CN109576295A - A kind of duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC and its construction method - Google Patents

A kind of duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC and its construction method Download PDF

Info

Publication number
CN109576295A
CN109576295A CN201811599539.8A CN201811599539A CN109576295A CN 109576295 A CN109576295 A CN 109576295A CN 201811599539 A CN201811599539 A CN 201811599539A CN 109576295 A CN109576295 A CN 109576295A
Authority
CN
China
Prior art keywords
minif
chv
gene
kana
dpv
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201811599539.8A
Other languages
Chinese (zh)
Inventor
程安春
周晓凤
汪铭书
刘田
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sichuan Agricultural University
Original Assignee
Sichuan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sichuan Agricultural University filed Critical Sichuan Agricultural University
Priority to CN201811599539.8A priority Critical patent/CN109576295A/en
Publication of CN109576295A publication Critical patent/CN109576295A/en
Priority to PCT/CN2019/122997 priority patent/WO2020134924A1/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16311—Mardivirus, e.g. Gallid herpesvirus 2, Marek-like viruses, turkey HV
    • C12N2710/16321—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16311—Mardivirus, e.g. Gallid herpesvirus 2, Marek-like viruses, turkey HV
    • C12N2710/16322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/20—Pseudochromosomes, minichrosomosomes
    • C12N2800/204—Pseudochromosomes, minichrosomosomes of bacterial origin, e.g. BAC
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of duck plague viruses to remove MiniF element gC gene-deleted strain DPV CHv- Δ gC and its construction method.The present invention utilizes GS1783 coli strain and pEPKan-S plasmid, MiniF element is lacked by intracellular spontaneous methods of homologous recombination in bacterial artificial chromosome recombination duck plague virus rescue system platform, completes the building of the seamless gene-deleted strain of no remaining duck plague virus of MiniF element for the first time.MiniF element is remained when technical solution of the present invention solves the problems, such as to lack duck plague virus gene on duck plague virus genome, provides sufficient technical support accurately to probe into the building of duck plague virus gene function and attenuated live vaccine.

Description

A kind of duck plague virus go MiniF element gC gene-deleted strain DPV CHv- Δ gC and its Construction method
Technical field
The invention belongs to gene engineering technology fields, and in particular to a kind of duck plague virus goes MiniF element gC gene delection Strain DPV CHv- Δ gC and its construction method.
Background technique
Bacterial artificial chromosome (bacterial artificial chromosome, BAC) is one kind using F plasmid as base The bacterial chromosome cloning vector that plinth is constituted is commonly used to the DNA fragmentation of clone 150kd or so size, 300kd at most storable Base-pair, the plasmid mainly include oris, and repE (control F plasmid replication) and parA, parB (control copy number) etc. are constituted, with The carrier cloned based on BAC is lower at the efficiency of chimera, high conversion efficiency, and is present in bacterial body with cyclic structure It is interior, it is easy to differentiate and isolate and purify, be currently used primarily in Large-insert genomic library constructs grind related to big gene cluster Study carefully.Whole viral genes group DNA molecular is inserted into BAC carrier, utilizes the minimum fertility factor replicon of the vector encoded (Minimal fertility factor replicon, Mini-F) obtains molecular cloning virus, and combines in Escherichia coli Mature assignment of genes gene mapping modification technique, to realize the insertion of the missing of viral gene and foreign gene in prokaryotic system.Mesh Preceding more common bacillus coli gene locator qualification technology mainly includes homologous recombination technique, the RecA albumen that Red/ET is mediated The homologous recombination technique and Tn that homologous recombination technique, the Cre/loxP of mediation are mediated transposon-mediated radom insertion and mutation Technology.Mature bacterial artificial chromosome duck plague virus, which has been obtained, using molecular cloning technological means saves system platform, The homologous recombination technique mediated simultaneously using bacillus coli gene locator qualification Red/ET can be in bacterial artificial chromosome duck plague disease The missing of duck plague virus gene and the insertion of foreign gene are carried out in poison rescue system platform, which has greatly pushed duck plague The flow of research of known viral gene function.
MiniF element is as the minimum fertility factor replicon for maintaining BAC carrier duplication, mainly by regulation BAC duplication SopA, sopB gene and encode centromere region that repE, repF gene, the regulation replicon of starting point (oriS) distribute SopC gene is constituted.MiniF element joined resistance screening gene and fluorescent marker gene, with complete bacterial resistance screening and BAC label screening,.MiniF element is inserted into viral genome, increases genome length, generates uncertain influence to virus replication. MiniF element remains in viral genome as bacterial sequences simultaneously, is unfavorable for the exploitation and license of attenuated live vaccine.Therefore Obtain removal MiniF element gene-deleted strain, it has also become probe into the emphasis of duck plague virus gene delection method.
Duck plague (Duck Plague, DP) be by duck plague virus in Alphaherpesviridae (Duck Plague virus, The acute contact height lethal infectious diseases of the aquatic birds such as duck caused by DPV), goose.The disease is reported by Holland first, immediately at me The more flourishing area of the duck culturing industries such as state south China, Central China and East China is popular, causes serious economic damage to the duck culturing industry in China It loses.Therefore it understands duck plague virus gene function in depth, reinforce to the research of duck plague epidemic disease to ensuring China's duck culturing industry health, can hold Supervention exhibition is particularly important.
Duck plague virus DPV-CHv pnca gene group DNA overall length 162175bp, includes 78 open reading frame, and codified participates in The structural proteins and functional protein of duck plague virus life cycle, wherein structural proteins mainly include constitute virus cyst membrane, interbed, Capsid and DNA binding protein.Envelope protein be glycosylation albumen, including gB, gC, gD, gE, gG, gH, gI, gJ, gK, gL, gM, 12 kinds of gN.Herpesviral membrane glycoprotein virus structure, function and in terms of play an important role.Therefore it visits Study carefully effect of the membrane glycoprotein in duck plague virus life cycle to deeply probe into duck plague virus gene function and carry out duck plague epidemic disease Sick preventing and controlling are most important.
It is utilized in the prior art using BAC as the technology of plateform molecules cloning virus, duck plague virus genome recombination is arrived In Baculovirus transfer vector containing BAC, by duck plague virus China velogen strain (DPVCHv) genome that will be up to 162kb or so It is cloned into bacterial artificial chromosome (BAC), the positive colony obtained after electrotransformation e. coli DH10B transfects after extracting plasmid Duck embryo fibroblasts (DEF) save out the bacterial artificial chromosome that green fluorescence and plaque can be generated on host cell DEF The obtained recombinant virus DEV CHv-BAC-G of duck plague virus DEV CHv-BAC-G is recombinated, can be given birth in the cell with virus form It deposits, can also be replicated in Escherichia coli in the form of plasmid, we are grasped with the mature heredity of E. coli system Make means to modify any position of DPVCHv genome, be transformed, study.But using Red/ET modification technique in bacterium people Work Chromosome recombination duck plague virus save system platform on to duck plague virus gene delection after, MiniF element can be remained.MiniF There is the probing into of gene function, the exploitation of attenuated live vaccine and license and influence in the residual of element.
Summary of the invention
For above-mentioned deficiency in the prior art, the present invention provides a kind of duck plague virus and goes MiniF element gC gene delection Strain DPV CHv- Δ gC and its construction method can effectively solve the problems, such as residual MiniF element.
To achieve the above object, the technical solution adopted by the present invention to solve the technical problems is:
A kind of duck plague virus removes the construction method of MiniF element gC gene-deleted strain DPV CHv- Δ gC, including following step It is rapid:
It (1) is amplification template with pKD4 plasmid, building △ gC expands kana upstream primer and building △ gC expands the downstream kana and draws Object, the kana resistance gene fragment by PCR method amplification comprising two sides with gC DNA homolog arm and FRT sequence, cuts glue and returns It receives, obtains DPV gC left arm-FRT-kana-FRT-gC right arm segment；
(2) induction is expressed containing pKD46 and DPV CHv-BAC-G clone bacterium DH10B RED recombination system；And it prepares and contains The DH10B positive colony bacterium competence of pKD46 and DPV CHv-BAC-G；Electrotransformation gel extraction DPV gC left arm-FRT- Kana-FRT-gC right arm target practice segment enters in the competence containing pKD46 and infective cloned plasmids；Screening positive clone Son utilizes gC identified for genes primer gC-R；GC-F carries out PCR identification, obtains positive clone molecule DPV CHv-BAC-G △ gC- kana；
(3) the kana resistant gene in positive clone molecule DPV CHv-BAC-G △ gC-kana is removed, is reflected using gC gene Determine primer gC-R；GC-F carries out PCR identification, obtains positive clone molecule DPVCHv-BAC-G △ gC；
(4) recombination DPV CHv-BAC-G △ gC plasmid is extracted, its electrotransformation is entered in GS1783 competence, obtains sun Property clone GS1783-DPV CHv-BAC-G △ gC, and prepare GS1783-DPVCHv-BAC-G △ gC competence；
(5) using pEPKan-S as template, GS1783-MiniF-F and GS1783-MiniF-R are primer, pass through PCR method Base fragment of the amplification comprising I_SceI restriction enzyme site and Kana element, be located at MiniF element ori2 downstream of gene 240bp and Homology arm segment I_SceI-Kana-MiniF at MiniF element ori2 downstream of gene 290bp, gel extraction obtain I_ SceI-Kana-MiniF segment；
(6) using CHv genome as template, CHv-UL23-F and CHv-UL23-R are primer, include by PCR method amplification UL23 gene, the downstream I_SceI-Kana-MiniF homology arm are overlapped 25bp and are located at MiniF element ori2 downstream of gene 180bp The homology arm segment at place, gel extraction obtain UL23-MiniF segment；
(7) using I_SceI-Kana-MiniF segment and UL23-MiniF segment as template, PCR fusion reaction is carried out, then To merge segment as template, PCR amplification is carried out using GS1783-MiniF-F and CHv-UL23-R as primer, obtains I_SceI- Kana-MiniF-UL23 target practice segment；
(8) I_SceI-Kana-MiniF-UL23 target practice segment is transformed into GS1783-DPVCHv-BAC-G △ gC impression It in state, is identified through antibiotic-screening and PCR, obtains positive clone molecule GS1783-DPV CHv-BAC-G △ gC-UL23-Kana；
(9) by the I_SceI-Kana segment in positive clone molecule GS1783-DPV CHv-BAC-G △ gC-UL23-Kana Remove, obtains positive clone molecule GS1783-DPV CHv-BAC-G △ gC-UL23；
(10) DPVCHv-BAC-G △ gC- is extracted from positive clone molecule GS1783-DPV CHv-BAC-G △ gC-UL23 UL23 plasmid obtains removal MiniF member by colony screening with DPV CHv-BAC-G △ gC-UL23 plasmid transfection DEF cell The DPV CHv- △ gC of part.
Further, PCR amplification system in step (1) are as follows: ddH2O 14μL、MaxDNA 20 μ L of Polymerase, 2 μ L of upstream primer, 2 μ L of downstream primer, 2 μ L of template；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 1min, 94 DEG C of denaturation 15s, 55 DEG C of annealing 15s, 72 DEG C of extension 1min, altogether 30 circulations, last 72 DEG C of extensions 10min.
Further, primer sequence in step (1) are as follows:
△ gC expands kana segment upstream primer:
5’-GCCGGTGTATCCTTCGTACATCATCAAGTTGTAACAATACTTAACGATTCTATATCGTGTAGGCT GGAGCTGCTTC-3'；
△ gC expands kana segment downstream primer:
5’-TAAAACGTCGTTTATTTATCAAAAGCTTTATTAAACATTTTATATTAAACCAGTATCATATGAAT ATCCTAATTAG-3’。
Further, PCR amplification system in step (2) and (3) are as follows: ddH2O 6μL、2×Taq PCRMasterMin10μ L, 1 μ L of upstream primer, 1 μ L of downstream primer, 2 μ L of template；
PCR amplification condition are as follows: 95 DEG C of initial denaturation 5min, 94 DEG C of denaturation 4min, 55 DEG C of annealing 30s, 72 DEG C of extension 2min, altogether 30 circulations, last 72 DEG C of extensions 10min.
Further, primer sequence in step (2) and (3) are as follows:
△ gC identifies upstream primer: 5 '-ATGGTAAGCACATAAAAGTGTCGT-3 '；
△ gC identifies downstream primer: 5 '-ATTGCTATCCTATCAGTCCGTA-3 '.
Further, primer sequence described in step (5) are as follows:
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTC ATGATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3'；
GS1783-MiniF-R:5’-ATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTAT tagggataacagggtaatcgat-3’。
Further, primer sequence in step (6) are as follows:
CHv-UL23-F:5'-GCCTGCAAGCGGTAACGAAAACGATtcaattaattgtcatctcgg-3'；
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCAT ATTCAACGGACATATTAAAAATTGA-3’。
Further, PCR fusion system in step (7) are as follows: ddH2O 8μL、Max DNA 10 μ L of Polymerase, template I_SceI-Kana-MiniF segment and each 1 μ L of UL23-MiniF segment；
PCR fusion conditions are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 55 DEG C of annealing 5s, 72 DEG C of extension 1min, totally 5 A circulation.
Further, PCR amplification system in step (7) are as follows: fusion 20 μ L of template, upstream primer GS1783-MiniF-F 0.5 μ L, 0.5 μ L of downstream primer CHv-UL23-R；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min.
The duck plague virus of above method building removes MiniF element gC gene-deleted strain DPV CHv- Δ gC.
The invention has the benefit that
The present invention utilizes Red-based on the basis of bacterial artificial chromosome recombination duck plague virus rescue system platform Modification technique utilizes the GS1783 coli strain containing codified Red operon and I_SceI enzyme gene sequence and contains There is coding card to receive the plasmid pEPKan-S of resistance and I_SceI restriction enzyme site, is lacked through intracellular spontaneous methods of homologous recombination MiniF element completes the building of the remaining duck plague virus gene-deleted strain of no MiniF element for the first time；Solves missing duck plague virus The problem of MiniF element remains when gene, provides accurately to probe into the building of duck plague virus gene function and attenuated live vaccine Sufficient technical support.
Detailed description of the invention
Fig. 1 is pEPKan-S plasmid map；
Fig. 2 is to be lacked using Red-Based modification technique and intracellular spontaneous homologous recombination technique to MiniF element Operational flowchart；
Fig. 3 is picture after going MiniF element DPV CHv- Δ gC deleted virus strain virus to save；
Fig. 4 is the PCR detection that DPV CHv- Δ gC is inoculated with liver dna extract after duck 48h and 72h；
Fig. 5 is to remove MiniF element DPV CHv- Δ gC gene-deleted strain and DPV-CHv plants of plaque size comparing result figures；
Fig. 6 is to remove MiniF element DPV CHv- Δ gC gene-deleted strain and DPV-CHv plants of plaque detection schematic diagrams；Wherein, Fig. 6 a For DPV CHv- Δ gC gene-deleted strain plaque, Fig. 6 b is DPV-CHv plants of plaques.
Specific embodiment
A specific embodiment of the invention is described below, in order to facilitate understanding by those skilled in the art this hair It is bright, it should be apparent that the present invention is not limited to the ranges of specific embodiment, for those skilled in the art, As long as various change is in the spirit and scope of the present invention that the attached claims limit and determine, these variations are aobvious and easy See, all are using the innovation and creation of present inventive concept in the column of protection.
A kind of seamless gene-deleted strain DPV CHv- Δ gC of duck plague virus gC gene, building process material therefor and reagent are as follows:
1, experimental material
(1) cell, bacterial strain, virus stain, plasmid
Primary duck embryo fibroblasts are prepared according to a conventional method by the nonimmune fertilization duck embryos of 10-11 age in days；GS1783 bacterial strain It is saved by Sichuan Agricultural University laboratory；Bacterial artificial chromosome recombinates duck plague virus DPVCHv-BAC-G and its infection clones PBAC-DPV is prepared and is saved by Sichuan Agricultural University's prevention veterinary institute poultry diease center；PKD4 and pEPKan-S plasmid is by four River agriculture university laboratory saves.
2, molecular biology reagents
The small extraction reagent kit of plasmid is purchased from TIANGEN company；QIAGEN Plasmid Midi Kit is purchased from QIAGEN company； Plain agar sugar gel DNA QIAquick Gel Extraction Kit is purchased from TIANGEN company；Max DNA Polymerase purchase From Takara company；TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 is public purchased from TaKaRa Department；Lipofectamine 3000 is purchased from Invitrogen company；
3, solution used and its preparation are tested
LB liquid medium: weigh Tryptone 10g, Yeast Extract 5g, sodium chloride 10g be dissolved in 800mL go from It in sub- water, is sufficiently stirred, is settled to lL, autoclave sterilization.
LB solid medium: being added 15g agar powder in the LB liquid medium for being settled to 1L, after autoclave sterilization, 60 DEG C or so are cooled to, 1.5mL chloramphenicol (storage concentration 25mg/ml) or 1.5mL kanamycins (storage concentration 50mg/ is added ML), paved plate, after to be solidified, 4 DEG C of preservations.
MEM: being dissolved in 800mL deionized water for 9.6g MEM dry powder and 2.2g sodium bicarbonate, be sufficiently stirred, adjust pH value to 7.4, it is settled to lL, filtration sterilization, 4 DEG C of preservations.
Embodiment 1 prepares the duck plague virus gC gene-deleted strain DPV CHv- Δ gC for removing MiniF element
Building duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC, and construction method includes following step It is rapid:
1, pKD4 plasmid is extracted according to plasmid extraction kit (being purchased from TIANGEN company), and design primer △ gC expands Kana-F and △ gC expands kana-R, and primer particular sequence is as follows:
△ gC expands kana-F:5 '-GCCGGTGTATCCTTCGTACATCATCAAGTTGTAACAATACTTAACGATTCTA TATCGTGTAGGCTGGAGCTGCTTC-3'；(SEQ ID NO:1)
△ gC expands kana-R:5 '-TAAAACGTCGTTTATTTATCAAAAGCTTTATTAAACATTTTATATTAAACCA GTATCATATGAATATCCTAATTAG-3'；(SEQ ID NO:2)
(1) using pKD4 plasmid as amplification template, kana-F and △ gC is expanded using △ gC and expands kana-R as primer, passes through PCR It is left to obtain DPV gC for kana resistance gene fragment of the amplification comprising two sides with gC DNA homolog arm and FRT sequence, gel extraction Arm-FRT-kana-FRT-gC right arm segment；
PCR amplification system are as follows: ddH2O 14μL、20 μ L of Max DNA Polymerase, building △ GC expands 2 μ L of kana segment upstream primer, building △ gC expands 2 μ L of kana segment downstream primer, 2 μ L of template Pkd4 plasmid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 1min, 98 DEG C of denaturation 15s, 55 DEG C of annealing 15s, 72 DEG C of extension 1min, altogether 30 circulations, last 72 DEG C of extensions 10min are saved in 16 DEG C.
2, in the infection clones containing pKD46 and DPV CHv-BAC-G (pBAC-DPV) DH10B RED recombination system induction Expression and the preparation of competence and electricity turn gC left arm-FRT-kana-FRT- △ gC right arm target practice segment
(1) DH10B positive colony bacterium of the picking containing pKD46 and pBAC-DPV from the cryopreservation tube for saving strain, ammonia benzyl are anti- Property and 30 DEG C of LB plate of chlorampenicol resistant overnight, expand culture.
(2) picking identifies correct single colonie, is inoculated into the LB liquid medium of 5mL benzyl containing ammonia, 30 DEG C, 180rpm training It supports overnight.
LB liquid medium the preparation method comprises the following steps: weighing Tryptone 10g, Yeast Extract 5g, sodium chloride 10g It is dissolved in 800mL deionized water, is sufficiently stirred, be settled to lL, autoclave sterilization
(3) overnight thallus 100mL is inoculated by 2% inoculum concentration to contain in chloramphenicol and ammonia benzyl resistance LB liquid medium, 30 DEG C, 180r shakes bacterium.
(4) work as OD600When=0.2, the L-arabinose of 1mol/L is added in 1:10, makes its final concentration of 100mmol/L 30 DEG C induction 90min (OD600≈ 0.6), give full expression to 3 on pKD46 albumen.15-30min is pre-chilled on ice.
(5) thalline were collected by centrifugation for the refrigerated centrifuge of preparatory 4 DEG C of coolings, and 5000rpm is centrifuged 5min, to the greatest extent supernatant.
(6) it is washed thallus 2 times, is had to when being blown and beaten with rifle softly with the pre- cold sterilization ultrapure water of the ice of 50mL, and the moment keeps On ice, 6000rpm is centrifuged 5min, to outwell supernatant after centrifugation immediately, cause damages in order to avoid thallus suspends again.
(7) thallus is lightly dissolved with the pre- cold sterilization ultrapure water of the ice of 200 μ L, be placed on ice, it is spare.
(8) conversion PCR product is into the competence containing pKD46 and infection clones pBAC-DPV plasmid, in λ-Red weight Under group enzyme mediates, by homologous recombination, replacement of the kalamycin resistance gene to gc gene is realized.Operating procedure is as follows:
(9) the 200 μ l that preparation is added in about 200ng PCR product segment gC left arm-FRT-kana-FRT-gC right arm are experienced State mixes, and is transferred in 0.2cm electric shock cup, and electric shock instrument makees electrotransformation, and shock by electricity condition: 200 Ω, 25 μ F, shock voltage 2.3kV.
(10) bacterium, 150r/min, 37 DEG C of cultures, recovery 2h is resuspended in the LB that 1mL is rapidly added after shocking by electricity.
(11) it takes 200 μ L bacterium solutions to be coated on a chlorine enzyme and ammonia benzyl resistance LB plate, is coated on after remaining centrifugation another A chlorine enzyme and ammonia benzyl LB plate, 37 DEG C of culture carton upside down culture 16h-24h.PCR identification gained single colonie, obtains positive bacterium colony DPV CHv-BAC-G △ gC-kana, using the single colonie re-suspension liquid grown in the step as template, using identification primer gC-F and GC-R carries out PCR identification, obtains positive clone molecule CHv-BAC-G △ gC-kana
△ gC-F:5 ,-ATGGATTGCACATAAAAGTGTCGT-3；(SEQ ID NO:3)
△ gC-R:5 ,-ATTGCTGTCCTATCAGTCCGTA-3；(SEQ ID NO:4)
PCR amplification system are as follows: ddH26 μ L of O, 2 × Taq PCR MasterMix, 10 μ L, DPV CHv- △ gc identification are drawn 1 μ L of object F, CHv- △ gc identify that 1 μ L of primer R, template are 2 μ L of single colonie re-suspension liquid；
PCR amplification condition are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 4min, 55 DEG C of annealing 30s, 72 DEG C of extension 2min, altogether 30 circulations, last 72 DEG C of extensions 10min are saved in 16 DEG C.
3, remove kana resistance gene fragment
(1) pCP20 Plasmid DNA is extracted according to plasmid extraction kit, with the ratio of 1:50 by CHv-BAC-G △ gC- Kana is seeded to 100mL containing in Ka Na and chlorine enzyme antibiotic LB liquid medium, acutely cultivates 2~3h to OD in 37 DEG C600For 0.4 or so；Then CHv-BAC-G △ gC-kana is recombinated into bacterium solution ice bath 30min or more rapidly.
(2) it takes 1~2 Μ L of pCP20 plasmid to be added in 100 above-mentioned DPV CHv-BAC-G △ gC-kana competence, gently mixes It is even, 30min is placed on ice；After 42 DEG C of heating 90S, then 1~2min is placed on ice；Be added 500 μ L LB, in 30 DEG C of water-baths with 1~2h of 150r/min shake culture；It takes on 200 Μ L culture LB plates, 30 DEG C of culture 18h；Picking colony carries out bacterium solution PCR Identification, at the same by positive bacterium solution scribing line 42 DEG C of chlorine enzyme LB plate induce overnight FLP recombinate expression of enzymes, choose single bacterium fall on card that resist Do not grown on mild-natured plate, then block that resistant gene oneself through being deleted by FLP recombinase, utilize primer SEQ ID NO:3 and SEQ IDNO:4 carries out PCR amplification, identifies positive bacterium colony, is named as DPV CHv-BAC-G △ gC；
PCR amplification system are as follows: ddH26 μ L of O, 2 × Taq PCR MasterMix, 10 μ L, DPV CHv- △ gC identification are drawn 1 μ L of object F, CHv- △ gC identify that 1 μ L of primer R, template are 2 μ L of single colonie re-suspension liquid；
PCR amplification condition are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 4min, 55 DEG C of annealing 30s, 72 DEG C of extension 2min, altogether 30 circulations, last 72 DEG C of extensions 10min are saved in 16 DEG C.
4, it will identify that correct DPV CHv-BAC-G △ gC clone expands culture and cultivated into 200ml chlorine enzyme resistance LB Night extracts recombinant plasmid.
5, by the recombinant plasmid of extraction, electrotransformation obtains GS1783-DPVCHv-BAC-G △ gC into GS1783 bacterial strain.
6, I_SceI-Kana-MiniF segment is expanded
(1) Escherichia coli with pEPKan-S plasmid are placed in LB solid medium containing kanamycin and are recovered, 37 DEG C of overnight incubations；Picking single colonie is inoculated in LB liquid medium containing kanamycin, 37 DEG C of overnight incubations, and plasmid is small Extraction reagent kit extracts pEPKan-S plasmid (pEPKan-S plasmid map is shown in Fig. 1)；
(2) using pEPKan-S plasmid as template, and design primer GS1783-MiniF-F and GS1783-MiniF-R, include The base fragment of I_SceI restriction enzyme site and Kana element, and at MiniF element ori2 downstream of gene 240bp and be located at Homology arm segment I_SceI-Kana-MiniF at MiniF element ori2 downstream of gene 290bp, plain agar sugar gel DNA are returned Kit (being purchased from TIANGEN company) recycling amplified fragments are received, I_SceI-Kana-MiniF segment is obtained；Primer particular sequence It is as follows:
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTC ATGATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3’(SEQ ID NO:5)
GS1783-MiniF-R:5’-ATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTAT tagggataacagggtaatcgat-3’(SEQ ID NO:6)
PCR amplification system is ddH2O 22μL、Max DNA Polymerase is (public purchased from Takara Department) 25 μ L, 1 GS1783-MiniF-F μ L, 1 GS1783-MiniF-R μ L, 1 μ L of template pEPKan-S plasmid；
PCR amplification condition is 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 Circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
8, UL23-MiniF segment is expanded
(1) it prepares duck embryo fibroblasts (DEF) and is inoculated in 25T cell bottle, 37 DEG C, 5%CO2After culture for 24 hours, inoculation 5MOI DPV CHv, 37 DEG C, 5%CO2Harvest is viral after cultivating 48h, after multigelation 2 times, according to TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 (being purchased from TaKaRa company) specification extracts DPV CHv genome；
(2) using DPV CHv genome as template, design primer CHv-UL23-F and CHv-UL23-R pass through PCR amplification packet Gene containing UL23, the downstream I_SceI-Kana-MiniF homology arm are overlapped 25bp and are located at MiniF element ori2 downstream of gene Homology arm segment at 180bp, plain agar sugar gel DNA QIAquick Gel Extraction Kit recycle amplified fragments, obtain UL23-MiniF piece Section；Particular sequence is as follows:
CHv-UL23-F:5’-GCCTGCAAGCGGTAACGAAAACGATtcaattaattgtcatctcgg-3’(SEQ ID NO:7)
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCAT ATTCAACGGACATATTAAAAATTGA-3’(SEQ ID NO:8)
PCR amplification system are as follows: ddH2O 22μL、Max DNA Polymerase 25μL、CHv- 1 μ L of UL23-F, 1 CHv-UL23-R μ L, 1 μ L of template DPV CHv genome；
PCR amplification condition is 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 Circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
9, it merges I_SceI-Kana-MiniF segment and UL23-MiniF segment obtains I_SceI-Kana-MiniF-UL23 Target practice segment
(1) using I_SceI-Kana-MiniF segment and UL23-MiniF segment as template, PCR fusion is carried out, then to melt Segment after conjunction is template, and SEQ ID NO:6 and SEQ ID NO:8 is primer, and PCR amplification obtains I_SceI-Kana-MiniF- UL23 segment；
PCR fusion system are as follows: ddH2O 8μL、10 μ L of Max DNA Polymerase, template I_ SceI-Kana-MiniF segment and each 1 μ L of UL23-MiniF segment；
PCR fusion conditions are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 55 DEG C of annealing 5s, 72 DEG C of extension 1min, totally 5 A circulation；
PCR amplification system are as follows: fusion 20 μ L of template, 0.5 μ L of upstream primer GS1783-MiniF-F, downstream primer CHv- UL23-R 0.5μL；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min.
Red-Based modification technique and intracellular spontaneous homologous recombination technique is recycled to lack MiniF element Operational flowchart (see Fig. 2), detailed process include step 10~12.
10, preparation GS1783-DPV CHv-BAC-G △ gC electricity turns competence and carries out target practice segment target practice
(1) GS1783-DPV CHv-BAC-G △ gC bacterium is frozen to be placed in the LB solid medium containing chloramphenicol again Soviet Union, 30 DEG C of overnight incubations；
(2) picking GS1783-DPV CHv-BAC-G △ gC single colonie is inoculated in LB liquid medium of the 5mL containing chloramphenicol In, 30 DEG C of overnight incubations obtain seed liquor；
(3) 5mL seed liquor is added in LB liquid medium of the 100mL containing chloramphenicol, is shaken in 30 DEG C to OD600Value is 0.5 Between~0.7；
(4) bacterium solution obtained by step (3) is immediately placed in mixture of ice and water cooling 20min after 42 DEG C of culture 15min；
(5) bacterium solution obtained by 50mL step (4) is taken, 10min is centrifuged in 4 DEG C of 4500 × g, removes supernatant；
(6) with pre-cooling ultrapure water bacterial sediment obtained by cleaning step (5) repeatedly on ice；
(7) ultrapure water is added, bacterium solution obtained by step (6) is settled to 500 μ L, every 100 μ L of pipe is dispensed to pre-cooling EP pipe, obtained It obtains GS1783-DPV CHv-BAC-G △ gC electricity and turns competence；
(8) turn that 200ng I SceI-Kana-MiniF-UL23 target practice segment is added in competence in 100 μ L electricity, after mixing Competence and target practice segment are added to the electric shock bottom of a cup portion of 2mm pre-cooling together, shocked by electricity under the conditions of 15kV/cm；
(9) 100 μ L LB liquid mediums are added and thallus after electric shock is resuspended, after 30 DEG C are shaken bacterium 1h, 4500 × g is centrifuged thallus 2min abandons supernatant, and 200 μ L LB liquid mediums, which suspend, to be precipitated, and is coated with containing kanamycin and chloramphenicol twin antibiotic resistance LB solid medium, in 30 DEG C of culture 48h；
(10) single colonie obtained by PCR authentication step (9) obtains positive bacterium colony GS1783-DPVCHv-BAC-G △ gC- UL23-Kana is reflected using the single colonie re-suspension liquid grown in step (9) as template using identification primer MiniF-F and MiniF-R Fixed positive bacterium colony；
MiniF-F:5'-GTTATCCACTGAGAAGCGAACG-3'；(SEQ ID NO:9)
MiniF-R:5'-GGCTGTAAAAGGACAGACCACA-3'；(SEQ ID NO:10)
PCR amplification system are as follows: ddH2O 22μL、Max DNA Polymerase 25μL、MiniF-F 1 μ L, 1 MiniF-R μ L, template are 1 μ L of step (9) single colonie re-suspension liquid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 15s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
11, remove I_SceI-Kana segment
(1) picking GS1783-DPV CHv-BAC-G △ gC-UL23-Kana single colonie is inoculated in LB of the 2mL containing chloramphenicol In fluid nutrient medium, 30 DEG C of overnight incubations obtain seed liquor；
(2) seed liquor obtained by 10 μ L steps (1) is taken to be inoculated in LB liquid medium of the 2mL containing chloramphenicol, 30 DEG C of cultures Slight cloud is presented to bacterium solution in 2h；
(3) LB liquid medium and 5M final concentration of 2% of the 1mL containing chloramphenicol is added into bacterium solution obtained by step (2) 30 DEG C of L-arabinose, cultivate 1h；
(4) bacterium solution obtained by step (3) is immediately placed in 42 DEG C of water-baths and cultivates 30min；
(5) after bacterium solution obtained by step (4) being placed in 30 DEG C of culture 2h, take 1 μ l bacterium solution that 200 μ l LB liquid mediums are added The LB solid medium containing chloramphenicol, 30 DEG C of culture for 24 hours~48h are applied to after middle mixing；
(6) gained single colonie is containing chloramphenicol and the Double LB solid medium of Ka Na mycin and chlorine in picking step (5) Parllel screening is carried out on mycin monoclonal antibody LB solid medium, chloramphenicol and the Double LB solid medium of Ka Na mycin are not given birth to Long, the bacterium colony of chloramphenicol monoclonal antibody LB solid culture basal growth utilizes primer SEQ ID NO:9 and SEQ ID by PCR method NO:10 carries out PCR amplification identification, obtains positive clone molecule GS1783-DPV CHv-BAC-G △ gC-UL23.
PCR amplification system are as follows: ddH2O 22μL、25 μ L of Max DNA Polymerase, upstream are drawn 1 μ L of object MiniF-F, 1 μ L of downstream primer MiniF-R, template are 1 μ L of step (6) single colonie re-suspension liquid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
12, rescue DPV CHv- Δ gC virus
(1) GS1783-DPV CHv-BAC-G △ gC-UL23 is frozen into bacterium and is placed in the LB solid medium containing chloramphenicol Middle recovery, 30 DEG C of overnight incubations；
(2) DPV CHv- is extracted according to QIAGEN Plasmid Midi Kit (being purchased from QIAGEN company) operating instruction BAC-G △ gC-UL23 plasmid；
(3) it prepares duck embryo fibroblasts (DEF) and is inoculated in 12 orifice plates, 37 DEG C, after 5%CO2 culture for 24 hours, according to Lipofectamine 3000 (being purchased from Invitrogen company) operating instruction transfects DPVCHv-BAC-G △ gC-UL23 plasmid, Fluorescent spot is observed after 96h, is collected virus, is inoculated in the 6 orifice plates for covering with DEF after multigelation 2 times；
(4) step (3) are repeated three times；
(5) after viral multigelation 2 times that step (4) obtains, 10 times of doubling dilutions are inoculated in the 6 orifice plates for covering with DEF In, 37 DEG C, 5%CO2After being incubated for 2h, abandoning Incubating Solution, the fixed cell of 1% methylcellulose of addition, 37 DEG C, 5%CO2Cultivate 120h Afterwards, picking picking unstressed configuration sick cell is reinoculated in DEF after multigelation 2 times, obtains DPV CHv- Δ gC-Q；
(6) it is extracted according to TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 specification DPV CHv- Δ gC viral genome carries out PCR amplification, identification missing using primer SEQ ID NO:9 and SEQ ID NO:10 MiniF element, final obtain remain the gC positive-virus strain of deleted virus strain DPVCHv- Δ without MiniF element, see Fig. 3.
PCR amplification system are as follows: ddH2O 22μL、25 μ L of Max DNA Polymerase, upstream are drawn 1 μ L of object MiniF-F, 1 μ L of downstream primer MiniF-R, template are the DPVCHv- Δ gC-Q viral genome 1 that step (6) are extracted μL；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
Embodiment 2 goes the measurement of MiniF element DPV CHV- △ gC gene-deleted strain growth curve
1, the measurement of one step growth curve
By parental virus DPV CHv and go MiniF element DPV CHV- △ gC gene-deleted strain thin with 2MOI inoculation DEF respectively Born of the same parents meet 6h, 12h, 18h, for 24 hours collection supernatant cell after poison, and each time point is done to be repeated three times.After collecting completely, repeatedly Freeze thawing 2 times, virus titer is detected in 96 orifice plates, the results showed that the lack part of gC gene influences the duplication of DPV CHv virus.
2, the measurement of multistep growth curve
By parental virus DPV CHv and MiniF element DPV CHV- △ gC gene-deleted strain is gone to be inoculated with DEF respectively with 0.01MOI Cell, connect 12h after poison, for 24 hours, 48h, 72h collect supernatant cell, each time point is done to be repeated three times.After collecting completely, instead Multiple freeze thawing 2 times, virus titer is detected in 96 orifice plates, the results showed that the missing of gC gene significantly affects the proliferation of DPV CHv virus Situation.
Embodiment 3 removes MiniF element DPV CHV- △ gC gene-deleted strain and DPV CHv plants of plaque assays
MiniF element DPV CHV- △ gC gene-deleted strain will be gone to be inoculated in DEF cell with DPV CHv plants, 72h divides after receiving poison Its TCID is not surveyed50, wherein DPV CHV- △ gC gene-deleted strain TCID50For 10-3.75, CHv plants of TCID of DPV50It is 10-6.75, then divide It will not remove MiniF element DPV CHV- △ gC gene-deleted strain and 10 times of doubling dilutions of DPV CHv plants of progress, 10-2-10-7It is inoculated in and contains Creep plate covers in six orifice plates of DEF cell, Yu Han 5%CO237 DEG C of incubators in middle culture 2h, during which every 15min carry out It all around rocks, virus is made to be uniformly dispersed.
Virus liquid is abandoned, is washed cell 2 times with PBS, 1% methylcellulose of 4mL, Yu Han 5%CO is added in each cell hole2 37 DEG C of incubators in middle culture 30h, microscopically observation cell, go MiniF element DPV CHV- △ gC gene-deleted strain choose 10-3 Dilution holes, DPV CHv, which selects good strains in the field for seed, takes 10-5Dilution holes carry out follow-up test, and methylcellulose is sucked out, is added after washing 2 times with PBS 4% paraformaldehyde of 1mL pre-cooling, 4 DEG C of fixed 30min, addition 1mL 30%H after sucking liquid2O2, soaking at room temperature 30Min, suction Liquid out distills water washing 2 times.
According to doctor moral instant SABC immunohistochemical staining kit (rabbit igg) operating procedure, 5%BSA closing is added dropwise Liquid is incubated at room temperature 30min, sucking liquid；The diluted DPV rabbit-anti of 1:100 is added, addition volume is the hole 1mL/, 37 DEG C of incubation 3h； Sucking liquid, PBS are washed 3 times, and biotinylated goat anti-rabbit IgG, 37 DEG C of incubations 30min, PBS washing 3 times, 5min/ times is added dropwise； SBAC reagent, 37 DEG C of incubations 30min, PBS washing 3 times, 5min/ times is added dropwise；PBS is sucked out, according to doctor's moral DAB colour reagent box Operating procedure, every hole are added dropwise the DAB mixed liquor of 800 μ L, are protected from light 30min, be in microscopically observation background dye it is faint yellow, Developing solution is abandoned, is washed with distilled water 3 times, each 5min, the creep plate taking-up in cell hole is placed on glass slide, is seen under microscope Examine and will both plaque size (see Fig. 5, Fig. 6, wherein Fig. 6 a is that the plaque of DPV CHV- △ gC gene-deleted strain detects figure；Fig. 6 b Figure is detected for CHv plants of DPV of plaques)；As shown in the testing result of Fig. 5 and Fig. 6, MiniF element DPV CHV- △ gC is gone to lack CHv plants compared with DPV of plaque of plaque small 18.65% of strain.
The present invention also goes MiniF element gC gene-deleted strain DPV CHv- Δ gC to do genetic stability reality duck plague virus It tests, pathogenic experiment and immunogenicity experiments.
Genetic stability: duck plague virus goes MiniF element gC gene-deleted strain DPV CHv- Δ gC to pass on DEF cell In 20 generations, there is plaque, shows that duck plague virus obtained goes MiniF element gC gene-deleted strain DPV CHv- Δ gC in DEF Middle stable heredity.
It is pathogenic: 15 4 week old DPV negative antibodies and PCR being detected into negative duck and are randomly divided into 3 groups, every group 5.1st group Intramuscular injection DPV CHv- Δ gC, the 2nd group of intramuscular injection parental virus DPV CHv, the malicious valence phase of every injecting virus in two groups Together, the 3rd group of isodose MEM of injection, as a control group, every group of independent isolated rearing, observation, the dead feelings of record morbidity daily Condition.As can be seen from the results, injection has the duck of parental virus all dead, and injects the duck having in DPV CHv- Δ gC and control group Without death, illustrate the pathogenic reduction of DPVCHv- Δ gC.
Immunogenicity: 10 4 week old DPV negative antibodies and PCR are detected into negative duck and are randomly divided into 2 groups, every group 5.1st Group intramuscular injection DPV CHv- Δ gC, the 2nd group of isodose MEM of injection, as a control group, every group of independent isolated rearing.Exempting from Blood sampling in 14 days separates serum after epidemic disease, carries out indirect ELISA detection as envelope antigen using the DPV of purifying, as a result can be detected Antibody during injection DPV CHv- Δ gC duck blood is clear illustrates that DPV CHv- Δ gC has good immunogenicity.
Sequence table
<120>a kind of duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC and its construction method
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 76
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gccggtgtat ccttcgtaca tcatcaagtt gtaacaatac ttaacgattc tatatcgtgt 60
aggctggagc tgcttc 76
<210> 2
<211> 76
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
taaaacgtcg tttatttatc aaaagcttta ttaaacattt tatattaaac cagtatcata 60
tgaatatcct aattag 76
<210> 3
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
atggattgca cataaaagtg tcgt 24
<210> 4
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
attgctgtcc tatcagtccg ta 22
<210> 5
<211> 98
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ttattaatct caggagcctg tgtagcgttt ataggaagta gtgttctgtc atgatgcctg 60
caagcggtaa cgaaaacgat tgttacaacc aattaacc 98
<210> 6
<211> 72
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
atcgttttcg ttaccgcttg caggcatcat gacagaacac tacttcctat tagggataac 60
agggtaatcg at 72
<210> 7
<211> 45
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
gcctgcaagc ggtaacgaaa acgattcaat taattgtcat ctcgg 45
<210> 8
<211> 79
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
ccgctccact tcaacgtaac accgcacgaa gatttctatt gttcctgaag gcatattcaa 60
cggacatatt aaaaattga 79
<210> 9
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
gttatccact gagaagcgaa cg 22
<210> 10
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
ggctgtaaaa ggacagacca ca 22

Claims (10)

1. the construction method that a kind of duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC, which is characterized in that packet Include following steps:
It (1) is amplification template with pKD4 plasmid, building △ gC expands kana upstream primer and building △ gC expands kana downstream primer, leads to Kana resistance gene fragment of the PCR method amplification comprising two sides with gC DNA homolog arm and FRT sequence is crossed, gel extraction obtains Obtain DPV gC left arm-FRT-kana-FRT-gC right arm segment；
(2) induction is expressed containing pKD46 and DPV CHv-BAC-G clone bacterium DH10B RED recombination system；And it prepares and contains The DH10B positive colony bacterium competence of pKD46 and DPV CHv-BAC-G；Electrotransformation gel extraction DPV gC left arm-FRT- Kana-FRT-gC right arm target practice segment enters in the competence containing pKD46 and infective cloned plasmids；Screening positive clone Son utilizes gC identified for genes primer gC-R；GC-F carries out PCR identification, obtains positive clone molecule DPV CHv-BAC-G △ gC- kana；
(3) the kana resistant gene in positive clone molecule DPV CHv-BAC-G △ gC-kana is removed, is drawn using gC identified for genes Object gC-R；GC-F carries out PCR identification, obtains positive clone molecule DPV CHv-BAC-G △ gC；
(4) recombination DPV CHv-BAC-G △ gC plasmid is extracted, its electrotransformation is entered in GS1783 competence, obtains positive gram Longzi GS1783-DPV CHv-BAC-G △ gC, and prepare GS1783-DPV CHv-BAC-G △ gC competence；
(5) using pEPKan-S as template, GS1783-MiniF-F and GS1783-MiniF-R are primer, are expanded by PCR method Base fragment comprising I_SceI restriction enzyme site and Kana element at MiniF element ori2 downstream of gene 240bp and is located at Homology arm segment I_SceI-Kana-MiniF at MiniF element ori2 downstream of gene 290bp, gel extraction obtain I_SceI- Kana-MiniF segment；
(6) using CHv genome as template, it includes UL23 by PCR method amplification that CHv-UL23-F and CHv-UL23-R, which are primer, Gene, the downstream I_SceI-Kana-MiniF homology arm are overlapped 25bp and at MiniF element ori2 downstream of gene 180bp Homology arm segment, gel extraction obtain UL23-MiniF segment；
(7) using I_SceI-Kana-MiniF segment and UL23-MiniF segment as template, PCR fusion reaction is carried out, then to melt Conjunction segment is template, and PCR amplification is carried out using GS1783-MiniF-F and CHv-UL23-R as primer and obtains I_SceI-Kana- MiniF-UL23 target practice segment；
(8) I_SceI-Kana-MiniF-UL23 target practice segment is transformed into GS1783-DPV CHv-BAC-G △ gC competence In, it is identified through antibiotic-screening and PCR, obtains positive clone molecule GS1783-DPV CHv-BAC-G △ gC-UL23-Kana；
(9) the I_SceI-Kana segment in positive clone molecule GS1783-DPV CHv-BAC-G △ gC-UL23-Kana is removed, Obtain positive clone molecule GS1783-DPV CHv-BAC-G △ gC-UL23；
(10) DPV CHv-BAC-G △ gC-UL23 is extracted from positive clone molecule GS1783-DPV CHv-BAC-G △ gC-UL23 Plasmid obtains removal MiniF element by colony screening with DPV CHv-BAC-G △ gC-UL23 plasmid transfection DEF cell DPV CHv-△gC。
2. the building side that duck plague virus described according to claim 1 removes MiniF element gC gene-deleted strain DPV CHv- Δ gC Method, which is characterized in that PCR amplification system described in step (1) are as follows: ddH2O 14μL、Max DNA 20 μ L of Polymerase, 2 μ L of upstream primer, 2 μ L of downstream primer, 2 μ L of template；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 1min, 94 DEG C of denaturation 15s, 55 DEG C of annealing 15s, 72 DEG C of extension 1min, totally 30 Circulation, last 72 DEG C of extensions 10min.
3. the building side that duck plague virus described according to claim 1 removes MiniF element gC gene-deleted strain DPV CHv- Δ gC Method, which is characterized in that primer sequence described in step (1) are as follows:
△ gC expands kana segment upstream primer:
5’-GCCGGTGTATCCTTCGTACATCATCAAGTTGTAACAATACTTAACGATTCTATATCGTGTAGGCTGGAG CTGCTTC-3'；
△ gC expands kana segment downstream primer:
5’-TAAAACGTCGTTTATTTATCAAAAGCTTTATTAAACATTTTATATTAAACCAGTATCATATGAATATCC TAATTAG-3’。
4. the building side that duck plague virus described according to claim 1 removes MiniF element gC gene-deleted strain DPV CHv- Δ gC Method, which is characterized in that PCR amplification system described in step (2) and (3) are as follows: ddH2O 6μL、2×Taq PCR MasterMin10 μ L, 1 μ L of upstream primer, 1 μ L of downstream primer, 2 μ L of template；
PCR amplification condition are as follows: 95 DEG C of initial denaturation 5min, 94 DEG C of denaturation 4min, 55 DEG C of annealing 30s, 72 DEG C of extension 2min, totally 30 Circulation, last 72 DEG C of extensions 10min.
5. the building side that duck plague virus described according to claim 1 removes MiniF element gC gene-deleted strain DPV CHv- Δ gC Method, which is characterized in that primer sequence described in step (2) and (3) are as follows:
△ gC identifies upstream primer: 5 '-ATGGTAAGCACATAAAAGTGTCGT-3 '；
△ gC identifies downstream primer: 5 '-ATTGCTATCCTATCAGTCCGTA-3 '.
6. the building side that duck plague virus described according to claim 1 removes MiniF element gC gene-deleted strain DPV CHv- Δ gC Method, which is characterized in that primer sequence described in step (5) are as follows:
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGA TGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3'；
GS1783-MiniF-R:5’-ATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTATtagg gataacagggtaatcgat-3’。
7. the building side that duck plague virus described according to claim 1 removes MiniF element gC gene-deleted strain DPV CHv- Δ gC Method, which is characterized in that primer sequence described in step (6) are as follows:
CHv-UL23-F:5'-GCCTGCAAGCGGTAACGAAAACGATtcaattaattgtcatctcgg-3'；
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCATATTC AACGGACATATTAAAAATTGA-3’。
8. the building side that duck plague virus described according to claim 1 removes MiniF element gC gene-deleted strain DPV CHv- Δ gC Method, which is characterized in that PCR fusion system described in step (7) are as follows: ddH2O8μL、Max DNA 10 μ L of Polymerase, template I_SceI-Kana-MiniF segment and each 1 μ L of UL23-MiniF segment；
PCR fusion conditions are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 55 DEG C of annealing 5s, 72 DEG C of extension 1min, totally 5 are followed Ring.
9. the building side that duck plague virus described according to claim 1 removes MiniF element gC gene-deleted strain DPV CHv- Δ gC Method, which is characterized in that PCR amplification system described in step (7) are as follows: fusion 20 μ L of template, upstream primer GS1783-MiniF-F 0.5 μ L, 0.5 μ L of downstream primer CHv-UL23-R；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 are followed Ring, last 72 DEG C of extensions 10min.
10. the duck plague virus of any one of claim 1~9 the method building removes MiniF element gC gene-deleted strain DPV CHv-ΔgC。
CN201811599539.8A 2018-12-26 2018-12-26 A kind of duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC and its construction method Pending CN109576295A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201811599539.8A CN109576295A (en) 2018-12-26 2018-12-26 A kind of duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC and its construction method
PCT/CN2019/122997 WO2020134924A1 (en) 2018-12-26 2019-12-04 Duck plague virus gc gene-deletion strain dpv chv-δgc with minif element removed and construction method therefor

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811599539.8A CN109576295A (en) 2018-12-26 2018-12-26 A kind of duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC and its construction method

Publications (1)

Publication Number Publication Date
CN109576295A true CN109576295A (en) 2019-04-05

Family

ID=65932716

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811599539.8A Pending CN109576295A (en) 2018-12-26 2018-12-26 A kind of duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC and its construction method

Country Status (2)

Country Link
CN (1) CN109576295A (en)
WO (1) WO2020134924A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020134924A1 (en) * 2018-12-26 2020-07-02 四川农业大学 Duck plague virus gc gene-deletion strain dpv chv-δgc with minif element removed and construction method therefor
CN113249340A (en) * 2020-08-19 2021-08-13 浙江省农业科学院 Double-color fluorescent protein labeled duck plague virus and construction method and application thereof
CN114807223A (en) * 2022-03-17 2022-07-29 新疆方牧生物科技有限公司 Construction method of porcine epidemic diarrhea virus infectious clone

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105802922A (en) * 2016-04-19 2016-07-27 四川农业大学 Establishing method of bacterial artificial chromosome recombinant duck plague virus rescue system platform and application

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102732545B (en) * 2012-05-08 2014-09-24 四川农业大学 Duck plague virus transfer vector pUC-deltagC-EGFP, and gC-deleted recombinant strain DPV-deltagC-EGFP
CN109576295A (en) * 2018-12-26 2019-04-05 四川农业大学 A kind of duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC and its construction method

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105802922A (en) * 2016-04-19 2016-07-27 四川农业大学 Establishing method of bacterial artificial chromosome recombinant duck plague virus rescue system platform and application

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ISHIHARA YUKARI等: "Removal of Inserted BAC after linearizatiON (RIBON)-a novel strategy to excise the mini-F sequences from viral BAC vectors", 《THE JOURNAL OF VETERINARY MEDICAL SCIENCE》 *
TISCHER BK等: "A self-excisable infectious bacterial artificial chromosome clone of varicella-zoster virus allows analysis of the essential tegument protein encoded by ORF9", 《JOURNAL OF VIROLOGY》 *
TISCHER BK等: "Viral bacterial artificial chromosomes: generation, mutagenesis, and removal of mini-F sequences", 《JOURNAL OF BIOMEDICINE & BIOTECHNOLOGY》 *
景艳春: "鸭瘟病毒gC基因介导的宿主细胞吸附特性及gC-/TK-双基因缺失株构建", 《中国优秀博硕士学位论文全文数据库(硕士)农业科技辑》 *
马云潮等: "重组鸭肠炎病毒载体疫苗研究进展", 《畜牧兽医学报》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020134924A1 (en) * 2018-12-26 2020-07-02 四川农业大学 Duck plague virus gc gene-deletion strain dpv chv-δgc with minif element removed and construction method therefor
CN113249340A (en) * 2020-08-19 2021-08-13 浙江省农业科学院 Double-color fluorescent protein labeled duck plague virus and construction method and application thereof
CN114807223A (en) * 2022-03-17 2022-07-29 新疆方牧生物科技有限公司 Construction method of porcine epidemic diarrhea virus infectious clone
CN114807223B (en) * 2022-03-17 2024-05-31 新疆方牧生物科技有限公司 Construction method of porcine epidemic diarrhea virus infectious clone

Also Published As

Publication number Publication date
WO2020134924A1 (en) 2020-07-02

Similar Documents

Publication Publication Date Title
AU611652B2 (en) Process for the genetic modification of monocotyledonous plants
CN106868008A (en) CRISPR/Cas9 targeting knock outs people Lin28A genes and its specificity gRNA
CN109576295A (en) A kind of duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC and its construction method
CN109536463A (en) The dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI and its construction method
CN107345222A (en) Express recombinant pseudorabies virus and its construction method and the application of Porcine epidemic diarrhea virus S1 albumen
CN109705223B (en) Recombinant subunit vaccine of orf virus and production method thereof
CN111575315A (en) Rabbit viral hemorrhagic disease virus type II VLP vaccine
CN106399267A (en) Recombinant turkey herpesvirus virus strain rHOH expressing H7N9 subtype avian influenza virus haemagglutinin protein and construction method
CN109593730A (en) The seamless gene-deleted strain DPV CHv- Δ Lorf5 of duck plague virus Lorf5 gene and its construction method
CN106243199B (en) There is the Vip3Aa11 protein mutant of high activity to beet armyworm
CN110128545A (en) A kind of fusion, recombinant expression carrier, antigen and its preparation method and application
CN108324937A (en) The herpes turkey virus live vector vaccine of 4 type penton protein of expression aviadenovirus serum and its preparation and application
CN113336858B (en) Rabbit hemorrhagic disease virus VP60 recombinant antigen with single site chimeric Pasteurella PlpE epitope, preparation and application thereof
CN112891528B (en) Vaccine strain for infectious bronchitis
CN109628417A (en) The dual-gene seamless gene-deleted strain CHv-BAC-G- Δ gE+ Δ gI of duck plague virus gE and gI and its construction method
CN111925449B (en) Recombinant CHO cell strain expressing chicken VP2 and chicken GAL-1 fusion protein and construction method and application thereof
CN109593732A (en) The seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene and its construction method
CN109609548A (en) The seamless gene-deleted strain DPV CHv- Δ gI of duck plague virus gI gene and its construction method
CN109486772A (en) The seamless gene-deleted strain DPV CHv-gE Δ ET in the region duck plague virus gE gene ET and its construction method
CN109825531B (en) Method for removing pXO2 plasmid in Bacillus anthracis
CN109486774A (en) The seamless gene-deleted strain DPV CHv-gE Δ CT in the region duck plague virus gE gene C T and its construction method
CN109609550A (en) A kind of seamless gene-deleted strain DPV CHv- Δ UL41 of duck plague virus UL41 gene and its construction method
AU2020101881A4 (en) DPV CHv-ΔgI of gI gene-free strain of duck plague virus and its construction method
CN109609549A (en) A kind of seamless gene-deleted strain CHv-BAC-G- Δ UL41 of duck plague virus UL41 gene and its construction method
CN109576294A (en) The seamless gene-deleted strain CHv-BAC-G- Δ gE of duck plague virus gE gene and its construction method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20190405