CN109593732A - The seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene and its construction method - Google Patents

The seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene and its construction method Download PDF

Info

Publication number
CN109593732A
CN109593732A CN201811599493.XA CN201811599493A CN109593732A CN 109593732 A CN109593732 A CN 109593732A CN 201811599493 A CN201811599493 A CN 201811599493A CN 109593732 A CN109593732 A CN 109593732A
Authority
CN
China
Prior art keywords
gene
dpv
minif
chv
kana
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811599493.XA
Other languages
Chinese (zh)
Other versions
CN109593732B (en
Inventor
程安春
刘田
汪铭书
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sichuan Agricultural University
Original Assignee
Sichuan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sichuan Agricultural University filed Critical Sichuan Agricultural University
Priority to CN201811599493.XA priority Critical patent/CN109593732B/en
Publication of CN109593732A publication Critical patent/CN109593732A/en
Application granted granted Critical
Publication of CN109593732B publication Critical patent/CN109593732B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16311—Mardivirus, e.g. Gallid herpesvirus 2, Marek-like viruses, turkey HV
    • C12N2710/16321—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16311—Mardivirus, e.g. Gallid herpesvirus 2, Marek-like viruses, turkey HV
    • C12N2710/16322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/20—Pseudochromosomes, minichrosomosomes
    • C12N2800/204—Pseudochromosomes, minichrosomosomes of bacterial origin, e.g. BAC
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention provides a kind of seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene and its construction methods.The present invention utilizes GS1783 coli strain and pEPkan-S plasmid, duck plague virus gE gene is lacked through homologous recombination twice in bacterial artificial chromosome recombination duck plague virus rescue system platform, MiniF element is lacked using intracellular spontaneous methods of homologous recombination, completes the building of no external source base and the seamless gene-deleted strain of the remaining duck plague virus of MiniF element for the first time.Technical solution of the present invention solves the problems, such as to remain base in deletion segment when missing duck plague virus gene and has lacked MiniF element, provides sufficient technical support accurately to probe into the building of duck plague virus gene function and attenuated live vaccine.

Description

The seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene and its construction method
Technical field
The invention belongs to gene engineering technology fields, and in particular to a kind of seamless gene-deleted strain DPV of duck plague virus gE gene CHv- Δ gE and its construction method.
Background technique
A kind of bacterial artificial chromosome (bacterial artificial chromosome, BAC) new development is got up DNA vector system, it has many advantages, such as, and capacity is big, hereditary capacity is stable, easily operated, in construction of gene library and gene function Analysis etc. is widely used.Whole viral genes group DNA molecular is inserted into BAC carrier, most using the vector encoded Small fertility factor replicon (Minimal fertility factor replicon, Mini-F) obtains molecular cloning disease Poison, and assignment of genes gene mapping modification technique mature in Escherichia coli is combined, to realize the missing of the viral gene in prokaryotic system And the insertion of foreign gene.Current more common bacillus coli gene locator qualification technology mainly includes the same of Red/ET mediation The homologous recombination technique and Tn transposons of source recombinant technique, RecA protein mediated homologous recombination technique, Cre/loxP mediation The radom insertion and mutating technology of mediation.Mature bacterial artificial chromosome duck has been obtained using molecular cloning technological means Pestivirus saves system platform, while can be thin using the homologous recombination technique that bacillus coli gene locator qualification Red/ET is mediated Bacterium artificial chromosome duck plague virus save system platform on carry out duck plague virus gene missing and foreign gene insertion, this at Fruit has greatly pushed the flow of research of duck plague virus gene function.
The homologous recombination technique that Red/ET is mediated is based on lambda phage Red operon (Red α/Red β/Red γ) and Rac The homologous recombination Knockout technology of bacteriophage RecE/RecT homologous recombination enzyme.The technical operation is simple, quick, efficient, is widely applied In gene delection, mutation work.But gene delection is carried out using the operating technology, is mutated and can be remained in missing or mutational site About 80bp or so external source base sequence (site FRT), the residual in the site will affect the accurate analysis of gene function.MiniF member Part is as the minimum fertility factor replicon for maintaining BAC carrier duplication, mainly by regulation BAC replication orgin (oriS) The sopC gene of repE, repF gene, sopA, sopB gene of regulation replicon distribution and coding centromere region is constituted. It joined resistance screening gene and fluorescent marker gene to complete bacterial resistance screening and BAC label screening, MiniF element. MiniF element is inserted into viral genome, increases genome length, generates uncertain influence to virus replication.MiniF element simultaneously It is remained in viral genome as bacterial sequences, is unfavorable for the exploitation and license of attenuated live vaccine.Therefore base residual is solved Problem simultaneously removes the seamless gene-deleted strain of MiniF element acquisition, it has also become probes into the emphasis of duck plague virus gene delection method.
Duck plague (Duck Plague, DP) be by duck plague virus in Alphaherpesviridae (Duck Plague virus, The acute contact height lethal infectious diseases of the aquatic birds such as duck caused by DPV), goose.The disease is reported by Holland first, immediately at me The more flourishing area of the duck culturing industries such as state south China, Central China and East China is popular, causes serious economic damage to the duck culturing industry in China It loses.Therefore it understands duck plague virus gene function in depth, reinforce to the research of duck plague epidemic disease to ensuring China's duck culturing industry health, can hold Supervention exhibition is particularly important.
Duck plague virus DPV-CHv pnca gene group DNA overall length 162175bp, includes 78 open reading frame, and codified participates in The structural proteins and non-structural protein of duck plague virus life cycle, wherein structural proteins mainly include capsid protein, cortex albumen And envelope protein.Envelope protein is glycosylation albumen, including gB, gC, gD, gE, gG, gH, gI, gJ, gK, gL, gM, gN 12 Kind.Glycoprotein has the function of that mediate retroviral adsorbs, is viral in spread between cells into sensitive cells and promotion, carries simultaneously Antigenic determinant can induce animal body immune system to the identification of virus and cause the pathology damage of tissue, therefore probes into capsule Effect of the membrane glycoprotein in duck plague virus life cycle is to deeply probing into duck plague virus gene function and to carry out duck plague epidemic disease anti- It is most important to control work.
It is utilized in the prior art using BAC as the technology of plateform molecules cloning virus, duck plague virus genome recombination is arrived In Baculovirus transfer vector containing BAC, building bacterial artificial chromosome recombination duck plague virus saves system platform DPV CHv- BAC-G.In combination with Red/ET modification technique, duck plague virus base is completed by mature genetic manipulation means in prokaryotic system Because of missing and foreign gene insertion.But system is saved in bacterial artificial chromosome recombination duck plague virus using Red/ET modification technique On platform to duck plague virus gene delection after, can at the missing gene site FRT at remnants two, while remaining MiniF element. There is the probing into of gene function, the exploitation of attenuated live vaccine and license and influence in the residual of FRT external source site and MiniF element.
Summary of the invention
For the above-mentioned problems in the prior art, the present invention provides a kind of seamless gene-deleted strain of duck plague virus gE gene DPV CHv- Δ gE and its construction method remain when the construction method can effectively solve missing duck plague virus gene in deletion segment Base, while the problem of remain MiniF element.
To achieve the above object, the technical solution adopted by the present invention to solve the technical problems is:
The seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene, construction method the following steps are included:
(1) pBAC-DPV plasmid is transformed into GS1783 E. coli competent, obtains GS1783-pBAC-DPV bacterium Strain, then prepares GS1783-pBAC-DPV competence；
(2) using pEPkan-S as template, using GS1783-BAC- Δ gE-F and GS1783-BAC- Δ gE-R as primer, lead to Cross the base fragment and gE upstream region of gene and each 40bp in downstream that PCR method amplification includes I_SceI restriction enzyme site and Kana element The target practice segment I_SceI-Kana-gE of homology arm, gel extraction obtain I_SceI-Kana-gE segment；
(3) I_SceI-Kana-gE segment is transformed into GS1783-pBAC-DPV competence, through antibiotic-screening and PCR identification, obtains positive clone molecule GS1783-pBAC-DPV-gE-Kana；
(4) the I_SceI-Kana segment in positive clone molecule GS1783-pBAC-DPV-gE-Kana is removed, prepares GS1783-pBAC-DPV- Δ gE competence；
(5) using pEPkan-S as template, using GS1783-MiniF-F and GS1783-MiniF-R as primer, pass through PCR Base fragment of the method amplification comprising I_SceI restriction enzyme site and Kana element is located at MiniF element ori2 downstream of gene 240bp Place and the homology arm segment I_SceI-Kana-MiniF at MiniF element ori2 downstream of gene 290bp, gel extraction obtain Obtain I_SceI-Kana-MiniF segment；
(6) it using CHv genome as template, using CHv-UL23-F and CHv-UL23-R as primer, is expanded by PCR method Comprising UL23 gene, the downstream I_SceI-Kana-MiniF homology arm overlapping 25bp and it is located at MiniF element ori2 downstream of gene Homology arm segment at 180bp, gel extraction obtain UL23-MiniF segment；
(7) using I_SceI-Kana-MiniF segment and UL23-MiniF segment as template, PCR fusion reaction is carried out, then To merge segment as template, PCR amplification is carried out using GS1783-MiniF-F and CHv-UL23-R as primer and obtains I_SceI- Kana-MiniF-UL23 target practice segment；
(8) I_SceI-Kana-MiniF-UL23 target practice segment is transformed into GS1783-pBAC-DPV- Δ gE competence In, it is identified through antibiotic-screening and PCR, obtains positive clone molecule GS1783-pBAC-DPV- Δ gE-UL23-Kana；
(9) the I_SceI-Kana segment in positive clone molecule GS1783-pBAC-DPV- Δ gE-UL23-Kana is removed, Obtain positive clone molecule GS1783-pBAC-DPV- Δ gE-UL23；
(10) pBAC-DPV- Δ gE-UL23 matter is extracted from positive clone molecule GS1783-pBAC-DPV- Δ gE-UL23 PBAC-DPV- Δ gE-UL23 plasmid transfection DEF cell is obtained the seamless gene-deleted strain DPV CHv- of gE by colony screening by grain ΔgE。
Further, step (2), step (5) and step (6) PCR amplification system are as follows: ddH2O 22μl、 25 μ l of Max DNA Polymerase, 1 μ l of upstream primer, 1 μ l of downstream primer, 1 μ l of template；PCR amplification condition are as follows: 98 DEG C pre- It is denaturalized 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 circulations, last 72 DEG C of extensions 10min.
Further, primer sequence in step (2) are as follows:
GS1783-BAC-ΔgE-F:5’-ATACTGCCGGCCAGACTACGGAACCTCAACAATTGGTACGtagggat aacagggtaatcgattt-3'；
GS1783-BAC-ΔgE-R:5’-TAACTATTTCACTAGTGAGTCATTAGTTCAACATCCATGACGTACCA ATTGTTGAGGTTCCGTAGTCTGGCCGGCAGTATgccagtgttacaaccaat-3’。
Further, primer sequence in step (5) are as follows:
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTC ATGATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3'；
GS1783-MiniF-R:5’-ATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTAT tagggataacagggtaatcgat-3’。
Further, primer sequence in step (6) are as follows:
CHv-UL23-F:5'-GCCTGCAAGCGGTAACGAAAACGATtcaattaattgtcatctcgg-3'；
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCAT ATTCAACGGACATATTAAAAATTGA-3’。
Further, primer sequence in step (7) are as follows:
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTC ATGATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3'；
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTA TTGTTCCTGAAGGCA TATTCAACGGACATATTAAAAATTGA-3’。
Further, PCR fusion system in step (7) are as follows: ddH2O 8μl、Max DNA 10 μ l of Polymerase, template I_SceI-Kana-MiniF segment and each 1 μ l of UL23-MiniF segment；PCR fusion conditions are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 55 DEG C of annealing 5s, 72 DEG C of extension 1min, totally 5 recycle.
Further, PCR amplification system in step (7) are as follows: fusion 20 μ l of template, upstream primer GS1783-MiniF-F 0.5 μ l, 0.5 μ l of downstream primer CHv-UL23-R；PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C Anneal 15s, 72 DEG C of extension 5s, totally 30 circulations, last 72 DEG C of extensions 10min.
The seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene provided by the invention and its construction method, have following The utility model has the advantages that
To obtain without external source base and the remaining duck plague virus gene-deleted strain of MiniF element, the present invention is in bacteria artificial Chromosome recombination duck plague virus is saved on the basis of system platform, using Red-based modification technique, i.e., using containing codified The GS1783 coli strain of Red operon and I_SceI enzyme gene sequence and resistance and I_SceI digestion are received containing coding card The plasmid pEPkan-S in site, first through homologous twice heavy in bacterial artificial chromosome recombination duck plague virus rescue system platform Group missing duck plague virus gE gene, then MiniF element is lacked through intracellular spontaneous methods of homologous recombination, no external source is completed for the first time The building of base and the seamless gene-deleted strain of the remaining duck plague virus of MiniF element.Technical solution of the present invention solves missing duck plague disease The problem of deletion segment remains base and MiniF element has been lacked when virus gene, accurately to probe into duck plague virus gene function And the building of attenuated live vaccine provides sufficient technical support.
Detailed description of the invention
Fig. 1 is pEPkan-S plasmid map.
Fig. 2 is to recombinate to carry out in duck plague virus rescue system platform in artificial chromosome using Red-Based modification technique The operational flowchart of gene delection.
Fig. 3 is to be lacked using Red-Based modification technique and intracellular spontaneous homologous recombination technique to MiniF element Operational flowchart.
Fig. 4 is picture after the seamless deleted virus strain virus rescue of DPV CHv- Δ gE.
Specific embodiment
The seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene, building process material therefor and reagent are as follows:
1, experimental material
(1) cell, bacterial strain, virus stain, plasmid
Primary duck embryo fibroblasts are prepared according to a conventional method by the nonimmune fertilization duck embryos of 10-11 age in days；GS1783 bacterial strain It is saved by Sichuan Agricultural University laboratory；PBAC-DPV plasmid is constructed and is saved by Sichuan Agricultural University laboratory；pEPkan-S Plasmid is saved by Sichuan Agricultural University laboratory.
2, molecular biology reagents
The small extraction reagent kit of plasmid is purchased from TIANGEN company；QIAGEN Plasmid Midi Kit is purchased from QIAGEN company； Plain agar sugar gel DNA QIAquick Gel Extraction Kit is purchased from TIANGEN company；Max DNA Polymerase purchase From Takara company；TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 is public purchased from TaKaRa Department；Lipofectamine 3000 is purchased from Invitrogen company；Instant SABC immunohistochemical staining kit (rabbit igg) purchase From doctor's moral company；DAB colour reagent box (Huang) is purchased from doctor's moral company.
3, solution used and its preparation are tested
LB liquid medium: weigh Tryptone 10g, Yeast Extract 5g, sodium chloride 10g be dissolved in 800mL go from It in sub- water, is sufficiently stirred, is settled to lL, autoclave sterilization.
LB solid medium: being added 15g agar powder in the LB liquid medium for being settled to 1L, after autoclave sterilization, 60 DEG C or so are cooled to, 1.5mL chloramphenicol (storage concentration 25mg/ml) or 1.5mL kanamycins (storage concentration 50mg/ is added ML), paved plate, after to be solidified, 4 DEG C of preservations.
MEM: being dissolved in 800mL deionized water for 9.6g MEM dry powder and 2.2g sodium bicarbonate, be sufficiently stirred, adjust pH value to 7.4, it is settled to lL, filtration sterilization, 4 DEG C of preservations.
Embodiment 1 prepares the seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene
The seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene, construction method the following steps are included:
1, preparation GS1783 electricity turns competence, electrotransformation pBAC-DPV plasmid
(1) Escherichia coli of the recovery with pBAC-DPV plasmid are in the LB solid medium containing chloramphenicol, 37 DEG C of cultures Overnight；It chooses single colonie to be inoculated in the LB liquid medium containing chloramphenicol, 37 DEG C of overnight incubations；
(2) pBAC-DPV plasmid is extracted according to QIAGEN Plasmid Midi Kit operating instruction；
(3) recovery GS1783 freezes bacterium in LB solid medium, 30 DEG C of overnight incubations；
(4) picking GS1783 single colonie is inoculated in 5mL LB liquid medium, 30 DEG C of overnight incubations, obtains seed liquor；
(5) 5mL seed liquor is added in 100mL LB liquid medium, 30 DEG C are shaken to OD600Value is between 0.5~0.7；
(6) bacterium solution obtained by step (5) is immediately placed in mixture of ice and water cooling 20min；
(7) take bacterium solution obtained by step (6), 4 DEG C, 4500 × g centrifugation 10min remove supernatant；
(8) with pre-cooling ultrapure water cleaning step (7) bacterial sediment repeatedly on ice；
(9) ultrapure water is added into thallus obtained by step (8), bacterium solution is settled to 500 μ l, every 100 μ l of pipe is dispensed to pre-cooling EP pipe obtains GS1783 electricity and turns competence；
(10) turn that 20ng pBAC-DPV plasmid is added in competence in 100 μ l GS1783 electricity, after mixing by competence and The electric shock bottom of a cup portion of 2mm pre-cooling is added in plasmid together, shocks by electricity under the conditions of 15kV/cm；
(11) take 100 μ l LB liquid mediums that thallus after electric shock is resuspended, after 30 DEG C are shaken bacterium 1h, 4500 × g is centrifuged thallus 2min abandons supernatant, is suspended and is precipitated using 200 μ l LB liquid mediums, is coated on the LB solid medium containing chloramphenicol, 30 DEG C of cultures for 24 hours, obtain GS1783-pBAC-DPV bacterial strain.
2, I_SceI-Kana-gE target practice segment is expanded
(1) Escherichia coli of the recovery with pEPkan-S plasmid are in LB solid medium containing kanamycin, and 37 DEG C Overnight incubation；It chooses single colonie to be inoculated in LB liquid medium containing kanamycin, 37 DEG C of overnight incubations are mentioned using plasmid is small Kit extracts pEPkan-S plasmid (pEPkan-S plasmid map is shown in Fig. 1)；
(2) using pEPkan-S plasmid as template, GS1783-BAC- Δ gE-F and GS1783-BAC- Δ gE-R is primer, is expanded Increase I_SceI-Kana-gE target practice segment, amplified fragments are recycled using plain agar sugar gel DNA QIAquick Gel Extraction Kit；
GS1783-BAC-ΔgE-F:5’-ATACTGCCGGCCAGACTACGGAACCTCAACAATTGGTACGtagggat Aacagggtaatcgattt-3 ' (SEQ ID NO:1)
GS1783-BAC-ΔgE-R:5’-TAACTATTTCACTAGTGAGTCATTAGTTCAACATCCATGACGTACCA ATTGTTGAGGTTCCGTAGTCTGGCCGGCAGTATgccagtgttacaaccaat-3 ' (SEQ ID NO:2)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object GS1783-BAC- Δ gE-F, 1 μ l of downstream primer GS1783-BAC- Δ gE-R, 1 μ l of template pEPkan-S plasmid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
Gene is carried out in artificial chromosome recombination duck plague virus rescue system platform using Red-Based modification technique to lack The operational flowchart of mistake, is shown in Fig. 2, and detailed process includes 3 and 4 two following processes.
3, preparation GS1783-pBAC-DPV electricity turns competence and carries out target practice segment target practice
(1) recovery GS1783-pBAC-DPV freezes bacterium in the LB solid medium containing chloramphenicol, and 30 DEG C were cultivated Night；
(2) picking GS1783-pBAC-DPV single colonie is inoculated in LB liquid medium of the 5mL containing chloramphenicol, 30 DEG C of trainings It supports overnight, obtains seed liquor；
(3) 5mL seed liquor is added in LB liquid medium of the 100mL containing chloramphenicol, is placed in 30 DEG C and shakes to OD600Value exists Between 0.5~0.7；
(4) bacterium solution obtained by step (3) is immediately placed in mixture of ice and water cooling 20min after 42 DEG C of culture 15min；
(5) bacterium solution obtained by 50mL step (4) is taken, 10min is centrifuged in 4 DEG C of 4500 × g, removes supernatant；
(6) with pre-cooling ultrapure water cleaning step (5) bacterial sediment repeatedly on ice；
(7) ultrapure water is added into thallus obtained by step (6), bacterium solution is settled to 500 μ l, every 100 μ l of pipe is dispensed to pre-cooling EP pipe obtains GS1783-pBAC-DPV electricity and turns competence；
(8) turn that 200ng I_SceI-Kana-gE target practice segment is added in competence in 100 μ l electricity, by competence after mixing The electric shock bottom of a cup portion of 2mm pre-cooling is added together with target practice segment, shocks by electricity under the conditions of 15kV/cm；
(9) it takes 100 μ l LB liquid mediums that thallus after electric shock is resuspended, after 30 DEG C are shaken bacterium 1h, is centrifuged thallus in 4500 × g 2min abandons supernatant, and 200 μ l LB liquid mediums, which suspend, to be precipitated, and is coated on containing kanamycin and chloramphenicol twin antibiotic resistance LB solid medium, in 30 DEG C of culture 48h；
(10) single colonie obtained by PCR authentication step (9) obtains positive bacterium colony GS1783-pBAC-DPV-gE-Kana, with step Suddenly the single colonie re-suspension liquid grown in (9) is template, utilizes amplification I_SceI-Kana-gE target practice segment upstream primer GS1783- BAC- Δ gE-F and identification gE downstream of gene primer gE-R identify positive bacterium colony, obtain positive clone molecule GS1783-pBAC-DPV- gE-Kana；
GS1783-BAC-ΔgE-F:5’-ATACTGCCGGCCAGACTACGGAACCTCAACAATTGGTACGtagggat Aacagggtaatcgattt-3 ' (SEQ ID NO:1)
GE-R:5 '-AGCGAGTACTTCTCTGCGTC-3 ' (SEQ ID NO:3)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object GS1783-BAC- Δ gE-F, 1 μ l of downstream primer gE-R, template are 1 μ l of step (9) single colonie re-suspension liquid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
4, remove I_SceI-Kana segment
(1) picking GS1783-pBAC-DPV-gE-Kana single colonie is inoculated in LB liquid medium of the 2mL containing chloramphenicol In, 30 DEG C of overnight incubations obtain seed liquor；
(2) seed liquor obtained by 10 μ l steps (1) is taken to be inoculated in LB liquid medium of the 2mL containing chloramphenicol, 30 DEG C of cultures Slight cloud is presented to bacterium solution in 2h；
(3) LB liquid medium and 5M final concentration of 2% of the 1mL containing chloramphenicol is added into bacterium solution obtained by step (2) L-arabinose, 30 DEG C of culture 1h；
(4) bacterium solution obtained by step (3) is immediately placed in 42 DEG C of water-baths and cultivates 30min；
(5) after bacterium solution obtained by step (4) being placed in 30 DEG C of culture 2h, take 1 μ l bacterium solution that 200 μ l LB liquid mediums are added The LB solid medium containing chloramphenicol, 30 DEG C of culture for 24 hours~48h are applied to after middle mixing；
(6) gained single colonie is containing chloramphenicol and the Double LB solid medium of Ka Na mycin and chlorine in picking step (5) Parllel screening is carried out on mycin monoclonal antibody LB solid medium, chloramphenicol and the Double LB solid medium of Ka Na mycin are not given birth to Long, the bacterium colony of chloramphenicol monoclonal antibody LB solid culture basal growth is identified by PCR method using gE identified for genes primer, obtains sun Property clone GS1783-pBAC-DPV- Δ gE.
GE-F:5 '-TCTCAAGACGCTCTGGAATC-3 ' (SEQ ID NO:4)
GE-R:5 '-AGCGAGTACTTCTCTGCGTC-3 ' (SEQ ID NO:3)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object gE-F, 1 μ l of downstream primer gE-R, template are 1 μ l of step (6) single colonie re-suspension liquid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
5, I_SceI-Kana-MiniF segment is expanded
(1) Escherichia coli of the recovery with pEPkan-S plasmid are in LB solid medium containing kanamycin, and 37 DEG C Overnight incubation；It chooses single colonie to be inoculated in LB liquid medium containing kanamycin, 37 DEG C of overnight incubations, plasmid is small to mention reagent Box extracts pEPkan-S plasmid；
(2) using pEPkan-S plasmid as template, GS1783-MiniF-F and GS1783-MiniF-R are primer, expand I_ SceI-Kana-MiniF target practice segment, plain agar sugar gel DNA QIAquick Gel Extraction Kit recycle amplified fragments；
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTC ATGATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3 ' (SEQ ID NO:5)
GS1783-MiniF-R:5’-ATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTAT Tagggataacagggtaatcgat-3 ' (SEQ ID NO:6)
PCR amplification system be 22 μ l of ddH2O,25 μ l of Max DNA Polymerase, upstream primer 1 μ l of GS1783-MiniF-F, 1 μ l of downstream primer GS1783-MiniF-R, 1 μ l of template pEPkan-S plasmid；
PCR amplification condition is 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 Circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
6, UL23-MiniF segment is expanded
(1) it prepares duck embryo fibroblasts (DEF) and is inoculated in 25T cell bottle, 37 DEG C, 5%CO2After culture for 24 hours, inoculation 5MOI DPV CHv, 37 DEG C, 5%CO2Harvest is viral after cultivating 48h, after multigelation 2 times, according to TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 specification extracts DPV CHv genome；
(2) DPV CHv genome is template, and CHv-UL23-F and CHv-UL23-R are primer, and amplification UL23-MiniF is beaten Target segment, plain agar sugar gel DNA QIAquick Gel Extraction Kit recycle amplified fragments；
CHv-UL23-F:5’-GCCTGCAAGCGGTAACGAAAACGATtcaattaattgtcatctcgg-3’(SEQ ID NO:7)
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCAT ATTCAACGGACATATTAAAAATTGA-3 ' (SEQ ID NO:8)
PCR amplification system is ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream primer 1 μ l of CHv-UL23-F, 1 μ l of downstream primer CHv-UL23-R, 1 μ l of template DPV CHv genome；
PCR amplification condition is 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 Circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
7, it merges I_SceI-Kana-MiniF segment and UL23-MiniF segment obtains I_SceI-Kana-MiniF-UL23 Target practice segment
(1) using I_SceI-Kana-MiniF segment and UL23-MiniF segment as template, I_SceI-Kana- is merged MiniF segment and UL23-MiniF segment；
Fusion system are as follows: ddH2O 8μl、10 μ l of Max DNA Polymerase, template I_SceI- Kana-MiniF segment and each 1 μ l of UL23-MiniF segment；
Fusion conditions are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 55 DEG C of annealing 5s, 72 DEG C of extension 1min, totally 5 are followed Ring.
(2) primer GS1783-MiniF-F and CHv-UL23-R are added into the resulting fusion template of step (1), expands I_ SceI-Kana-MiniF-UL23 target practice segment, plain agar sugar gel DNA QIAquick Gel Extraction Kit recycle amplified fragments；
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTC ATGATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3 ' (SEQ ID NO:5)
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCAT ATTCAACGGACATATTAAAAATTGA-3 ' (SEQ ID NO:8)
PCR amplification system are as follows: fusion 20 μ l of template, 0.5 μ l of upstream primer GS1783-MiniF-F, downstream primer CHv- UL23-R 0.5μl；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
The behaviour that MiniF element is lacked using Red-Based modification technique and intracellular spontaneous homologous recombination technique Fig. 3 is seen as flow chart, and detailed process includes following 8,9 and 10.
8, preparation GS1783-pBAC-DPV- Δ gE electricity turns competence and carries out target practice segment target practice
(1) recovery GS1783-pBAC-DPV- Δ gE freezes bacterium in the LB solid medium containing chloramphenicol, 30 DEG C of trainings It supports overnight；
(2) picking GS1783-pBAC-DPV- Δ gE single colonie is inoculated in LB liquid medium of the 5mL containing chloramphenicol, and 30 DEG C overnight incubation obtains seed liquor；
(3) 5mL seed liquor is added in LB liquid medium of the 100mL containing chloramphenicol, is shaken in 30 DEG C to OD600Value is 0.5 Between~0.7；
(4) bacterium solution obtained by step (3) is immediately placed in mixture of ice and water cooling 20min after 42 DEG C of culture 15min；
(5) bacterium solution obtained by 50mL step (4) is taken, 10min is centrifuged in 4 DEG C of 4500 × g, removes supernatant；
(6) with pre-cooling ultrapure water bacterial sediment obtained by cleaning step (5) repeatedly on ice；
(7) ultrapure water is added, bacterium solution obtained by step (6) is settled to 500 μ l, every 100 μ l of pipe is dispensed to pre-cooling EP pipe, obtained It obtains GS1783-pBAC-DPV- Δ gE electricity and turns competence；
(8) turn that 200ng I_SceI-Kana-MiniF-UL23 target practice segment is added in competence in 100 μ l electricity, after mixing Competence and target practice segment are added to the electric shock bottom of a cup portion of 2mm pre-cooling together, shocked by electricity under the conditions of 15kV/cm；
(9) 100 μ l LB liquid mediums are added and thallus after electric shock is resuspended, after 30 DEG C are shaken bacterium 1h, 4500 × g is centrifuged thallus 2min abandons supernatant, and 200 μ l LB liquid mediums, which suspend, to be precipitated, and is coated with containing kanamycin and chloramphenicol twin antibiotic resistance LB solid medium, in 30 DEG C of culture 48h；
(10) single colonie obtained by PCR authentication step (9) obtains positive bacterium colony GS1783-pBAC-DPV- Δ gE-UL23- Kana is identified positive using the single colonie re-suspension liquid grown in step (9) as template using identification primer MiniF-F and MiniF-R Bacterium colony；
MiniF-F:5 '-GTTATCCACTGAGAAGCGAACG-3 ' (SEQ ID NO:9)
MiniF-R:5 '-GGCTGTAAAAGGACAGACCACA-3 ' (SEQ ID NO:10)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object MiniF-F, 1 μ l of downstream primer MiniF-R, template are 1 μ l of step (9) single colonie re-suspension liquid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 15s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
9, remove I_SceI-Kana segment
(1) picking GS1783-pBAC-DPV- Δ gE-UL23-Kana single colonie is inoculated in LB liquid of the 2mL containing chloramphenicol In culture medium, 30 DEG C of overnight incubations obtain seed liquor；
(2) seed liquor obtained by 10 μ l steps (1) is taken to be inoculated in LB liquid medium of the 2mL containing chloramphenicol, 30 DEG C of cultures Slight cloud is presented to bacterium solution in 2h；
(3) LB liquid medium and 5M final concentration of 2% of the 1mL containing chloramphenicol is added into bacterium solution obtained by step (2) 30 DEG C of L-arabinose, cultivate 1h；
(4) bacterium solution obtained by step (3) is immediately placed in 42 DEG C of water-baths and cultivates 30min；
(5) after bacterium solution obtained by step (4) being placed in 30 DEG C of culture 2h, take 1 μ l bacterium solution that 200 μ l LB liquid mediums are added The LB solid medium containing chloramphenicol, 30 DEG C of culture for 24 hours~48h are applied to after middle mixing；
(6) gained single colonie is containing chloramphenicol and the Double LB solid medium of Ka Na mycin and chlorine in picking step (5) Parllel screening is carried out on mycin monoclonal antibody LB solid medium, chloramphenicol and the Double LB solid medium of Ka Na mycin are not given birth to Long, the bacterium colony of chloramphenicol monoclonal antibody LB solid culture basal growth is identified by PCR method using MiniF identified for genes primer, is obtained Obtain positive clone molecule GS1783-pBAC-DPV- Δ gE-UL23.
MiniF-F:5 '-GTTATCCACTGAGAAGCGAACG-3 ' (SEQ ID NO:9)
MiniF-R:5 '-GGCTGTAAAAGGACAGACCACA-3 ' (SEQ ID NO:10)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object MiniF-F, 1 μ l of downstream primer MiniF-R, template are 1 μ l of step (6) single colonie re-suspension liquid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
10, rescue DPV CHv- Δ gE virus
(1) recovery GS1783-pBAC-DPV- Δ gE-UL23 freezes bacterium in the LB solid medium containing chloramphenicol, and 30 DEG C overnight incubation；
(2) pBAC-DPV- Δ gE-UL23 plasmid is extracted according to QIAGEN Plasmid Midi Kit operating instruction；
(3) it prepares duck embryo fibroblasts (DEF) and is inoculated in 12 orifice plates, 37 DEG C, 5%CO2After culture for 24 hours, according to 3000 operating instruction of Lipofectamine transfects pBAC-DPV- Δ gE-UL23 plasmid, and fluorescent spot is observed after 96h, collects disease Poison is inoculated in the 6 orifice plates for covering with DEF after multigelation 2 times；
(4) step (3) are repeated three times；
(5) after viral multigelation 2 times that step (4) obtains, 10 times of doubling dilutions are inoculated in the 6 orifice plates for covering with DEF In, 37 DEG C, 5%CO2After being incubated for 2h, abandoning Incubating Solution, the fixed cell of 1% methylcellulose of addition, 37 DEG C, 5%CO2Cultivate 120h Afterwards, picking unstressed configuration sick cell is reinoculated in DEF after multigelation 2 times, obtains DPV CHv- Δ gE-Q；
(6) it is extracted according to TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 specification DPV CHv- Δ gE-Q viral genome identifies primer MiniF-F and MiniF-R using MiniF, identifies the MiniF member of missing Part, final obtain remain without MiniF element, without the remaining seamless deleted virus strain DPV CHv- Δ gE sun of base at missing gene Venereal disease strain, is shown in Fig. 4.
MiniF-F:5 '-GTTATCCACTGAGAAGCGAACG-3 ' (SEQ ID NO:9)
MiniF-R:5 '-GGCTGTAAAAGGACAGACCACA-3 ' (SEQ ID NO:10)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object MiniF-F, 1 μ l of downstream primer MiniF-R, template are the DPV CHv- Δ gE-Q viral genome that step (6) are extracted 1μl；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
The seamless gene-deleted strain DPV CHv- Δ gE of embodiment 2 is inoculated with the detection after 7 age in days ducks to viral load
GE gene and the seamless gene-deleted strain DPV CHv- Δ gE of MiniF element are inoculated with DEF cell with 0.01MOI, after connecing poison 120h collects cell, multigelation 2 times, measures TCID50Afterwards, 7 age in days of 2MOI DPV CHv- Δ gE deleted virus intramuscular inoculation is taken Duck, respectively at for 24 hours, 48h, 72h, 96h acquisition duck blood, liver and spleen, according to TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 specification extracts each tissue DNA.It is carried out using identification primer gE-F and gE-R PCR amplification, detection attack whether 48h duck liver virus after poison is gE gene delection virus, using UL30QPCR identification primer and Taq probe, QPCR detects different time points blood, viral load in liver and spleen.The result shows that DPV CHv- Δ gE is inoculated with It can be detected in blood, liver and spleen after duck；Elder generation is presented in DPV CHv- Δ gE virion quantity in blood, liver The trend cut down after being incremented by；The trend gradually cut down is presented in DPV CHv- Δ gE virion quantity in spleen；DPV in blood CHv- Δ gE virion quantity is lower than liver and spleen tissue；Liver organization DPV CHv- Δ gE virion quantity is in 48h Reach highest and spleen tissue in reaching highest for 24 hours.
The measurement of the seamless gene-deleted strain DPV CHv- Δ gE growth curve of embodiment 3
1, the measurement of one step growth curve
The seamless gene-deleted strain DPV CHv- Δ gE of parental virus DPV CHv and gE gene is inoculated with DEF cell respectively with 2MOI, It meets 6h, 12h after poison, 18h, collect supernatant cell for 24 hours, each time point is done to be repeated three times.After collecting completely, multigelation 2 times, virus titer is detected in 96 orifice plates, the results showed that the missing of gE gene is not significantly affected by the duplication of DPV CHv virus.
2, the measurement of multistep growth curve
The seamless gene-deleted strain DPV CHv- Δ gE of parental virus DPV CHv and gE gene is thin with 0.01MOI inoculation DEF respectively Born of the same parents, connect 12h after poison, for 24 hours, 48h, 72h collect supernatant cell, each time point is done to be repeated three times.After collecting completely, repeatedly Freeze thawing 2 times, virus titer is detected in 96 orifice plates, the results showed that the missing of gE gene is not significantly affected by the increasing of DPV CHv virus Grow situation.
The experiment of the seamless gene-deleted strain DPV CHv- Δ gI plaque test of embodiment 4
The seamless gene-deleted strain DPV CHv- Δ gE of parental virus DPV CHv and gE gene is covered with respectively with 0.01MOI inoculation The 6 orifice plates of DEF cell, 37 DEG C, 5%CO2After adsorbing 2h, supernatant is removed, 2mL1% methylcellulose, 37 DEG C, 5%CO are added2Culture After 48h, 1% methylcellulose is removed, PBS is washed 3 times, and overnight, PBS is washed 3 times for 4% 4 DEG C of paraformaldehyde fixation, and H is added2O2With Methanol is incubated at room temperature 30min with the mixed liquor that volume ratio is that 1:50 is mixed, and distills water washing 3 times, and 5%BSA confining liquid is added, Be incubated at room temperature 30min, be added rabbit-anti DPV, 4 DEG C overnight incubation, PBS wash 3 times, be added biotinylated goat anti-rabbit IgG, 37 DEG C It is incubated for 30min, PBS is washed 3 times, and SABC substrate is added dropwise, and 37 DEG C of incubations 30min, PBS washing 3 times, DAB developing solution is protected from light colour developing, Mounting, the results showed that the missing of gE gene may influence DPV CHv virus and be proliferated in the cell and propagation condition.
In addition, present invention gene-deleted strain DPV CHv- Δ gE also seamless to duck plague virus gE gene has done genetic stability reality It tests, safety experiment and immunogenicity experiments.
Genetic stability: the seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene passed on for 20 generations on DEF cell, There is plaque, shows that the seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene obtained stablizes heredity in DEF.
Safety: 15 4 week old DPV negative antibodies and PCR are detected into negative duck, are randomly divided into 3 groups, every group 5.1st Group intramuscular injection DPV CHv- Δ gE, the 2nd group of intramuscular injection parental virus DPV CHv, the malicious valence of every injecting virus in two groups It is identical, the MEM of the meterings such as the 3rd group of injection, as a control group, and every group of independent isolated rearing, observation, the dead feelings of record morbidity daily Condition.As can be seen from the results, injection has the duck of parental virus all dead, and injects the duck having in DPV CHv- Δ gE and control group Without death, illustrate that DPV CHv- Δ gE safety is good.
Immunogenicity: 10 4 week old DPV negative antibodies and PCR are detected into negative duck, are randomly divided into 2 groups, every group 5.The 1 group of intramuscular injection DPV CHv- Δ gE, the 2nd group of isodose MEM of injection, as a control group, every group of independent isolated rearing.Exempting from Blood sampling in 14 days separates serum after epidemic disease, carries out indirect ELISA detection as envelope antigen using the DPV of purifying, as a result can be detected Antibody during injection DPV CHv- Δ gE duck blood is clear illustrates that DPV CHv- Δ gE has good immunogenicity.
Sequence table
<110>Sichuan Agricultural University
<120>the seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene and its construction method
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 64
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atactgccgg ccagactacg gaacctcaac aattggtacg tagggataac agggtaatcg 60
attt 64
<210> 2
<211> 98
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
taactatttc actagtgagt cattagttca acatccatga cgtaccaatt gttgaggttc 60
cgtagtctgg ccggcagtat gccagtgtta caaccaat 98
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
agcgagtact tctctgcgtc 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
tctcaagacg ctctggaatc 20
<210> 5
<211> 98
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ttattaatct caggagcctg tgtagcgttt ataggaagta gtgttctgtc atgatgcctg 60
caagcggtaa cgaaaacgat tgttacaacc aattaacc 98
<210> 6
<211> 72
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
atcgttttcg ttaccgcttg caggcatcat gacagaacac tacttcctat tagggataac 60
agggtaatcg at 72
<210> 7
<211> 45
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
gcctgcaagc ggtaacgaaa acgattcaat taattgtcat ctcgg 45
<210> 8
<211> 79
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
ccgctccact tcaacgtaac accgcacgaa gatttctatt gttcctgaag gcatattcaa 60
cggacatatt aaaaattga 79
<210> 9
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
gttatccact gagaagcgaa cg 22
<210> 10
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
ggctgtaaaa ggacagacca ca 22

Claims (9)

1. the construction method of the seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene, which comprises the following steps:
(1) pBAC-DPV plasmid is transformed into GS1783 E. coli competent, obtains GS1783-pBAC-DPV bacterial strain, so After prepare GS1783-pBAC-DPV competence；
(2) using pEPkan-S as template, using GS1783-BAC- Δ gE-F and GS1783-BAC- Δ gE-R as primer, pass through Base fragment and gE upstream region of gene and downstream each 40bp of the PCR method amplification comprising I_SceI restriction enzyme site and Kana element are same The target practice segment I_SceI-Kana-gE of source arm, gel extraction obtain I_SceI-Kana-gE segment；
(3) I_SceI-Kana-gE segment is transformed into GS1783-pBAC-DPV competence, is screened, obtain positive clone molecule GS1783-pBAC-DPV-gE-Kana；
(4) the I_SceI-Kana segment in positive clone molecule GS1783-pBAC-DPV-gE-Kana is removed, prepares GS1783- PBAC-DPV- Δ gE competence；
(5) using pEPkan-S as template, using GS1783-MiniF-F and GS1783-MiniF-R as primer, pass through PCR method Base fragment of the amplification comprising I_SceI restriction enzyme site and Kana element, be located at MiniF element ori2 downstream of gene 240bp and Homology arm segment I_SceI-Kana-MiniF at MiniF element ori2 downstream of gene 290bp, gel extraction obtain I_ SceI-Kana-MiniF segment；
(6) using CHv genome as template, using CHv-UL23-F and CHv-UL23-R as primer, include by PCR method amplification UL23 gene, the downstream I_SceI-Kana-MiniF homology arm are overlapped 25bp and are located at MiniF element ori2 downstream of gene 180bp The homology arm segment at place, gel extraction obtain UL23-MiniF segment；
(7) using I_SceI-Kana-MiniF segment and UL23-MiniF segment as template, PCR fusion reaction is carried out, then to melt Conjunction segment is template, and PCR amplification is carried out using GS1783-MiniF-F and CHv-UL23-R as primer and obtains I_SceI-Kana- MiniF-UL23 target practice segment；
(8) I_SceI-Kana-MiniF-UL23 target practice segment is transformed into GS1783-pBAC-DPV- Δ gE competence, is passed through Antibiotic-screening and PCR identification, obtain positive clone molecule GS1783-pBAC-DPV- Δ gE-UL23-Kana；
(9) the I_SceI-Kana segment in positive clone molecule GS1783-pBAC-DPV- Δ gE-UL23-Kana is removed, obtains Positive clone molecule GS1783-pBAC-DPV- Δ gE-UL23；
(10) pBAC-DPV- Δ gE-UL23 plasmid is extracted from positive clone molecule GS1783-pBAC-DPV- Δ gE-UL23, it will PBAC-DPV- Δ gE-UL23 plasmid transfection DEF cell obtains the seamless gene-deleted strain DPV CHv- Δ of gE gene by colony screening gE。
2. the construction method of the seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene according to claim 1, special Sign is, PCR amplification system in step (2), step (5) and step (6) are as follows: ddH2O 22μl、Max 25 μ l of DNA Polymerase, 1 μ l of upstream primer, 1 μ l of downstream primer, 1 μ l of template；PCR amplification condition are as follows: 98 DEG C of initial denaturations 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 recycle, last 72 DEG C of extensions 10min.
3. the construction method of the seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene according to claim 1 or 2, It is characterized in that, primer sequence in step (2) are as follows:
GS1783-BAC-ΔgE-F:5’-ATACTGCCGGCCAGACTACGGAACCTCAACAATTGGTACGtagggataaca gggtaatcgattt-3'；
GS1783-BAC-ΔgE-R:5’-TAACTATTTCACTAGTGAGTCATTAGTTCAACATCCATGACGTACCAATTG TTGAGGTTCCGTAGTCTGGCCGGCAGTATgccagtgttacaaccaat-3’。
4. the construction method of the seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene according to claim 1 or 2, It is characterized in that, primer sequence in step (5) are as follows:
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGA TGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3'；
GS1783-MiniF-R:5’-ATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTATtagg gataacagggtaatcgat-3’。
5. the construction method of the seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene according to claim 1 or 2, It is characterized in that, primer sequence in step (6) are as follows:
CHv-UL23-F:5'-GCCTGCAAGCGGTAACGAAAACGATtcaattaattgtcatctcgg-3'；
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCATATTC AACGGACATATTAAAAATTGA-3’。
6. the construction method of the seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene according to claim 1, special Sign is, primer sequence in step (7) are as follows:
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGA TGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3'；
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCATATTC AACGGACATATTAAAAATTGA-3’。
7. the construction method of the seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene according to claim 1, special Sign is, PCR fusion system in step (7) are as follows: ddH2O 8μl、Max DNA Polymerase 10μl、 Template I_SceI-Kana-MiniF segment and each 1 μ l of UL23-MiniF segment；PCR fusion conditions are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 55 DEG C of annealing 5s, 72 DEG C of extension 1min, totally 5 recycle.
8. the construction method of the seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene according to claim 1, special Sign is, PCR amplification system in step (7) are as follows: fusion 20 μ l of template, 0.5 μ l of upstream primer GS1783-MiniF-F, downstream 0.5 μ l of primer CHv-UL23-R；PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C extend 5s, totally 30 circulation, last 72 DEG C of extensions 10min.
9. the seamless gene-deleted strain DPV of duck plague virus gE gene constructed using the described in any item methods of claim 1-8 CHv-ΔgE。
CN201811599493.XA 2018-12-26 2018-12-26 Duck plague virus gE gene traceless deletion strain DPV CHv-delta gE and construction method thereof Active CN109593732B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811599493.XA CN109593732B (en) 2018-12-26 2018-12-26 Duck plague virus gE gene traceless deletion strain DPV CHv-delta gE and construction method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811599493.XA CN109593732B (en) 2018-12-26 2018-12-26 Duck plague virus gE gene traceless deletion strain DPV CHv-delta gE and construction method thereof

Publications (2)

Publication Number Publication Date
CN109593732A true CN109593732A (en) 2019-04-09
CN109593732B CN109593732B (en) 2021-02-02

Family

ID=65964511

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811599493.XA Active CN109593732B (en) 2018-12-26 2018-12-26 Duck plague virus gE gene traceless deletion strain DPV CHv-delta gE and construction method thereof

Country Status (1)

Country Link
CN (1) CN109593732B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102994534A (en) * 2012-05-08 2013-03-27 四川农业大学 Duck plague virus gE gene transfer vector pUC-Delta gE-EGFP and recombinant strain DPV-Delta gE-EGFP
CN105802922A (en) * 2016-04-19 2016-07-27 四川农业大学 Establishing method of bacterial artificial chromosome recombinant duck plague virus rescue system platform and application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102994534A (en) * 2012-05-08 2013-03-27 四川农业大学 Duck plague virus gE gene transfer vector pUC-Delta gE-EGFP and recombinant strain DPV-Delta gE-EGFP
CN105802922A (en) * 2016-04-19 2016-07-27 四川农业大学 Establishing method of bacterial artificial chromosome recombinant duck plague virus rescue system platform and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ISHIHARA Y 等: ""Removal of Inserted BAC after linearizatiON (RIBON)-a novel strategy to excise the mini-F sequences from viral BAC vectors."", 《THE JOURNAL OF VETERINARY MEDICAL SCIENCE》 *
陈柳 等: ""DEV囊膜糖蛋白gI基因缺失病毒生物学特性研究"", 《浙江畜牧兽医》 *

Also Published As

Publication number Publication date
CN109593732B (en) 2021-02-02

Similar Documents

Publication Publication Date Title
CN109536463A (en) The dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI and its construction method
CN113388562A (en) Rhizobium HH103 omega mutant for reducing number of nodules and application thereof
CN107164409A (en) CDV sensitive cell line SLAM MDCK and its construction method and application
CN110295183A (en) A method of citrus is improved to canker resistance based on CsPrx25 overexpression
CN109576295A (en) A kind of duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC and its construction method
CN107345222A (en) Express recombinant pseudorabies virus and its construction method and the application of Porcine epidemic diarrhea virus S1 albumen
CN114164184B (en) Newcastle disease virus gene VI vaccine strain and application thereof
CN106755087A (en) The stabilization expression recombinant cell lines of CSFV E 2 protein, preparation method, using and CSFV subunit vaccine
CN109705223B (en) Recombinant subunit vaccine of orf virus and production method thereof
WO2021042470A1 (en) Use of combination of grna targets in constructing cell lines of porcine models of haemophilia a, b and ab
CN109628417A (en) The dual-gene seamless gene-deleted strain CHv-BAC-G- Δ gE+ Δ gI of duck plague virus gE and gI and its construction method
CN109593732A (en) The seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene and its construction method
CN109609548A (en) The seamless gene-deleted strain DPV CHv- Δ gI of duck plague virus gI gene and its construction method
CN109486772A (en) The seamless gene-deleted strain DPV CHv-gE Δ ET in the region duck plague virus gE gene ET and its construction method
CN109486774A (en) The seamless gene-deleted strain DPV CHv-gE Δ CT in the region duck plague virus gE gene C T and its construction method
CN110257434A (en) The cell clone of MyoG gene knock-in and MSTN gene knockout is prepared using Crispr/Cas9 technology
CN109576293A (en) The seamless gene-deleted strain CHv-BAC-G-gE Δ ET in the region duck plague virus gE gene ET and its construction method
CN109486773A (en) The seamless gene-deleted strain CHv-BAC-G-gE Δ CT in the region duck plague virus gE gene C T and its construction method
CN109576294A (en) The seamless gene-deleted strain CHv-BAC-G- Δ gE of duck plague virus gE gene and its construction method
CN109593731A (en) The seamless gene-deleted strain CHv-BAC-G- Δ gI of duck plague virus gI gene and its construction method
CN109593730A (en) The seamless gene-deleted strain DPV CHv- Δ Lorf5 of duck plague virus Lorf5 gene and its construction method
CN109609550A (en) A kind of seamless gene-deleted strain DPV CHv- Δ UL41 of duck plague virus UL41 gene and its construction method
CN108324937A (en) The herpes turkey virus live vector vaccine of 4 type penton protein of expression aviadenovirus serum and its preparation and application
CN108754019B (en) Amplification method of porcine epidemic diarrhea virus ORF1 gene complete sequence
CN109609549A (en) A kind of seamless gene-deleted strain CHv-BAC-G- Δ UL41 of duck plague virus UL41 gene and its construction method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant