CN109536463A - The dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI and its construction method - Google Patents

The dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI and its construction method Download PDF

Info

Publication number
CN109536463A
CN109536463A CN201811599537.9A CN201811599537A CN109536463A CN 109536463 A CN109536463 A CN 109536463A CN 201811599537 A CN201811599537 A CN 201811599537A CN 109536463 A CN109536463 A CN 109536463A
Authority
CN
China
Prior art keywords
gene
dpv
kana
minif
chv
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811599537.9A
Other languages
Chinese (zh)
Other versions
CN109536463B (en
Inventor
程安春
刘田
汪铭书
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sichuan Agricultural University
Original Assignee
Sichuan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sichuan Agricultural University filed Critical Sichuan Agricultural University
Priority to CN201811599537.9A priority Critical patent/CN109536463B/en
Publication of CN109536463A publication Critical patent/CN109536463A/en
Priority to PCT/CN2019/125291 priority patent/WO2020135108A1/en
Application granted granted Critical
Publication of CN109536463B publication Critical patent/CN109536463B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16311—Mardivirus, e.g. Gallid herpesvirus 2, Marek-like viruses, turkey HV
    • C12N2710/16321—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16311—Mardivirus, e.g. Gallid herpesvirus 2, Marek-like viruses, turkey HV
    • C12N2710/16322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/20—Pseudochromosomes, minichrosomosomes
    • C12N2800/204—Pseudochromosomes, minichrosomosomes of bacterial origin, e.g. BAC
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Virology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides a kind of dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI and its construction methods.The present invention utilizes GS1783 coli strain and pEPkan-S plasmid, duck plague virus gE gene and gI gene are lacked through homologous recombination twice in bacterial artificial chromosome recombination duck plague virus rescue system platform, MiniF element is lacked using intracellular spontaneous methods of homologous recombination, completes the building of no external source base and the dual-gene seamless gene-deleted strain of the remaining duck plague virus of MiniF element for the first time.Technical solution of the present invention solves the problems, such as to remain base in deletion segment when missing duck plague virus gene and has lacked MiniF element, provides sufficient technical support accurately to probe into the building of duck plague virus gene function and attenuated live vaccine.

Description

The dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI and its Construction method
Technical field
The invention belongs to gene engineering technology fields, and in particular to a kind of dual-gene seamless gene-deleted strain of duck plague virus gE and gI DPV CHv- Δ gE+ Δ gI and its construction method.
Background technique
A kind of bacterial artificial chromosome (bacterial artificial chromosome, BAC) new development is got up DNA vector system, it has many advantages, such as, and capacity is big, hereditary capacity is stable, easily operated, in construction of gene library and gene function Analysis etc. is widely used.Whole viral genes group DNA molecular is inserted into BAC carrier, most using the vector encoded Small fertility factor replicon (Minimal fertility factor replicon, Mini-F) obtains molecular cloning disease Poison, and assignment of genes gene mapping modification technique mature in Escherichia coli is combined, to realize the missing of the viral gene in prokaryotic system And the insertion of foreign gene.Current more common bacillus coli gene locator qualification technology mainly includes the same of Red/ET mediation The homologous recombination technique and Tn transposons of source recombinant technique, RecA protein mediated homologous recombination technique, Cre/loxP mediation The radom insertion and mutating technology of mediation.Mature bacterial artificial chromosome duck has been obtained using molecular cloning technological means Pestivirus saves system platform, while can be thin using the homologous recombination technique that bacillus coli gene locator qualification Red/ET is mediated Bacterium artificial chromosome duck plague virus save system platform on carry out duck plague virus gene missing and foreign gene insertion, this at Fruit has greatly pushed the flow of research of duck plague virus gene function.
The homologous recombination technique that Red/ET is mediated is based on lambda phage Red operon (Red α/Red β/Red γ) and Rac The homologous recombination Knockout technology of bacteriophage RecE/RecT homologous recombination enzyme.The technical operation is simple, quick, efficient, is widely applied In gene delection, mutation work.But gene delection is carried out using the operating technology, is mutated and can be remained in missing or mutational site About 80bp or so external source base sequence (site FRT), the residual in the site will affect the accurate analysis of gene function.MiniF member Part is as the minimum fertility factor replicon for maintaining BAC carrier duplication, mainly by regulation BAC replication orgin (oriS) The sopC gene of repE, repF gene, sopA, sopB gene of regulation replicon distribution and coding centromere region is constituted. It joined resistance screening gene and fluorescent marker gene to complete bacterial resistance screening and BAC label screening, MiniF element. MiniF element is inserted into viral genome, increases genome length, generates uncertain influence to virus replication.MiniF element simultaneously It is remained in viral genome as bacterial sequences, is unfavorable for the exploitation and license of attenuated live vaccine.Therefore base residual is solved Problem simultaneously removes the seamless gene-deleted strain of MiniF element acquisition, it has also become probes into the emphasis of duck plague virus gene delection method.
Duck plague (Duck Plague, DP) be by duck plague virus in Alphaherpesviridae (Duck Plague virus, The acute contact height lethal infectious diseases of the aquatic birds such as duck caused by DPV), goose.The disease is reported by Holland first, immediately at me The more flourishing area of the duck culturing industries such as state south China, Central China and East China is popular, causes serious economic damage to the duck culturing industry in China It loses.Therefore it understands duck plague virus gene function in depth, reinforce to the research of duck plague epidemic disease to ensuring China's duck culturing industry health, can hold Supervention exhibition is particularly important.
Duck plague virus DPV-CHv pnca gene group DNA overall length 162175bp, includes 78 open reading frame, and codified participates in The structural proteins and non-structural protein of duck plague virus life cycle, wherein structural proteins mainly include capsid protein, cortex albumen And envelope protein.Envelope protein is glycosylation albumen, including gB, gC, gD, gE, gG, gH, gI, gJ, gK, gL, gM, gN 12 Kind.Glycoprotein has the function of that mediate retroviral adsorbs, is viral in spread between cells into sensitive cells and promotion, carries simultaneously Antigenic determinant can induce animal body immune system to the identification of virus and cause the pathology damage of tissue, therefore probes into capsule Effect of the membrane glycoprotein in duck plague virus life cycle is to deeply probing into duck plague virus gene function and to carry out duck plague epidemic disease anti- It is most important to control work.
It is utilized in the prior art using BAC as the technology of plateform molecules cloning virus, duck plague virus genome recombination is arrived In Baculovirus transfer vector containing BAC, building bacterial artificial chromosome recombination duck plague virus saves system platform DPV CHv- BAC-G.In combination with Red/ET modification technique, duck plague virus base is completed by mature genetic manipulation means in prokaryotic system Because of missing and foreign gene insertion.But system is saved in bacterial artificial chromosome recombination duck plague virus using Red/ET modification technique On platform to duck plague virus gene delection after, can at the missing gene site FRT at remnants two, while remaining MiniF element. There is the probing into of gene function, the exploitation of attenuated live vaccine and license and influence in the residual of FRT external source site and MiniF element.
Summary of the invention
For the above-mentioned problems in the prior art, it is dual-gene seamless scarce that the present invention provides a kind of duck plague virus gE and gI Strain DPV CHv- Δ gE+ Δ gI and its construction method are lost, is being lacked when which can effectively solve missing duck plague virus gene Unsceptered point residual base, while the problem of remain MiniF element.
To achieve the above object, the technical solution adopted by the present invention to solve the technical problems is:
A kind of dual-gene seamless gene-deleted strain of duck plague virus gE and gI belongs to Mardivirus for Marek's disease poison, is named as duck The bis- deleted virus strain DPV CHv- Δ gE+ Δ gI of pestivirus gE and gI are preserved in Chinese Typical Representative culture on July 4th, 2018 Collection (address are as follows: Wuhan City, Hubei Province Wuchang District Wuhan University), deposit number are CCTCC NO:V201841.
Above-mentioned dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI (the i.e. duck plague virus gE and gI of duck plague virus gE and gI Double deleted virus strain DPV CHv- Δ gE+ Δ gI) construction method the following steps are included:
(1) pBAC-DPV plasmid is transformed into GS1783 E. coli competent, obtains GS1783-pBAC-DPV bacterium Strain, then prepares GS1783-pBAC-DPV competence；
(2) using pEPkan-S as template, using GS1783-BAC- Δ gE-F and GS1783-BAC- Δ gE-R as primer, lead to Cross the base fragment and gE upstream region of gene and each 40bp in downstream that PCR method amplification includes I_SceI restriction enzyme site and Kana element The target practice segment I_SceI-Kana-gE of homology arm, gel extraction obtain I_SceI-Kana-gE segment；
(3) I_SceI-Kana-gE segment is transformed into GS1783-pBAC-DPV competence, is screened, obtain positive gram Longzi GS1783-pBAC-DPV-gE-Kana；
(4) the I_SceI-Kana segment in positive clone molecule GS1783-pBAC-DPV-gE-Kana is removed, prepares GS1783-pBAC-DPV- Δ gE competence；
(5) using pEPkan-S as template, using GS1783-BAC- Δ gI-F and GS1783-BAC- Δ gI-R as primer, lead to Cross the base fragment and gI upstream region of gene and each 40bp in downstream that PCR method amplification includes I_SceI restriction enzyme site and Kana element The target practice segment I_SceI-Kana-gI of homology arm, gel extraction obtain I_SceI-Kana-gI segment；
(6) I_SceI-Kana-gI segment is transformed into GS1783-pBAC-DPV- Δ gE competence, is sieved through antibiotic Choosing and PCR identification, obtain positive clone molecule GS1783-pBAC-DPV- Δ gE-gI-Kana；
(7) the I_SceI-Kana segment in positive clone molecule GS1783-pBAC-DPV- Δ gE-gI-Kana is removed, makes Standby GS1783-pBAC-DPV- Δ gE+ Δ gI competence；
(8) using pEPkan-S as template, using GS1783-MiniF-F and GS1783-MiniF-R as primer, pass through PCR Base fragment of the method amplification comprising I_SceI restriction enzyme site and Kana element is located at MiniF element ori2 downstream of gene 240bp Place and the homology arm segment I_SceI-Kana-MiniF at MiniF element ori2 downstream of gene 290bp, gel extraction obtain Obtain I_SceI-Kana-MiniF segment；
(9) it using CHv genome as template, using CHv-UL23-F and CHv-UL23-R as primer, is expanded by PCR method Comprising UL23 gene, the downstream I_SceI-Kana-MiniF homology arm overlapping 25bp and it is located at MiniF element ori2 downstream of gene Homology arm segment at 180bp, gel extraction obtain UL23-MiniF segment；
(10) using I_SceI-Kana-MiniF segment and UL23-MiniF segment as template, PCR fusion reaction is carried out, so Afterwards to merge segment as template, PCR amplification is carried out using GS1783-MiniF-F and CHv-UL23-R as primer and obtains I_SceI- Kana-MiniF-UL23 target practice segment；
(11) I_SceI-Kana-MiniF-UL23 target practice segment is transformed into GS1783-pBAC-DPV- Δ gE+ Δ gI sense It by state, is identified through antibiotic-screening and PCR, obtains positive clone molecule GS1783-pBAC-DPV- Δ gE+ Δ gI-UL23- Kana；
(12) by the I_SceI-Kana piece in positive clone molecule GS1783-pBAC-DPV- Δ gE+ Δ gI-UL23-Kana Section is removed, and positive clone molecule GS1783-pBAC-DPV- Δ gE+ Δ gI-UL23 is obtained；
(13) pBAC-DPV- Δ gE+ Δ is extracted from positive clone molecule GS1783-pBAC-DPV- Δ gE+ Δ gI-UL23 PBAC-DPV- Δ gE+ Δ gI-UL23 plasmid transfection DEF cell is obtained gE and gI by colony screening by gI-UL23 plasmid Dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI.
Further, PCR amplification system in step (2), step (5), step (8) and step (9) are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, 1 μ l of upstream primer, 1 μ l of downstream primer, 1 μ l of template；PCR amplification Condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 recycle, and last 72 DEG C Extend 10min.
Further, primer sequence in step (2) are as follows:
GS1783-BAC-ΔgE-F:5’-ATACTGCCGGCCAGACTACGGAACCTCAACAATTGGTACGtagggat aacagggtaatcgattt-3'；
GS1783-BAC-ΔgE-R:5’-TAACTATTTCACTAGTGAGTCATTAGTTCAACATCCATGACGTACCA ATTGTTGAGGTTCCGTAGTCTGGCCGGCAGTATgccagtgttacaaccaat-3’。
Further, primer sequence in step (5) are as follows:
GS1783-BAC-ΔgI-F:5’-GTGCGCCATATAGACGATATATTGAGTTTCAAAAATAGAAtagggat aacagggtaatcgattt-3'；
GS1783-BAC-ΔgI-R:5’-TCATAACAAAAACATTTACTTTTAGTCATACTGATGTGAATTCTATT TTTGAAACTCAATATATCGTCTATATGGCGCACgccagtgttacaaccaat-3’。
Further, primer sequence in step (8) are as follows:
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTC ATGATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3'；
GS1783-MiniF-R:5’-ATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTAT tagggataacagggtaatcgat-3’。
Further, primer sequence in step (9) are as follows:
CHv-UL23-F:5'-GCCTGCAAGCGGTAACGAAAACGATtcaattaattgtcatctcgg-3'；
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCAT ATTCAACGGACATATTAAAAATTGA-3’。
Further, primer sequence in step (10) are as follows:
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTC ATGATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3'；
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCAT ATTCAACGGACATATTAAAAATTGA-3’。
Further, PCR fusion system in step (10) are as follows: ddH2O 8μl、Max DNA 10 μ l of Polymerase, template I_SceI-Kana-MiniF segment and each 1 μ l of UL23-MiniF segment；PCR fusion conditions are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 55 DEG C of annealing 5s, 72 DEG C of extension 1min, totally 5 recycle.
Further, PCR amplification system in step (10) are as follows: fusion 20 μ l of template, upstream primer GS1783-MiniF-F 0.5 μ l, 0.5 μ l of downstream primer CHv-UL23-R；PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C Anneal 15s, 72 DEG C of extension 5s, totally 30 circulations, last 72 DEG C of extensions 10min.
The dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI provided by the invention and its building side Method has the advantages that
To obtain without external source base and the remaining duck plague virus gene-deleted strain of MiniF element, the present invention is in bacteria artificial Chromosome recombination duck plague virus is saved on the basis of system platform, using Red-based modification technique, i.e., using containing codified The GS1783 coli strain of Red operon and I_SceI enzyme gene sequence and resistance and I_SceI digestion are received containing coding card The plasmid pEPkan-S in site, first through homologous twice heavy in bacterial artificial chromosome recombination duck plague virus rescue system platform Group missing duck plague virus gE gene and gI gene, then MiniF element is lacked through intracellular spontaneous methods of homologous recombination, it completes for the first time Building without external source base and the dual-gene seamless gene-deleted strain of the remaining duck plague virus of MiniF element.Technical solution of the present invention solution The problem of deletion segment remains base and MiniF element has been lacked when missing of having determined duck plague virus gene, accurately to probe into duck The building of pestivirus gene function and attenuated live vaccine provides sufficient technical support.
Detailed description of the invention
Fig. 1 is pEPkan-S plasmid map.
Fig. 2 is to recombinate duck plague virus in bacterial artificial chromosome using Red-Based modification technique to save in system platform Carry out the operational flowchart of gene delection (by taking gE gene delection as an example).
Fig. 3 is to be lacked using Red-Based modification technique and intracellular spontaneous homologous recombination technique to MiniF element Operational flowchart.
Fig. 4 is picture after the seamless deleted virus strain virus rescue of DPV CHv- Δ gE+ Δ gI.
Fig. 5 is the PCR detection that DPV CHv- Δ gE+ Δ gI is inoculated with liver dna extract after duck 48h.
Fig. 6 is inoculated in the blood, spleen and the liver that obtain in different time points after duck for DPV CHv- Δ gE+ Δ gI and lacks Lose viral level.
Specific embodiment
The dual-gene seamless gene-deleted strain of duck plague virus gE and gI is named as the bis- deleted virus strain DPV of duck plague virus gE and gI CHv- Δ gE+ Δ gI, building process material therefor and reagent are as follows:
1, experimental material
(1) cell, bacterial strain, virus stain, plasmid
Primary duck embryo fibroblasts are prepared according to a conventional method by the nonimmune fertilization duck embryos of 10-11 age in days；GS1783 bacterial strain It is saved by Sichuan Agricultural University laboratory；PBAC-DPV plasmid is constructed and is saved by Sichuan Agricultural University laboratory；pEPkan-S Plasmid is saved by Sichuan Agricultural University laboratory.
2, molecular biology reagents
The small extraction reagent kit of plasmid is purchased from TIANGEN company；QIAGEN Plasmid Midi Kit is purchased from QIAGEN company； Plain agar sugar gel DNA QIAquick Gel Extraction Kit is purchased from TIANGEN company；Max DNA Polymerase purchase From Takara company；TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 is public purchased from TaKaRa Department；Lipofectamine 3000 is purchased from Invitrogen company；Instant SABC immunohistochemical staining kit (rabbit igg) purchase From doctor's moral company；DAB colour reagent box (Huang) is purchased from doctor's moral company.
3, solution used and its preparation are tested
LB liquid medium: weigh Tryptone 10g, Yeast Extract 5g, sodium chloride 10g be dissolved in 800mL go from It in sub- water, is sufficiently stirred, is settled to lL, autoclave sterilization.
LB solid medium: being added 15g agar powder in the LB liquid medium for being settled to 1L, after autoclave sterilization, 60 DEG C or so are cooled to, 1.5mL chloramphenicol (storage concentration 25mg/ml) or 1.5mL kanamycins (storage concentration 50mg/ is added ML), paved plate, after to be solidified, 4 DEG C of preservations.
MEM: being dissolved in 800mL deionized water for 9.6g MEM dry powder and 2.2g sodium bicarbonate, be sufficiently stirred, adjust pH value to 7.4, it is settled to lL, filtration sterilization, 4 DEG C of preservations.
Embodiment 1 prepares the dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI
The dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI, construction method includes following step It is rapid:
1, preparation GS1783 electricity turns competence, electrotransformation pBAC-DPV plasmid
(1) Escherichia coli of the recovery with pBAC-DPV plasmid are in the LB solid medium containing chloramphenicol, 37 DEG C of cultures Overnight；It chooses single colonie to be inoculated in the LB liquid medium containing chloramphenicol, 37 DEG C of overnight incubations；
(2) pBAC-DPV plasmid is extracted according to QIAGEN Plasmid Midi Kit operating instruction；
(3) recovery GS1783 freezes bacterium in LB solid medium, 30 DEG C of overnight incubations；
(4) picking GS1783 single colonie is inoculated in 5mL LB liquid medium, 30 DEG C of overnight incubations, obtains seed liquor；
(5) 5mL seed liquor is added in 100mL LB liquid medium, 30 DEG C are shaken to OD600Value is between 0.5~0.7；
(6) bacterium solution obtained by step (5) is immediately placed in mixture of ice and water cooling 20min；
(7) take bacterium solution obtained by step (6), 4 DEG C, 4500 × g centrifugation 10min remove supernatant；
(8) with pre-cooling ultrapure water cleaning step (7) bacterial sediment repeatedly on ice；
(9) ultrapure water is added into thallus obtained by step (8), bacterium solution is settled to 500 μ l, every 100 μ l of pipe is dispensed to pre-cooling EP pipe obtains GS1783 electricity and turns competence；
(10) turn that 20ng pBAC-DPV plasmid is added in competence in 100 μ l GS1783 electricity, after mixing by competence and The electric shock bottom of a cup portion of 2mm pre-cooling is added in plasmid together, shocks by electricity under the conditions of 15kV/cm；
(11) take 100 μ l LB liquid mediums that thallus after electric shock is resuspended, after 30 DEG C are shaken bacterium 1h, 4500 × g is centrifuged thallus 2min abandons supernatant, is suspended and is precipitated using 200 μ l LB liquid mediums, is coated on the LB solid medium containing chloramphenicol, 30 DEG C of cultures for 24 hours, obtain GS1783-pBAC-DPV bacterial strain.
2, I_SceI-Kana-gE target practice segment is expanded
(1) Escherichia coli of the recovery with pEPkan-S plasmid are in LB solid medium containing kanamycin, and 37 DEG C Overnight incubation；It chooses single colonie to be inoculated in LB liquid medium containing kanamycin, 37 DEG C of overnight incubations are mentioned using plasmid is small Kit extracts pEPkan-S plasmid (pEPkan-S plasmid map is shown in Fig. 1)；
(2) using pEPkan-S plasmid as template, GS1783-BAC- Δ gE-F and GS1783-BAC- Δ gE-R is primer, is expanded Increase I_SceI-Kana-gE target practice segment, amplified fragments are recycled using plain agar sugar gel DNA QIAquick Gel Extraction Kit；
GS1783-BAC-ΔgE-F:5’-ATACTGCCGGCCAGACTACGGAACCTCAACAATTGGTACGtagggat Aacagggtaatcgattt-3 ' (SEQ ID NO:1)
GS1783-BAC-ΔgE-R:5’-TAACTATTTCACTAGTGAGTCATTAGTTCAACATCCATGACGTACCA ATTGTTGAGGTTCCGTAGTCTGGCCGGCAGTATgccagtgttacaaccaat-3 ' (SEQ ID NO:2)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object GS1783-BAC- Δ gE-F, 1 μ l of downstream primer GS1783-BAC- Δ gE-R, 1 μ l of template pEPkan-S plasmid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
Base is carried out in bacterial artificial chromosome recombination duck plague virus rescue system platform using Red-Based modification technique Because the operational flowchart (by taking gE gene delection as an example) of missing is shown in Fig. 2, detailed process includes 3 and 4 two following processes.
3, preparation GS1783-pBAC-DPV electricity turns competence and carries out target practice segment target practice
(1) recovery GS1783-pBAC-DPV freezes bacterium in the LB solid medium containing chloramphenicol, and 30 DEG C were cultivated Night；
(2) picking GS1783-pBAC-DPV single colonie is inoculated in LB liquid medium of the 5mL containing chloramphenicol, 30 DEG C of trainings It supports overnight, obtains seed liquor；
(3) 5mL seed liquor is added in LB liquid medium of the 100mL containing chloramphenicol, is placed in 30 DEG C and shakes to OD600Value exists Between 0.5~0.7；
(4) bacterium solution obtained by step (3) is immediately placed in mixture of ice and water cooling 20min after 42 DEG C of culture 15min；
(5) bacterium solution obtained by 50mL step (4) is taken, 10min is centrifuged in 4 DEG C of 4500 × g, removes supernatant；
(6) with pre-cooling ultrapure water cleaning step (5) bacterial sediment repeatedly on ice；
(7) ultrapure water is added into thallus obtained by step (6), bacterium solution is settled to 500 μ l, every 100 μ l of pipe is dispensed to pre-cooling EP pipe obtains GS1783-pBAC-DPV electricity and turns competence；
(8) turn that 200ng I_SceI-Kana-gE target practice segment is added in competence in 100 μ l electricity, by competence after mixing The electric shock bottom of a cup portion of 2mm pre-cooling is added together with target practice segment, shocks by electricity under the conditions of 15kV/cm；
(9) it takes 100 μ l LB liquid mediums that thallus after electric shock is resuspended, after 30 DEG C are shaken bacterium 1h, is centrifuged thallus in 4500 × g 2min abandons supernatant, and 200 μ l LB liquid mediums, which suspend, to be precipitated, and is coated on containing kanamycin and chloramphenicol twin antibiotic resistance LB solid medium, in 30 DEG C of culture 48h；
(10) single colonie obtained by PCR authentication step (9) obtains positive bacterium colony GS178-pBAC-DPV-gE-Kana, with step Suddenly the single colonie re-suspension liquid grown in (9) is template, utilizes amplification I_SceI-Kana-gE target practice segment upstream primer GS1783- BAC- Δ gE-F and identification gE downstream of gene primer gE-R identify positive bacterium colony, obtain positive clone molecule GS1783-pBAC-DPV- gE-Kana；
GS1783-BAC-ΔgE-F:5’-ATACTGCCGGCCAGACTACGGAACCTCAACAATTGGTACGtagggat Aacagggtaatcgattt-3 ' (SEQ ID NO:1)
GE-R:5 '-AGCGAGTACTTCTCTGCGTC-3 ' (SEQ ID NO:3)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object GS1783-BAC- Δ gE-F, 1 μ l of downstream primer gE-R, template are 1 μ l of step (9) single colonie re-suspension liquid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
4, remove I_SceI-Kana segment
(1) picking GS1783-pBAC-DPV-gE-Kana single colonie is inoculated in LB liquid medium of the 2mL containing chloramphenicol In, 30 DEG C of overnight incubations obtain seed liquor；
(2) seed liquor obtained by 10 μ l steps (1) is taken to be inoculated in LB liquid medium of the 2mL containing chloramphenicol, 30 DEG C of cultures Slight cloud is presented to bacterium solution in 2h；
(3) LB liquid medium and 5M final concentration of 2% of the 1mL containing chloramphenicol is added into bacterium solution obtained by step (2) L-arabinose, 30 DEG C of culture 1h；
(4) bacterium solution obtained by step (3) is immediately placed in 42 DEG C of water-baths and cultivates 30min；
(5) after bacterium solution obtained by step (4) being placed in 30 DEG C of culture 2h, take 1 μ l bacterium solution that 200 μ l LB liquid mediums are added The LB solid medium containing chloramphenicol, 30 DEG C of culture for 24 hours~48h are applied to after middle mixing；
(6) gained single colonie is containing chloramphenicol and the Double LB solid medium of Ka Na mycin and chlorine in picking step (5) Parllel screening is carried out on mycin monoclonal antibody LB solid medium, chloramphenicol and the Double LB solid medium of Ka Na mycin are not given birth to Long, the bacterium colony of chloramphenicol monoclonal antibody LB solid culture basal growth is identified by PCR method using gE identified for genes primer, obtains sun Property clone GS1783-pBAC-DPV- Δ gE.
GE-F:5 '-TCTCAAGACGCTCTGGAATC-3 ' (SEQ ID NO:4)
GE-R:5 '-AGCGAGTACTTCTCTGCGTC-3 ' (SEQ ID NO:3)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object gE-F, 1 μ l of downstream primer gE-R, template are 1 μ l of step (6) single colonie re-suspension liquid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
5, I_SceI-Kana-gI target practice segment is expanded
(1) Escherichia coli of the recovery with pEPkan-S plasmid are in LB solid medium containing kanamycin, and 37 DEG C Overnight incubation；It chooses single colonie to be inoculated in LB liquid medium containing kanamycin, 37 DEG C of overnight incubations are mentioned using plasmid is small Kit extracts pEPkan-S plasmid；
(2) using pEPkan-S plasmid as template, GS1783-BAC- Δ gI-F and GS1783-BAC- Δ gI-R is primer, is expanded Increase I_SceI-Kana-gI target practice segment, amplified fragments are recycled using plain agar sugar gel DNA QIAquick Gel Extraction Kit；
GS1783-BAC-ΔgI-F:5’-GTGCGCCATATAGACGATATATTGAGTTTCAAAAATAGAAtagggat Aacagggtaatcgattt-3 ' (SEQ ID NO:5)
GS1783-BAC-ΔgI-R:5’-TCATAACAAAAACATTTACTTTTAGTCATACTGATGTGAATTCTATT TTTGAAACTCAATATATCGTCTATATGGCGCACgccagtgttacaaccaat-3 ' (SEQ ID NO:6)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object GS1783-BAC- Δ gI-F, 1 μ l of downstream primer GS1783-BAC- Δ gI-R, 1 μ l of template pEPkan-S plasmid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
6, preparation GS1783-pBAC-DPV- Δ gE electricity turns competence and carries out target practice segment target practice
(1) recovery GS1783-pBAC-DPV- Δ gE freezes bacterium in the LB solid medium containing chloramphenicol, 30 DEG C of trainings It supports overnight；
(2) picking GS1783-pBAC-DPV- Δ gE single colonie is inoculated in LB liquid medium of the 5mL containing chloramphenicol, and 30 DEG C overnight incubation obtains seed liquor；
(3) 5mL seed liquor is added in LB liquid medium of the 100mL containing chloramphenicol, is placed in 30 DEG C and shakes to OD600Value exists Between 0.5~0.7；
(4) bacterium solution obtained by step (3) is immediately placed in mixture of ice and water cooling 20min after 42 DEG C of culture 15min；
(5) bacterium solution obtained by 50mL step (4) is taken, 10min is centrifuged in 4 DEG C of 4500 × g, removes supernatant；
(6) with pre-cooling ultrapure water cleaning step (5) bacterial sediment repeatedly on ice；
(7) ultrapure water is added into thallus obtained by step (6), bacterium solution is settled to 500 μ l, every 100 μ l of pipe is dispensed to pre-cooling EP pipe obtains GS1783-pBAC-DPV- Δ gE electricity and turns competence；
(8) turn that 200ng I_SceI-Kana-gI target practice segment is added in competence in 100 μ l electricity, by competence after mixing The electric shock bottom of a cup portion of 2mm pre-cooling is added together with target practice segment, shocks by electricity under the conditions of 15kV/cm；
(9) it takes 100 μ l LB liquid mediums that thallus after electric shock is resuspended, after 30 DEG C are shaken bacterium 1h, is centrifuged thallus in 4500 × g 2min abandons supernatant, and 200 μ l LB liquid mediums, which suspend, to be precipitated, and is coated on containing kanamycin and chloramphenicol twin antibiotic resistance LB solid medium, in 30 DEG C of culture 48h；
(10) single colonie obtained by PCR authentication step (9) obtains positive bacterium colony GS178-pBAC-DPV- Δ gE-gI-Kana, Using the single colonie re-suspension liquid grown in step (9) as template, amplification I_SceI-Kana-gI target practice segment upstream primer is utilized GS1783-BAC- Δ gI-F and identification gE downstream of gene primer gI-R identify positive bacterium colony；
GS1783-BAC-ΔgI-F:5’-GTGCGCCATATAGACGATATATTGAGTTTCAAAAATAGAAtagggat Aacagggtaatcgattt-3 (SEQ ID NO:5)
GI-R:5 '-GACCGGTAGTTCCAATCACT-3 ' (SEQ ID NO:7)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object GS1783-BAC- Δ gI-F, 1 μ l of downstream primer gI-R, 1 μ l of template；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
7, remove I_SceI-Kana segment
(1) picking GS1783-pBAC-DPV- Δ gE-gI-Kana single colonie is inoculated in LB liquid training of the 2mL containing chloramphenicol It supports in base, 30 DEG C of overnight incubations, obtains seed liquor；
(2) seed liquor obtained by 10 μ l steps (1) is taken to be inoculated in LB liquid medium of the 2mL containing chloramphenicol, 30 DEG C of cultures Slight cloud is presented to bacterium solution in 2h；
(3) LB liquid medium and 5M final concentration of 2% of the 1mL containing chloramphenicol is added into bacterium solution obtained by step (2) L-arabinose, 30 DEG C of culture 1h；
(4) bacterium solution obtained by step (3) is immediately placed in 42 DEG C of water-baths and cultivates 30min；
(5) after bacterium solution obtained by step (4) being placed in 30 DEG C of culture 2h, take 1 μ l bacterium solution that 200 μ l LB liquid mediums are added The LB solid medium containing chloramphenicol, 30 DEG C of culture for 24 hours~48h are applied to after middle mixing；
(6) gained single colonie is containing chloramphenicol and the Double LB solid medium of Ka Na mycin and chlorine in picking step (5) Parllel screening is carried out on mycin monoclonal antibody LB solid medium, chloramphenicol and the Double LB solid medium of Ka Na mycin are not given birth to It is long, the bacterium colony of chloramphenicol monoclonal antibody LB solid culture basal growth by PCR method using gI upstream region of gene identify primer gI-F and GE downstream of gene identification primer gE-R is identified, positive clone molecule GS1783-pBAC-DPV- Δ gE+ Δ gI is obtained.
GI-F:5 '-TGTGGGTGGGTCATCTACAT-3 ' (SEQ ID NO:14)
GE-R:5 '-AGCGAGTACTTCTCTGCGTC-3 ' (SEQ ID NO:3)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object gE-F, 1 μ l of downstream primer gE-R, template are 1 μ l of step (6) single colonie re-suspension liquid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
8, I_SceI-Kana-MiniF segment is expanded
(1) Escherichia coli of the recovery with pEPkan-S plasmid are in LB solid medium containing kanamycin, and 37 DEG C Overnight incubation；It chooses single colonie to be inoculated in LB liquid medium containing kanamycin, 37 DEG C of overnight incubations, plasmid is small to mention reagent Box extracts pEPkan-S plasmid；
(2) using pEPkan-S plasmid as template, GS1783-MiniF-F and GS1783-MiniF-R are primer, expand I_ SceI-Kana-MiniF target practice segment, plain agar sugar gel DNA QIAquick Gel Extraction Kit recycle amplified fragments；
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTC ATGATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3 ' (SEQ ID NO:8)
GS1783-MiniF-R:5’-ATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTAT Tagggataacagggtaatcgat-3 ' (SEQ ID NO:9)
PCR amplification system be 22 μ l of ddH2O,25 μ l of Max DNA Polymerase, upstream primer 1 μ l of GS1783-MiniF-F, 1 μ l of downstream primer GS1783-MiniF-R, 1 μ l of template pEPkan-S plasmid；
PCR amplification condition is 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 Circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
9, UL23-MiniF segment is expanded
(1) it prepares duck embryo fibroblasts (DEF) and is inoculated in 25T cell bottle, 37 DEG C, after 5%CO2 culture for 24 hours, inoculation 5MOI DPV CHv, 37 DEG C, harvest is viral after 5%CO2 cultivates 48h, after multigelation 2 times, according to TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 specification extracts DPV CHv genome；
(2) DPV CHv genome is template, and CHv-UL23-F and CHv-UL23-R are primer, and amplification UL23-MiniF is beaten Target segment, plain agar sugar gel DNA QIAquick Gel Extraction Kit recycle amplified fragments；
CHv-UL23-F:5’-GCCTGCAAGCGGTAACGAAAACGATtcaattaattgtcatctcgg-3’(SEQ ID NO:10)
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCAT ATTCAACGGACATATTAAAAATTGA-3 ' (SEQ ID NO:11)
PCR amplification system is ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream primer 1 μ l of CHv-UL23-F, 1 μ l of downstream primer CHv-UL23-R, 1 μ l of template DPV CHv genome；
PCR amplification condition is 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 Circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
10, it merges I_SceI-Kana-MiniF segment and UL23-MiniF segment obtains I_SceI-Kana-MiniF- UL23 target practice segment
(1) using I_SceI-Kana-MiniF segment and UL23-MiniF segment as template, I_SceI-Kana- is merged MiniF segment and UL23-MiniF segment；
Fusion system are as follows: ddH2O 8μl、10 μ l of Max DNA Polymerase, template I_SceI- Kana-MiniF segment and each 1 μ l of UL23-MiniF segment；
Fusion conditions are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 55 DEG C of annealing 5s, 72 DEG C of extension 1min, totally 5 are followed Ring.
(2) primer GS1783-MiniF-F and CHv-UL23-R are added into the resulting fusion template of step (1), expands I_ SceI-Kana-MiniF-UL23 target practice segment, plain agar sugar gel DNA QIAquick Gel Extraction Kit recycle amplified fragments；
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTC ATGATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3 ' (SEQ ID NO:8)
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCAT ATTCAACGGACATATTAAAAATTGA-3 ' (SEQ ID NO:11)
PCR amplification system are as follows: fusion 20 μ l of template, 0.5 μ l of upstream primer GS1783-MiniF-F, downstream primer CHv- UL23-R 0.5μl；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
The behaviour that MiniF element is lacked using Red-Based modification technique and intracellular spontaneous homologous recombination technique Fig. 3 is seen as flow chart, and detailed process includes following 11,12 and 13.
11, preparation GS1783-pBAC-DPV- Δ gE+ Δ gI electricity turns competence and carries out target practice segment target practice
(1) recovery GS1783-pBAC-DPV- Δ gE+ Δ gI freezes bacterium in the LB solid medium containing chloramphenicol, and 30 DEG C overnight incubation；
(2) picking GS1783-pBAC-DPV- Δ gE+ Δ gI single colonie is inoculated in LB liquid medium of the 5mL containing chloramphenicol In, 30 DEG C of overnight incubations obtain seed liquor；
(3) 5mL seed liquor is added in LB liquid medium of the 100mL containing chloramphenicol, is shaken in 30 DEG C to OD600Value is 0.5 Between~0.7；
(4) bacterium solution obtained by step (3) is immediately placed in mixture of ice and water cooling 20min after 42 DEG C of culture 15min；
(5) bacterium solution obtained by 50mL step (4) is taken, 10min is centrifuged in 4 DEG C of 4500 × g, removes supernatant；
(6) with pre-cooling ultrapure water bacterial sediment obtained by cleaning step (5) repeatedly on ice；
(7) ultrapure water is added, bacterium solution obtained by step (6) is settled to 500 μ l, every 100 μ l of pipe is dispensed to pre-cooling EP pipe, obtained It obtains GS1783-pBAC-DPV- Δ gE+ Δ gI electricity and turns competence；
(8) turn that 200ng I_SceI-Kana-MiniF-UL23 target practice segment is added in competence in 100 μ l electricity, after mixing Competence and target practice segment are added to the electric shock bottom of a cup portion of 2mm pre-cooling together, shocked by electricity under the conditions of 15kV/cm；
(9) 100 μ l LB liquid mediums are added and thallus after electric shock is resuspended, after 30 DEG C are shaken bacterium 1h, 4500 × g is centrifuged thallus 2min abandons supernatant, and 200 μ l LB liquid mediums, which suspend, to be precipitated, and is coated with containing kanamycin and chloramphenicol twin antibiotic resistance LB solid medium, in 30 DEG C of culture 48h；
(10) single colonie obtained by PCR authentication step (9) obtains positive bacterium colony GS1783-pBAC-DPV- Δ gE+ Δ gI- UL23-Kana is reflected using the single colonie re-suspension liquid grown in step (9) as template using identification primer MiniF-F and MiniF-R Fixed positive bacterium colony；
MiniF-F:5 '-GTTATCCACTGAGAAGCGAACG-3 ' (SEQ ID NO:12)
MiniF-R:5 '-GGCTGTAAAAGGACAGACCACA-3 ' (SEQ ID NO:13)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object MiniF-F, 1 μ l of downstream primer MiniF-R, template are 1 μ l of step (9) single colonie re-suspension liquid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 15s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
12, remove I_SceI-Kana segment
(1) picking GS1783-pBAC-DPV- Δ gE+ Δ gI-UL23-Kana single colonie is inoculated in LB of the 2mL containing chloramphenicol In fluid nutrient medium, 30 DEG C of overnight incubations obtain seed liquor；
(2) seed liquor obtained by 10 μ l steps (1) is taken to be inoculated in LB liquid medium of the 2mL containing chloramphenicol, 30 DEG C of cultures Slight cloud is presented to bacterium solution in 2h；
(3) LB liquid medium and 5M final concentration of 2% of the 1mL containing chloramphenicol is added into bacterium solution obtained by step (2) 30 DEG C of L-arabinose, cultivate 1h；
(4) bacterium solution obtained by step (3) is immediately placed in 42 DEG C of water-baths and cultivates 30min；
(5) after bacterium solution obtained by step (4) being placed in 30 DEG C of culture 2h, take 1 μ l bacterium solution that 200 μ l LB liquid mediums are added The LB solid medium containing chloramphenicol, 30 DEG C of culture for 24 hours~48h are applied to after middle mixing；
(6) gained single colonie is containing chloramphenicol and the Double LB solid medium of Ka Na mycin and chlorine in picking step (5) Parllel screening is carried out on mycin monoclonal antibody LB solid medium, chloramphenicol and the Double LB solid medium of Ka Na mycin are not given birth to Long, the bacterium colony of chloramphenicol monoclonal antibody LB solid culture basal growth is identified by PCR method using MiniF identified for genes primer, is obtained Obtain positive clone molecule GS1783-pBAC-DPV- Δ gE+ Δ gI-UL23.
MiniF-F:5 '-GTTATCCACTGAGAAGCGAACG-3 ' (SEQ ID NO:12)
MiniF-R:5 '-GGCTGTAAAAGGACAGACCACA-3 ' (SEQ ID NO:13)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object MiniF-F, 1 μ l of downstream primer MiniF-R, template are 1 μ l of step (6) single colonie re-suspension liquid；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
13, rescue DPV CHv- Δ gE+ Δ gI virus
(1) recovery GS1783-pBAC-DPV- Δ gE+ Δ gI-UL23 freezes bacterium in the LB solid medium containing chloramphenicol In, 30 DEG C of overnight incubations；
(2) pBAC-DPV- Δ gE+ Δ gI-UL23 matter is extracted according to QIAGEN Plasmid Midi Kit operating instruction Grain；
(3) it prepares duck embryo fibroblasts (DEF) and is inoculated in 12 orifice plates, 37 DEG C, 5%CO2After culture for 24 hours, according to 3000 operating instruction of Lipofectamine transfects pBAC-DPV- Δ gE+ Δ gI-UL23 plasmid, observes fluorescent spot after 96h, receives Collection is viral, is inoculated in the 6 orifice plates for covering with DEF after multigelation 2 times；
(4) step (3) are repeated three times；
(5) after viral multigelation 2 times that step (4) obtains, 10 times of doubling dilutions are inoculated in the 6 orifice plates for covering with DEF In, 37 DEG C, 5%CO2After being incubated for 2h, abandoning Incubating Solution, the fixed cell of 1% methylcellulose of addition, 37 DEG C, 5%CO2Cultivate 120h Afterwards, picking unstressed configuration sick cell is reinoculated in DEF after multigelation 2 times, obtains DPV CHv- Δ gE+ Δ gI-Q；
(6) it is extracted according to TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 specification DPV CHv- Δ gE+ Δ gI-Q viral genome identifies primer MiniF-F and MiniF-R using MiniF, identifies missing MiniF element, final obtain remains without MiniF element, without the remaining seamless deleted virus strain DPV of base at missing gene CHv- Δ gE+ Δ gI positive-virus strain, is shown in Fig. 4.
MiniF-F:5 '-GTTATCCACTGAGAAGCGAACG-3 ' (SEQ ID NO:12)
MiniF-R:5 '-GGCTGTAAAAGGACAGACCACA-3 ' (SEQ ID NO:13)
PCR amplification system are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, upstream are drawn 1 μ l of object MiniF-F, 1 μ l of downstream primer MiniF-R, template are the DPV CHv- Δ gE+ Δ gI-Q virus that step (6) are extracted 1 μ l of genome；
PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 A circulation, last 72 DEG C of extensions 10min are saved in 16 DEG C.
The seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of embodiment 2 is inoculated with the detection after 7 age in days ducks to viral load
GE, gI gene and the seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of MiniF element is thin with 0.01MOI inoculation DEF Born of the same parents, 120h collects cell after connecing poison, multigelation 2 times, measures TCID50Afterwards, 2MOI DPV CHv- Δ gE+ Δ gI missing disease is taken Malicious 7 age in days duck of intramuscular inoculation, respectively at for 24 hours, 48h, 72h, 96h acquisition duck blood, liver and spleen, according to TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 specification extracts each tissue DNA.Utilize identification primer GE-F and gI-R PCR detection attacks after poison whether 48h duck liver virus is gE gene and gI Gene Double deleted virus (see Fig. 5), Identify primer and Taq probe using UL30QPCR, QPCR detect different time points blood, viral load in liver and spleen (see Fig. 6).The result shows that can be detected in blood, liver and spleen after DPV CHv- Δ gE+ Δ gI inoculation duck；Blood, liver The trend for being first incremented by and cutting down afterwards is presented in dirty middle DPV CHv- Δ gE+ Δ gI virion quantity；DPV CHv- Δ gE+ in spleen The trend gradually cut down is presented in Δ gI virion quantity；DPV CHv- Δ gE+ Δ gI virion quantity is lower than liver in blood Dirty and spleen tissue；Liver organization DPV CHv- Δ gE+ Δ gI virion quantity in 48h reach highest and spleen tissue in Reach highest for 24 hours.
In addition, present invention gene-deleted strain DPV CHv- Δ gE+ Δ gI also seamless to duck plague virus gE, gI gene done it is hereditary steady Qualitative experiment, safety experiment and immunogenicity experiments.
Genetic stability: the seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE, gI gene is uploaded in DEF cell In 20 generations of generation, there is lesion plaque, show the seamless gene-deleted strain DPV CHv- Δ gE+ Δ of duck plague virus gE, gI gene obtained GI stablizes heredity in DEF.
Safety: 15 4 week old DPV negative antibodies and PCR are detected into negative duck, are randomly divided into 3 groups, every group 5.1st Group intramuscular injection DPV CHv- Δ gE+ Δ gI, the 2nd group of intramuscular injection parental virus DPV CHv, every injecting virus in two groups Malicious valence is identical, the MEM of the meterings such as the 3rd group of injection, and as a control group, every group of independent isolated rearing, observation, record morbidity daily is extremely Die situation.As can be seen from the results, injection has the duck of parental virus all dead, and injecting has DPV CHv- Δ gE+ Δ gI and right According to the duck in group without death, illustrate that DPV CHv- Δ gE+ Δ gI safety is good.
Immunogenicity: 10 4 week old DPV negative antibodies and PCR are detected into negative duck, are randomly divided into 2 groups, every group 5.The 1 group of intramuscular injection DPV CHv- Δ gE+ Δ gI, the 2nd group of isodose MEM of injection, as a control group, every group is individually isolated feeding It supports.14 days after immune, leg muscle injection inoculation DPV CHv is virulent, observes and records condition of morbidity death.It can by result Know, attack malicious 100% death of control group, immune group 100% is protected, and illustrates that DPV CHv- Δ gE+ Δ gI has good immunogene Property.
Sequence table
<110>Sichuan Agricultural University
<120>the dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI and its construction method
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 64
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atactgccgg ccagactacg gaacctcaac aattggtacg tagggataac agggtaatcg 60
attt 64
<210> 2
<211> 98
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
taactatttc actagtgagt cattagttca acatccatga cgtaccaatt gttgaggttc 60
cgtagtctgg ccggcagtat gccagtgtta caaccaat 98
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
agcgagtact tctctgcgtc 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
tctcaagacg ctctggaatc 20
<210> 5
<211> 64
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gtgcgccata tagacgatat attgagtttc aaaaatagaa tagggataac agggtaatcg 60
attt 64
<210> 6
<211> 98
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
tcataacaaa aacatttact tttagtcata ctgatgtgaa ttctattttt gaaactcaat 60
atatcgtcta tatggcgcac gccagtgtta caaccaat 98
<210> 7
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
gaccggtagt tccaatcact 20
<210> 8
<211> 98
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
ttattaatct caggagcctg tgtagcgttt ataggaagta gtgttctgtc atgatgcctg 60
caagcggtaa cgaaaacgat tgttacaacc aattaacc 98
<210> 9
<211> 72
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
atcgttttcg ttaccgcttg caggcatcat gacagaacac tacttcctat tagggataac 60
agggtaatcg at 72
<210> 10
<211> 45
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
gcctgcaagc ggtaacgaaa acgattcaat taattgtcat ctcgg 45
<210> 11
<211> 79
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
ccgctccact tcaacgtaac accgcacgaa gatttctatt gttcctgaag gcatattcaa 60
cggacatatt aaaaattga 79
<210> 12
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
gttatccact gagaagcgaa cg 22
<210> 13
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
ggctgtaaaa ggacagacca ca 22
<210> 14
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
tgtgggtggg tcatctacat 20

Claims (10)

1. the dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI, it is preserved on July 4th, 2018 State's Type Tissue Collection, deposit number are CCTCC NO:V201841.
2. the building of the dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI as described in claim 1 Method, which comprises the following steps:
(1) pBAC-DPV plasmid is transformed into GS1783 E. coli competent, obtains GS1783-pBAC-DPV bacterial strain, so After prepare GS1783-pBAC-DPV competence；
(2) using pEPkan-S as template, using GS1783-BAC- Δ gE-F and GS1783-BAC- Δ gE-R as primer, pass through Base fragment and gE upstream region of gene and downstream each 40bp of the PCR method amplification comprising I_SceI restriction enzyme site and Kana element are same The target practice segment I_SceI-Kana-gE of source arm, gel extraction obtain I_SceI-Kana-gE segment；
(3) I_SceI-Kana-gE segment is transformed into GS1783-pBAC-DPV competence, is screened, obtain positive clone molecule GS1783-pBAC-DPV-gE-Kana；
(4) the I_SceI-Kana segment in positive clone molecule GS1783-pBAC-DPV-gE-Kana is removed, prepares GS1783- PBAC-DPV- Δ gE competence；
(5) using pEPkan-S as template, using GS1783-BAC- Δ gI-F and GS1783-BAC- Δ gI-R as primer, pass through Base fragment and gI upstream region of gene and downstream each 40bp of the PCR method amplification comprising I_SceI restriction enzyme site and Kana element are same The target practice segment I_SceI-Kana-gI of source arm, gel extraction obtain I_SceI-Kana-gI segment；
(6) I_SceI-Kana-gI segment is transformed into GS1783-pBAC-DPV- Δ gE competence, through antibiotic-screening and PCR identification, obtains positive clone molecule GS1783-pBAC-DPV- Δ gE-gI-Kana；
(7) the I_SceI-Kana segment in positive clone molecule GS1783-pBAC-DPV- Δ gE-gI-Kana is removed, prepares GS1783-pBAC-DPV- Δ gE+ Δ gI competence；
(8) using pEPkan-S as template, using GS1783-MiniF-F and GS1783-MiniF-R as primer, pass through PCR method Base fragment of the amplification comprising I_SceI restriction enzyme site and Kana element, be located at MiniF element ori2 downstream of gene 240bp and Homology arm segment I_SceI-Kana-MiniF at MiniF element ori2 downstream of gene 290bp, gel extraction obtain I_ SceI-Kana-MiniF segment；
(9) using CHv genome as template, using CHv-UL23-F and CHv-UL23-R as primer, include by PCR method amplification UL23 gene, the downstream I_SceI-Kana-MiniF homology arm are overlapped 25bp and are located at MiniF element ori2 downstream of gene 180bp The homology arm segment at place, gel extraction obtain UL23-MiniF segment；
(10) using I_SceI-Kana-MiniF segment and UL23-MiniF segment as template, carry out PCR fusion reaction, then with Fusion segment is template, and PCR amplification is carried out using GS1783-MiniF-F and CHv-UL23-R as primer and obtains I_SceI- Kana-MiniF-UL23 target practice segment；
(11) I_SceI-Kana-MiniF-UL23 target practice segment is transformed into GS1783-pBAC-DPV- Δ gE+ Δ gI competence In, it is identified through antibiotic-screening and PCR, obtains positive clone molecule GS1783-pBAC-DPV- Δ gE+ Δ gI-UL23-Kana；
(12) the I_SceI-Kana segment in positive clone molecule GS1783-pBAC-DPV- Δ gE+ Δ gI-UL23-Kana is gone Fall, obtains positive clone molecule GS1783-pBAC-DPV- Δ gE+ Δ gI-UL23；
(13) pBAC-DPV- Δ gE+ Δ gI- is extracted from positive clone molecule GS1783-pBAC-DPV- Δ gE+ Δ gI-UL23 PBAC-DPV- Δ gE+ Δ gI-UL23 plasmid transfection DEF cell it is biradical to be obtained gE and gI by colony screening by UL23 plasmid Because of seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI.
3. the structure of the dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI according to claim 2 Construction method, which is characterized in that PCR amplification system in step (2), step (5), step (8) and step (9) are as follows: ddH2O 22μl、25 μ l of Max DNA Polymerase, 1 μ l of upstream primer, 1 μ l of downstream primer, 1 μ l of template；PCR amplification Condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 recycle, and last 72 DEG C Extend 10min.
4. the dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI's of duck plague virus gE and gI according to claim 2 or 3 Construction method, which is characterized in that primer sequence in step (2) are as follows:
GS1783-BAC-ΔgE-F:5’-ATACTGCCGGCCAGACTACGGAACCTCAACAATTGGTACGtagggataaca gggtaatcgattt-3'；
GS1783-BAC-ΔgE-R:5’-TAACTATTTCACTAGTGAGTCATTAGTTCAACATCCATGACGTACCAATTG TTGAGGTTCCGTAGTCTGGCCGGCAGTATgccagtgttacaaccaat-3’。
5. the dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI's of duck plague virus gE and gI according to claim 2 or 3 Construction method, which is characterized in that primer sequence in step (5) are as follows:
GS1783-BAC-ΔgI-F:5’-GTGCGCCATATAGACGATATATTGAGTTTCAAAAATAGAAtagggataaca gggtaatcgattt-3'；
GS1783-BAC-ΔgI-R:5’-TCATAACAAAAACATTTACTTTTAGTCATACTGATGTGAATTCTATTTTTG AAACTCAATATATCGTCTATATGGCGCACgccagtgttacaaccaat-3’。
6. the dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI's of duck plague virus gE and gI according to claim 2 or 3 Construction method, which is characterized in that primer sequence in step (8) are as follows:
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGA TGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3'；
GS1783-MiniF-R:5’-ATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTATtagg gataacagggtaatcgat-3’。
7. the dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI's of duck plague virus gE and gI according to claim 2 or 3 Construction method, which is characterized in that primer sequence in step (9) are as follows:
CHv-UL23-F:5'-GCCTGCAAGCGGTAACGAAAACGATtcaattaattgtcatctcgg-3'；
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCATATTC AACGGACATATTAAAAATTGA-3’。
8. the structure of the dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI according to claim 2 Construction method, which is characterized in that primer sequence in step (10) are as follows:
GS1783-MiniF-F:5’-TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGA TGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3'；
CHv-UL23-R:5’-CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGGCATATTC AACGGACATATTAAAAATTGA-3’。
9. the dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI's of duck plague virus gE and gI according to claim 2 or 8 Construction method, which is characterized in that PCR fusion system in step (10) are as follows: ddH2O8μl、Max DNA 10 μ l of Polymerase, template I_SceI-Kana-MiniF segment and each 1 μ l of UL23-MiniF segment；PCR fusion conditions are as follows: 95 DEG C of initial denaturation 5min, 95 DEG C of denaturation 15s, 55 DEG C of annealing 5s, 72 DEG C of extension 1min, totally 5 recycle.
10. the dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI according to claim 2 or 8 Construction method, which is characterized in that PCR amplification system in step (10) are as follows: fusion 20 μ l of template, upstream primer GS1783- 0.5 μ l of MiniF-F, 0.5 μ l of downstream primer CHv-UL23-R；PCR amplification condition are as follows: 98 DEG C of initial denaturation 2min, 98 DEG C of denaturation 10s, 55 DEG C of annealing 15s, 72 DEG C of extension 5s, totally 30 recycle, last 72 DEG C of extensions 10min.
CN201811599537.9A 2018-12-26 2018-12-26 Duck plague virus gE and gI double-gene traceless deleted strain DPV CHv-delta gE + delta gI and construction method thereof Active CN109536463B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201811599537.9A CN109536463B (en) 2018-12-26 2018-12-26 Duck plague virus gE and gI double-gene traceless deleted strain DPV CHv-delta gE + delta gI and construction method thereof
PCT/CN2019/125291 WO2020135108A1 (en) 2018-12-26 2019-12-13 Duck plague virus ge and gi dual-gene traceless deletion strain dpv chv-delta ge + delta gi and construction method therefor

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811599537.9A CN109536463B (en) 2018-12-26 2018-12-26 Duck plague virus gE and gI double-gene traceless deleted strain DPV CHv-delta gE + delta gI and construction method thereof

Publications (2)

Publication Number Publication Date
CN109536463A true CN109536463A (en) 2019-03-29
CN109536463B CN109536463B (en) 2022-06-17

Family

ID=65857831

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811599537.9A Active CN109536463B (en) 2018-12-26 2018-12-26 Duck plague virus gE and gI double-gene traceless deleted strain DPV CHv-delta gE + delta gI and construction method thereof

Country Status (2)

Country Link
CN (1) CN109536463B (en)
WO (1) WO2020135108A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020135108A1 (en) * 2018-12-26 2020-07-02 四川农业大学 Duck plague virus ge and gi dual-gene traceless deletion strain dpv chv-delta ge + delta gi and construction method therefor
CN113388585A (en) * 2021-06-10 2021-09-14 江苏农牧科技职业学院 High-titer phage culture method and application
CN116731982A (en) * 2023-08-08 2023-09-12 华南农业大学 Duck plague herpesvirus gene deletion attenuated vaccine strain, construction method and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104480142A (en) * 2014-12-16 2015-04-01 青岛蔚蓝生物股份有限公司 Duck plague virus gene deletion transfer vector and application thereof
CN105385663A (en) * 2015-11-26 2016-03-09 中国兽医药品监察所 Establishment of duck enteritis virus gE and gI double gene deletion virus strain and application of establishment
CN105802922A (en) * 2016-04-19 2016-07-27 四川农业大学 Establishing method of bacterial artificial chromosome recombinant duck plague virus rescue system platform and application

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109536463B (en) * 2018-12-26 2022-06-17 四川农业大学 Duck plague virus gE and gI double-gene traceless deleted strain DPV CHv-delta gE + delta gI and construction method thereof
CN109628417A (en) * 2018-12-26 2019-04-16 四川农业大学 The dual-gene seamless gene-deleted strain CHv-BAC-G- Δ gE+ Δ gI of duck plague virus gE and gI and its construction method

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104480142A (en) * 2014-12-16 2015-04-01 青岛蔚蓝生物股份有限公司 Duck plague virus gene deletion transfer vector and application thereof
CN105385663A (en) * 2015-11-26 2016-03-09 中国兽医药品监察所 Establishment of duck enteritis virus gE and gI double gene deletion virus strain and application of establishment
CN105802922A (en) * 2016-04-19 2016-07-27 四川农业大学 Establishing method of bacterial artificial chromosome recombinant duck plague virus rescue system platform and application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ISHIHARA, Y等: "Removal of Inserted BAC after linearizatiON (RIBON)-a novel stra", 《JOURNAL OF VETERINARY MEDICAL SCIENCE》 *
陈柳等: "DEV囊膜糖蛋白gI基因缺失病毒生物学特性研究", 《浙江畜牧兽医》 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020135108A1 (en) * 2018-12-26 2020-07-02 四川农业大学 Duck plague virus ge and gi dual-gene traceless deletion strain dpv chv-delta ge + delta gi and construction method therefor
CN113388585A (en) * 2021-06-10 2021-09-14 江苏农牧科技职业学院 High-titer phage culture method and application
CN113388585B (en) * 2021-06-10 2024-05-14 江苏农牧科技职业学院 Phage high-titer culture method and application
CN116731982A (en) * 2023-08-08 2023-09-12 华南农业大学 Duck plague herpesvirus gene deletion attenuated vaccine strain, construction method and application thereof
CN116731982B (en) * 2023-08-08 2023-10-20 华南农业大学 Duck plague herpesvirus gene deletion attenuated vaccine strain, construction method and application thereof

Also Published As

Publication number Publication date
CN109536463B (en) 2022-06-17
WO2020135108A8 (en) 2020-09-10
WO2020135108A1 (en) 2020-07-02

Similar Documents

Publication Publication Date Title
CN112080521B (en) Recombinant pseudorabies virus vector construction for expressing foreign protein and preparation method of recombinant pseudorabies virus
CN109536463A (en) The dual-gene seamless gene-deleted strain DPV CHv- Δ gE+ Δ gI of duck plague virus gE and gI and its construction method
CN110079541A (en) A kind of method and its application of building coronavirus infectivity clone
CN114164184B (en) Newcastle disease virus gene VI vaccine strain and application thereof
CN103436478A (en) Salmonella enteritidis double knockout attenuated mutant and preparation as well as application thereof
CN110295183A (en) A method of citrus is improved to canker resistance based on CsPrx25 overexpression
CN109576295A (en) A kind of duck plague virus removes MiniF element gC gene-deleted strain DPV CHv- Δ gC and its construction method
CN109705223B (en) Recombinant subunit vaccine of orf virus and production method thereof
CN116948975A (en) IFNAR1 gene knockout MDCK cell strain, construction method and application thereof
CN109628417A (en) The dual-gene seamless gene-deleted strain CHv-BAC-G- Δ gE+ Δ gI of duck plague virus gE and gI and its construction method
CN114107304B (en) Recombinant coccidium vector for expressing alpha toxin protein and fluorescent tag protein and detection method thereof
CN109609548A (en) The seamless gene-deleted strain DPV CHv- Δ gI of duck plague virus gI gene and its construction method
CN109593732A (en) The seamless gene-deleted strain DPV CHv- Δ gE of duck plague virus gE gene and its construction method
CN109486774A (en) The seamless gene-deleted strain DPV CHv-gE Δ CT in the region duck plague virus gE gene C T and its construction method
CN109486772A (en) The seamless gene-deleted strain DPV CHv-gE Δ ET in the region duck plague virus gE gene ET and its construction method
CN108754019B (en) Amplification method of porcine epidemic diarrhea virus ORF1 gene complete sequence
CN109593730A (en) The seamless gene-deleted strain DPV CHv- Δ Lorf5 of duck plague virus Lorf5 gene and its construction method
CN109576293A (en) The seamless gene-deleted strain CHv-BAC-G-gE Δ ET in the region duck plague virus gE gene ET and its construction method
CN109486773A (en) The seamless gene-deleted strain CHv-BAC-G-gE Δ CT in the region duck plague virus gE gene C T and its construction method
CN108728477A (en) A kind of efficient Transpositional mutation system and construction method
CN108754616B (en) Pseudorabies virus genome Fosmid library, construction method and application thereof in constructing mutant
CN109609547A (en) The seamless gene-deleted strain CHv-BAC-G- Δ Lorf5 of duck plague virus Lorf5 gene and its construction method
CN109593731A (en) The seamless gene-deleted strain CHv-BAC-G- Δ gI of duck plague virus gI gene and its construction method
CN109576294A (en) The seamless gene-deleted strain CHv-BAC-G- Δ gE of duck plague virus gE gene and its construction method
CN109609550A (en) A kind of seamless gene-deleted strain DPV CHv- Δ UL41 of duck plague virus UL41 gene and its construction method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant