thorough The end, cools down.

3.3.2 the electricity comprising pKD46 and DPV CHv-BAC-G infection clones turns the preparation of competent cell

Take the Induced cultures after the cooling that 3.3.1 obtains, prepare electricity transformed competence colibacillus according to the method for embodiment 1, put Convert standby in doing electricity on ice.

3.3.3 electricity converts the bacterial strain that fragment of linearly practicing shooting proceeds to express RED recombinase gene

3.3.3.1 it is electroporated

The 50 μ l that the linear kana resistance gene fragment that 100ng reclaims joins preparation in 3.3.2 express RED recombinase In the Electroporation-competent cells of gene, program is set according to the method for embodiment 1 and carries out electroporated, converted and transferred to In test tube after 37 DEG C of recovery 2h, take 200 μ l bacterium solution coating LB/Cm/Kana flat boards, remaining centrifugal after be applied to another one LB/Cm/Kana flat board, 37 DEG C of incubators are inverted and are cultivated 16-24h.

3.3.3.2 first round RED restructuring is identified

After growing monoclonal on the flat board that first round restructuring electricity converts, choose the UL55 gene delection mirror in several table 6 Determine primer and carry out bacterium colony PCR qualification.Result shows under the effect of RED recombinase, the Kana fragment success of band UL55 homology arm Recombinate on DPV CHv-BAC-G genome.It is a length of that disappearance identifies that primer amplification Kana replaces front UL55 gene region fragment The a length of 1895bp of purpose region segments after 979bp, Kana replacement.Bacterium colony PCR is identified that correct clone puts into containing Cm/ The LB fluid medium of Kana resistance is carried out cultivate, conservation.

4 second take turns RED restructuring removes Kana resistant gene

4.1 remove kana resistant gene

(1) from-70 DEG C of refrigerators, take out the Pcp20 strain of preservation, line LB/Amp flat board, be inverted for 30 DEG C and cultivate 24- 48h.Select the monoclonal inoculation LB/Amp fluid medium grown to carry out increasing bacterium, extracting plasmid, after being dissolved in appropriate aquesterilisa, 4 DEG C save backup.

(2) take first round RED restructuring and identify correct monoclonal, after LB/Cm/Kana cultivates 13-16h, by the ratio of 1:50 Example is inoculated in LB/Cm/Kana fluid medium, prepares Competent cell.

(3) Competent that chemical conversion 0.5pg Pcp20 plasmid eliminates UL55 gene to first round RED restructuring is thin In born of the same parents.

(4) the conversion bacterium solution after 30 DEG C of recovery 2h is taken 100 μ l LB and do 10^-1-10^-5Doubling dilution, finally takes 100 μ l10^-4With 10^-5Cultivation 2 LB/Cm/Amp flat boards of coating of dilution, cultivate 24h for 30 DEG C.

(5) monoclonal grown on plate of making even lines LB/Cm flat board, is inverted flat board and cultivates 16-in 42 DEG C of incubators 24h。

4.2 second take turns RED restructuring identifies

4.2.1 bacterium colony PCR identifies

After second takes turns and grow monoclonal on the flat board that restructuring 42 DEG C is cultivated, choose the UL55 gene delection in several table 6 Identify that primer carries out bacterium colony PCR qualification.Qualification result shows by proceeding to Pcp20 in escherichia coli so that it is expresses and can identify The FLP recombinase excision Kana resistant gene in FRT site, then by 42 DEG C of hot inactivation temperature sensitive plasmid Pcp20, it is thus achieved that knock out The gene-deleted strain DPV CHv-BAC-G Δ UL55 of the whole ORF of UL55.PCR result shows, after removing Kana resistant gene, identifies Primer amplification UL55 gene region only remains 502bp, consistent with expected results (Fig. 8).Order-checking identifies that correct rear input contains further The LB fluid medium of Cm resistance is carried out cultivate, conservation.

5 rescue recombinant virus DPV CHv-BAC-G Δ UL55

In 5.1, amount extracts DPV CHv-BAC-G Δ UL55 plasmid

Cultivated identifying that correct DPV CHv-BAC-G Δ UL55 clone puts in 100ml LB/Cm fluid medium Night, 13-16h, extracted recombiant plasmid by the description of Qiagen Plasmid Midi kit, and aquesterilisa takes a small amount of purple after dissolving Outer spectrophotometric determination concentration, remaining-4 DEG C save backup.

5.2 rescue DPV CHv-BAC-G Δ UL55 viruses

Taking the recombinant clone plasmid DPV CHv-BAC-G Δ UL55 that 2.5 μ g extract, conventional method is transfected into and grows up to monolayer In DEF cell, 37 DEG C, 5%CO2 incubator is cultivated 4～6 days, observe fluorescent plaques.Harvesting, after multigelation three times, Blind passage three generations removes the plasmid of transient expression, results frozen virus to expand viral yield simultaneously.

The qualification of 5.3 rescue recombinant virus DPV CHv-BAC-G Δ UL55

Using rescue DPV CHv-BAC-G Δ UL55 infection cell DNA as template, by the UL55 gene delection in table 6 Identify that primer carries out PCR amplification.Infect DEF cell DNA with DPV CHv, DPV CHv-BAC-G simultaneously and carry out amplification work for template For comparison (Fig. 9).Electrophoresis result shows, it is later that rescue UL55 gene delection virus can only amplify UL55 full genome disappearance 502bp fragment, the DPV CHv of correspondence, DPV CHv-BAC-G then can amplify the 979bp fragment including UL55 gene. Resisting as one with rabbit anti-UL55 polyclonal antibody further, the goat-anti rabbit of TRITC labelling is as two anti-IFA detection UL55 genes Expression, result shows that DPV CHv-BAC-G Δ UL55 can not detect the expression of UL55 gene, and its parent plant DPV UL55 gene normal expression in CHv-BAC-G, proves that UL55 gene-deleted strain DPV CHv-BAC-G Δ UL55 is built into further Merit.

6DPV CHv-BAC-G Δ UL55R back mutation builds

For building the back mutation strain DPV CHv-BAC-G Δ UL55R of DPV CHv-BAC-G Δ UL55, line is passed through in design Property practice shooting the UL55-Kana fragment of both sides band about UL55 homology arm inserted DPV CHv-BAC-G Δ UL55 recombinant virus UL55 gene delection region, then take turns RED restructuring elimination Kana resistant gene by second, it is thus achieved that recover the reply of UL55 gene Strain DPV CHv-BAC-G Δ UL55R.

6.1UL55-Kana the acquisition of linear target practice fragment

Sequential design two according to DPV CHv and pKD4 is to primer, and amplification UL55 and kana sequence, then passes through respectively UL55 downstream of gene primer and Kana upstream region of gene primer 5 ' end overlapping complementary part, be connected to UL55 fragment and Kana fragment Together, as the fragment of linearly practicing shooting building back mutation first round Red restructuring.In order to carry out RED homologous recombination target practice, design The forward primer of UL55 gene and the downstream primer 5 ' end of Kana gene include the homology arm of UL55 gene both sides about 50bp.

(1) amplification of UL55 and kana genetic fragment, purification: conventional method extracts DPV CHv cell DNA and pKD4 matter Grain, as pcr template, expands UL55 and kana genetic fragment respectively with the primer in table 6, amplification system and program reference table (PRT) 2, Table 3.After amplification, 1% sepharose electrophoresis is identified and reclaims.UL55 and kana fragment after reclaiming is dissolved in aquesterilisa, Measuring on ultraviolet spectrophotometer after taking a small amount of suitably dilution and reclaim fragment concentrations, remaining 4 DEG C save backup.

(2) over-lap PCR (splicing by overlapping extension PCR, SOE-PCR): add equimolar Step (1) reclaims, UL55 and the kana genetic fragment of purification as template, utilize UL55 according to table 7, the system of table 8 and program Overlap extension is carried out with the complementary portion of kana fragment.Using UL55-kana genetic fragment good for overlap as template, with UL55 base Because the forward primer of fragment and the downstream primer of kana genetic fragment carry out PCR again as primer, the amount of overlapping products is made to expand Greatly.The system of PCR and program are as shown in table 9, table 10 for the second time.

Table 7 over-lap PCR first round reaction system

Table 8 over-lap PCR first round PCR reaction condition

Table 9 over-lap PCR second takes turns reaction system

Table 10 over-lap PCR second takes turns PCR reaction condition

(3) recovery of UL55-Kana linearly target practice fragment, purification: by UL55-through two-wheeled over-lap PCR in step (2) Kana amplified production, identifies with 1% agarose gel electrophoresis, and carries out glue recovery, purification recovery fragment, and measures concentration As the homology arm target practice fragment building Δ UL55 gene-deleted strain back mutation.

6.2 first round RED recombinate (DPV CHv-BAC-G Δ UL55 genome of being recombinated to by UL55-Kana)

Electroporated target practice fragment UL55-Kana in the DH10B comprising DPV CHv-BAC-G Δ UL55 and pKD46, Under the effect of RED recombinase, the UL55-Kana fragment of band UL55 homology arm is successfully recombinated DPV CHv-BAC-G Δ UL55 base Because of in group.Disappearance identifies that primer amplification Kana replaces the front a length of 979bp of UL55 gene region fragment, after UL55 gene delection This zone length is a length of 1895bp of purpose region segments after 502bp, UL55-Kana replace, consistent with expected results.

6.3 second take turns RED restructuring (removing Kana)

The removal of Kana resistant gene is the same with the method for the present embodiment 4.1, by converting PCp20 temperature-sensitive plasmid Mediation second is taken turns RED restructuring and is eliminated kana resistance.PCR qualification result shows, after UL55 gene is replied, identifies primer amplification UL55 Gene region produces the fragment (remaining 84bp FRT sequence) of 1063bp, consistent with expected results, DPV CHv-BAC-G Δ UL55R back mutation strain successfully constructs (Figure 10).

6.4RFLP analyze

With in Qiagen Plasmid Midi Kit amount extract DPV CHv-BAC-G, DPV CHv-BAC-G Δ UL55, DPV CHv-BAC-G Δ UL55R plasmid, respectively takes 1 μ g respectively with EcoRI, BamHI enzyme action 1-2h.All 25 μ l digestion products are complete Portion's loading, 1% gel electrophoresis 20V, 0.01A electrophoresis 16-17 hour.After electrophoresis completes, with 10-20 μ l EB airtight dyeing 2-3h, Gel imaging instrument is recorded as picture.Result display DPV CHv-BAC-G and DPV CHv-BAC-G Δ UL55R is through BamHI, EcoRI enzyme The band zero difference produced after cutting, and consistent with intended enzyme action spectrogram band.In contrast, corresponding UL55 gene delection Strain has then lacked a band in about 4kb after EcoRI enzyme action, about 6kb adds a band (Figure 11 A/B*), The restriction analysis result of BamHI is then identical with DPV CHv-BAC-G, DPV CHv-BAC-G Δ UL55R, with intended cleavage map Compose completely the same.Show by 2 take turns RED restructuring successfully construct UL55 gene-deleted strain DPV CHv-BAC-G Δ UL55 and Its back mutation strain DPV CHv-BAC-G Δ UL55R.

The rescue of 6.5DPV CHv-BAC-G Δ UL55/R and the qualification of Revive virus

The DPV CHv-BAC-G Δ UL55R plasmid that transfection is extracted, to DEF cell, saves out the DPV that can produce pathological changes CHv-BAC-GΔUL55R.And using the DNA of this infection cell as template, carry out PCR amplification with UL55 gene cloning primer.With Time with DPV CHv, DPV CHv-BAC-G, DPV CHv-BAC-G Δ UL55R infect DEF cell DNA for template carry out amplification make For comparison.Electrophoresis result shows, the UL55 gene delection reply strain of rescue can amplify and include that UL55 full genome and 84bpFRT are residual Stay sequence then can only amplify the UL55 gene of 795bp, DPV at interior 879bp, corresponding DPV CHv, DPV CHv-BAC-G CHv-BAC-G Δ UL55 then can not amplify corresponding band.Resist as one with rabbit anti-UL55 polyclonal antibody further, The goat-anti rabbit of TRITC labelling is as the expression (Figure 12) of two anti-IFA detection UL55 genes, and result shows DPV CHv-BAC- G Δ UL55 can not detect the expression of UL55 gene, and its parent plant DPV CHv-BAC-G and back mutation strain DPV CHv- UL55 gene normal expression in BAC-G Δ UL55R, proves UL55 gene delection back mutation strain DPV CHv-BAC-G further Δ UL55R successfully constructs, and the phenotype of UL55 gene is replied.

The extracorporeal biology of 7 rescue recombinant virus DPV CHv-BAC-G Δ UL55, DPV CHv-BAC-G Δ UL55/R is special Property analyze

7.1 plaque assays

Method with reference to embodiment 1 carries out plaque assays, result display parent poison CHv, rescue recombinant virus DPV CHv- BAC-G, UL55 gene-deleted strain DPV CHv-BAC-G Δ UL55 and UL55 gene delection back mutation strain DPV CHv-BAC-G Δ UL55R is after host cells infected DEF, and the plaque size of formation is close, form the most closely similar (Figure 13 A-D).

7.2 one step growth curves measure

Recombinant virus DPV CHv-BAC-G, UL55 gene-deleted strain DPV CHv-BAC-G Δ UL55 is saved with 0.02MOI Infecting DEF with UL55 gene delection back mutation strain DPV CHv-BAC-G Δ UL55R, different time points after infection is collected Cell sample, measures the titre (Figure 14 A, B) of virus.It can be seen that in front 24h after infection, infection cell Upper cleer and peaceful cell all can't detect the increase of viral level, illustrate that it is in latency.After infecting 24h, the two is upper Content in cleer and peaceful cell all dramatically increases, and the virus in cell during 48h.p.i is not further added by, and the content in supernatant exists Continue to increase, illustrate that the duplication of now virus comes into cracking release period.Build with DPV CHv-BAC-G for parent plant UL55 gene-deleted strain DPV CHv-BAC-G Δ UL55 and UL55 gene delection back mutation strain DPV CHv-BAC-G Δ UL55R The appeal of cell is sufficiently close to, and shows identical trend, speculate accordingly, the duplication and right of UL55 gene and virus The appeal of cell is unrelated.

8DPV UL55 gene and the common positioning scenarios analysis of UL26.5

8.1UL55 Yu UL26.5 common location in DPV CHv host cells infected

For detection UL55 and the UL26.5 albumen common positioning scenarios in DPV host cells infected, mouse-anti UL55 is used in design Antibody and rabbit anti-UL26.5 antibody anti-carry out IFA detection as one.Conventional method prepares DEF cell, and inoculates DPV CHv.60h after infection, takes out kind of a creep plate for full cell, operates according to indirect immunofluorescence method.Concrete condition such as table 11 Shown in.Shown in Figure 15 A-D, UL55 albumen, after DPV CHv infection cell 60h, is gathered into fluorescent spot and is distributed widely in core week also Fraction is had to be present in nucleus.UL26.5 albumen then forms dazzling fluorescent spot and is distributed widely in nucleus and nuclear membrane is attached Closely (Figure 15 E-H).The common positioning scenarios display UL55 albumen distribution in DPV CHv infection cell of the two adjoins with UL26.5 And have fraction overlapping (Figure 15 L yl moiety).

Table 11UL55 Yu UL26.5 common positioning analysis in DPV CHv host cells infected

8.2UL55 albumen to UL26.5 albumen at the function analysis of intracellular targeting

For analyzing whether UL55 albumen exists interaction, design UL55 gene-deleted strain DPV with UL26.5 further CHv-BAC-G Δ UL55 infection cell, the positioning scenarios of UL26.5 albumen after indirect immunofluorescene assay UL55 gene delection, with Time detection DPV CHv-BAC-G Δ UL55 parent plant DPV CHv-BAC-G and its back mutation strain DPV CHv-BAC-G Δ In UL55R host cells infected, the distribution situation of UL26.5 is as comparison.Process and indirect immunofluorescence bar to infection cell Part is as shown in table 12.

Table 12UL55 albumen to UL26.5 albumen at the function analysis of intracellular targeting

From Figure 14 E-H it can be seen that the DEF cell that UL55 gene-deleted strain infects, UL26.5 albumen is infecting carefully The nucleus of born of the same parents sends dazzling fluorescence and expresses, with recombinant virus EGFP gene, the green fluorescence that sends and overlap.Correspondingly, UL55 gene delection parent plant DPV CHv-BAC-G and its back mutation strain DPV CHv-BAC-G Δ UL55R also been observed phase Same positioning scenarios (Figure 16 A-D, I-L).Show UL26.5 albumen that UL55 gene-deleted strain encodes and street strain coding UL26.5 albumen location zero difference in host cell, although the location that UL26.5 is in host cell and UL55 albumen are at sky Between adjacent and partly overlap in structure, but the location of UL26.5 albumen is not affected by UL55 albumen.

Described above illustrate and describes some preferred embodiments of invention, but as previously mentioned, it should be understood that invention is not It is confined to form disclosed herein, is not to be taken as the eliminating to other embodiments, and can be used for other combinations various, amendment And environment, and can be carried out by above-mentioned teaching or the technology of association area or knowledge in invention contemplated scope described herein Change.And the change that those skilled in the art are carried out and change are without departing from the spirit and scope of invention, the most all should weigh appended by invention In the protection domain that profit requires.

Claims

1. a restructuring duck plague virus, it is characterised in that include duck plague virus whole genome sequence, described duck plague virus full genome Group sequence has been inserted into transfer vector pUC18/EGFP-TKAB-BAC11 sequence, described transfer vector pUC18/EGFP-TKAB- BAC11 sequence include bacterial artificial chromosome Core Feature element (mini-F sequence), selection markers green fluorescent protein EGFP, Cm resistance marker and two loxp sites；Described transfer vector sequence is as shown in SEQ ID NO.1；The nucleoside in described loxp site Acid sequence is as shown in SEQ ID NO.24.

Restructuring duck plague virus the most according to claim 1, it is characterised in that described transfer vector pUC18/EGFP-TKAB- The insertion point of BAC11 is between the 250-251 nucleotide of DPV CHv TK gene, and the left and right sides homology arm of transfer vector is respectively Named for TKA with TKB；The nucleotide sequence of described TKA is as shown in SEQ ID NO.22, and the nucleotide sequence of described TKB is such as Shown in SEQ ID NO.23.

Restructuring duck plague virus the most according to claim 1, it is characterised in that described restructuring duck plague virus is with antibacterial and virus Two kinds of forms preserve.

4. a transfer vector construction method, it is characterised in that comprise the following steps:

1) with plasmid pEGFP-Δ MCS as template, PCR expands EGFP expression cassette and by its sub-clone to pUC18, it is thus achieved that pUC18/ EGFP；

2) with the DPV DNA that extracts as template, TK gene insertion site left and right sides homology arm TKA, TKB, and sub-gram one by one are expanded Grand to pUC18/EGFP, it is thus achieved that pUC18/EGFP-TKAB；The nucleotide sequence of described TKA is as shown in SEQ ID NO.22, described The nucleotide sequence of TKB is as shown in SEQ ID NO.23；

3) by Sph I linearization for enzyme restriction pBeloBAC11 plasmid, and the pUC18/EGFP-that itself and identical enzyme action were processed TKAB is attached, Amp/Cm Double recombinant celo virus transfer vector pUC18/EGFP-TKAB-BAC11.

5. the construction method of a bacterial artificial chromosome restructuring duck plague virus rescue system platform, it is characterised in that will include The transfer vector sequence of bacterial artificial chromosome (BAC) Core Feature element (mini-F) and green fluorescent protein (EGFP) is inserted To the TK region of duck plague virus China virulent strain (the NCBI Accession NO.JQ647509) genome up to 162kb, electricity Converting after the positive colony obtained after escherichia coli DH10B extracts plasmid and transfect DEF (DEF), saving out can be The bacterial artificial chromosome restructuring duck plague virus DEVCHv-BAC-G of green fluorescence is produced on host cell DEF.

The construction method of bacterial artificial chromosome the most according to claim 5 restructuring duck plague virus rescue system platform, its Being characterised by, described construction method is specifically implemented according to following steps:

1) TK gene left and right homology arm, EGFP green fluorescence expression cassette, pBeloBAC11 core are included by multistep clone's structure The restructuring duck plague virus transfer vector pUC18/EGFP-TKAB-BAC11 of function element three part composition；

2) extracting restructuring duck plague virus metastasis transplanting physique grain and jointly transfect DEF cell with DPV DNA, screening can send green glimmering The restructuring duck plague virus DPV CHv-BAC-G of light；

3) during PCR identifies restructuring duck plague virus DPV CHv-BAC-G, DPV genomic gene and BAC primary functional elements is complete Property；

4) extracting the DPV CHv-BAC-G in cyclisation period, electricity converts to escherichia coli DH10B competent cell, Cm resistant panel Screening positive clone pBAC-DPV；Wherein, cyclisation refers to 30-50% cytopathy period period；

5) extract PCR and restriction enzyme mapping identifies correct pBAC-DPV plasmid, transfect DEF cell, save out and include that DPV CHv is complete The infection clones of genome.

The construction method of bacterial artificial chromosome the most according to claim 6 restructuring duck plague virus rescue system platform, its It is characterised by, builds bacterial artificial chromosome restructuring duck plague virus rescue platform the primer as follows:

TKAF:5 '-3 ', GAATTCATGCTTGCCATCATAACCGTATTCTC, nucleotide sequence is as shown in SEQ ID NO.2；

TKAR:5 '-3 ', TCTAGAATAACTTCGTATAATGTATGCTATACGAAGTTATCACCTCGAGCTTTTCT TTCCTG TG, nucleotide sequence is as shown in SEQ ID NO.3；

TKBF:5 '-3 ', GCATGCACATAGCAACAACTGACGCAAAAGC, nucleotide sequence is as shown in SEQ ID NO.4；

TKBR:5 '-3 ', AAGCTTTCCCAGAAAGCTCGCCTAGGTCCTC, nucleotide sequence is as shown in SEQ ID NO.5；

EGFPF:5 '-3 ', TCTAGATAGTTATTAATAGTAATCAATTACG, nucleotide sequence is as shown in SEQ ID NO.6；

EGFPR:5 '-3 ', GTCGACATGCAGTGAAAAAAATGCT, nucleotide sequence is as shown in SEQ ID NO.7；

8. utilize the weight that the bacterial artificial chromosome restructuring duck plague virus rescue system platform described in claim 5 or 6 builds Group duck plague virus UL55 gene-deleted strain and back mutation strain thereof.

9. the bacterial artificial chromosome restructuring duck plague virus rescue system platform described in claim 5 or 6 is at duck plague virus base Because of function, viral pathogenesis mechanism and duck plague virus based on this platform prevention and other birds infectious disease restructuring duck plague virus Application in terms of vaccine research, it is characterised in that include on other birds infectious disease genes and DPV CHv-BAC-G genome The replacement in any site or insertion, other birds infectious disease described are include causing the Anseriformes fowl included including chicken, duck, goose The viral infectious of class.