CN105695423B

CN105695423B - Express the strain of recombination chicken Marek's disease virus vaccine and its construction method and application of infectious bursal disease virus VP 2 gene

Info

Publication number: CN105695423B
Application number: CN201610147339.3A
Authority: CN
Inventors: 王笑梅; 李凯; 刘长军; 张艳萍; 崔红玉; 祁小乐; 高立; 高玉龙; 王永强; 高宏雷
Original assignee: Harbin Veterinary Research Institute of CAAS
Current assignee: Harbin Veterinary Research Institute of CAAS
Priority date: 2016-03-15
Filing date: 2016-03-15
Publication date: 2018-04-27
Anticipated expiration: 2036-03-15
Also published as: CN105695423A

Abstract

The invention discloses a kind of strain of recombination chicken Marek's disease virus vaccine and its construction method and application for expressing infectious bursal disease virus VP 2 gene, belong to medicine or veterinary science technical field.The present invention utilizes recombinant clone technology, genetic fragment CAG VP2 comprising infectious bursal disease virus VP 2 gene and CAG promoter sequences are inserted into the US2 gene internals of 814 plants of chicken Marek's disease virus attenuated vaccine, structure obtains the recombinant cosmid in US2 gene internals insertion CAG VP2 expression cassettes, and the recombination chicken Marek's disease virus vaccine strain of expression infectious bursal disease virus VP 2 gene is obtained by its rescue.Research shows, the vaccine strain that the present invention obtains have with the malicious equal replicative capacity ira vitro of 814 vaccine strains of parent and good genetic stability, and the attack of MDV highly virulent strains and IBDV highly virulent strains can be resisted at the same time.It can be seen from the above that the recombinant mdv vaccine strain for the expression IBDV VP2 genes that the present invention obtains can be used for preparing prevention or the medicine for the treatment of gumboro disease and chicken Marek's disease.

Description

Express the recombination chicken marek's disease virus epidemic disease of infectious bursal disease virus VP 2 gene Seedling strain and its construction method and application

Technical field

The present invention relates to a kind of recombination chicken Marek's disease virus vaccine strain and its construction method and application, more particularly to one The strain of recombination chicken Marek's disease virus vaccine and its construction method and application of kind expression infectious bursal disease virus VP 2 gene, The invention belongs to medicine or veterinary science technical field.

Background technology

China is a Ge Yang fowl big country.Bursal Disease and Marek's disease are to endanger China's aviculture health hair Two kinds of mostly important immunosupress sexually transmitted diseases of exhibition, it, which is widely current, brings huge economic damage to China's aviculture Lose.

Bursal Disease (IBD) is a kind of main harm 3- as caused by infectious bursal disease virus (IBDV) Acute, the highly contagious disease of 6 week old chick.This disease is starting in U.S. Gumboro areas in nineteen fifty-seven, is referred to as " sweet Cloth sieve disease "；Reported first in 1962 by Cosgrove, the serious enlargement of the kidney due to dying of the sick chicken, also referred to as " fowl nephrosis ".Over 60 years, which threatens the development of aviculture always.Antigenic variation, immunosupress, particularly highly virulent strain (vvIBDV) appearance so that the sick prevention and control situation is more acute.World Organization for Animal Health (OIE) thinks that IBD has become influence The important diseases of social economy.IBDV genomes are made of two Double-stranded RNA segments, are respectively A segments and B segments.Compile A segments The VP2 albumen of code forms the outer capsid of virus, is the major structural protein of IBDV.VP2 can induce body to produce neutralizing antibody, It is the main host protective antigens of IBDV (Heine H G, Boyle, D B.Infectious bursal disease virus structural protein VP2expressed by a fowlpox virus recombinant confers protection against disease in chickens.Arch Virol,1993,131:277-292.).Vaccine immunity It is the main means of prevention and control vvIBDV, but vvIBDV is pathogenic strong and is not suitable with cell culture, and the acquisition of vaccine strain can only pass through By wild vvIBDV in chicken embryo or CEF cells Attenuation.This traditional acclimation method is time-consuming and laborious, and result carry with Machine (Gao L, Qi X, Li K, Gao H, Gao Y, Qin L, Wang Y, Wang X.Development of a tailored vaccine against challenge with very virulent infectious bursal disease virus of chickens using reverse genetics.Vaccine 2011,29:5550-5557.)。 For highly pathogenicity, the prevention and control of the prevention and control of vvIBDV, particularly SARS Epidemic that easily make a variation, carry out the quick structure of new generation vaccine It is extremely urgent to build research.

Marek's disease (MD) is the infectiousness neoplastic disease of a breeder as caused by marek's disease virus (MDV), with leaching Bar hyperblastosis and tumour, which are formed, to be characterized.Marek's disease is one of principal disease of chicken, and both at home and abroad since the fifties Most valued chicken disease.MDV belongs to Alphaherpesviridae Marek's disease sample Tobamovirus, is a kind of cell-associated blister sore Poison, its genome are wire distrand DNA, about 180kb.MDV at least encodes 103 protein, but most of albumen are not yet Identified.MDV includes three kinds of serotypes, and serum 1 type virus has oncogenicity, can be further divided into several pathotypes, including Mild MDV (mMDV), strong poison type MDV (vMDV), ultra-intense virus type MDV (vvMDV) and spy ultra-intense virus type MDV (vv+MDV) viruses Strain.Non- the oncogenic virus separation strains and herpes turkey virus separation strains of chicken are referred to as 2 type of serum and 3 type MDV.Currently used for pre- The vaccine of anti-MD is mainly serum 1 type attenuated vaccine, and common vaccine strain has the CVI988 strains of Holland and 814 vaccines in China Strain.Wherein, 814 vaccine strain characters are stablized, and are one plant of Natural Avirulent Strains, the vaccine strain since the eighties in last century succeed in developing with Come, used for more than 30 years safely, without any adverse reaction.814 vaccine strains have a good immunogenicity, protecting effect with CVI988/Rispens plants quite.814 vaccine strains or China's independent development, it is uniquely effectively applying, there is autonomous property right MD vaccines.

The infection of IBDV and MDV can not only cause the morbidity of infected chicken dead, can also cause significant immunosupress, Cause the immuning failure of scabies secondary infection and other a variety of vaccines.Endangered caused by two kinds of viral mixed infections more seriously, Add the difficulty of prevention and control.Vaccine is the main means for controlling MD and IBD, and MD vaccines are to make in breeder flock, laying hen group Vaccine, can greatly improve breeding efficiency in broiler chicken group using the vaccine.Currently used for preventing the vaccine master of IBD If traditional live vaccine and inactivated vaccine, but traditional vaccine is not only easy to be disturbed be subject to maternal antibody, and returned with virulence The strong and halfway security risk of inactivation.Meanwhile now IBD attenuated vaccines and medium widely using for virulence vaccine are not only caused The immunosupress of chicken group, also exacerbates the variation of virus, therefore there is an urgent need to develop more safely and effectively novel I BD epidemic diseases Seedling.The immunological comparison that live vector vaccine induction body produces is extensive, can express a variety of antigens at the same time, multivalence or multi-joint epidemic disease is made Seedling, is one of Main way of current and future vaccines research and development.Moreover, recombinant live-vector vaccine is not due to containing complete purpose Virus, therefore opposite traditional vaccine has more preferable security.

Recombinant live-vector vaccine is that virus or bacterium are built into a carrier with technique for gene engineering, then external source base Because being inserted being allowed to the live vaccine expressed.The immunological comparison that such vaccine-induced body produces is extensive, including humoral immunity and Cellular immunity, or even mucosal immunity；Even more important, live vector vaccine can express a variety of antigens at the same time, and multivalence or more is made Vaccines, play the effect of " pin prevents more diseases ", are one of Main ways of current and future vaccines research and development.Research shows, blister Exanthema virus genome is larger, and the duplication dispensable gene for being inserted into or replacing for foreign gene is more, is a kind of preferably structure weight The viral vector of group live vector vaccine.The research report of existing a large amount of herpesviral live vector vaccines at present, such as Guo Wanzhu with A plants of Min PRV tri- gene-deleted strains of TK/gE/gI of PRV and obtains national novel chiral synthon certificate for vector construction.As blister sore A member of malicious section, MDV are equally a kind of good live vaccine vectors (Tsukamoto K., Kojima C., Komori Y., et al.Protection of chickens against very virulent infectious bursal Disease virus(IBDV)and Marek's disease virus(MDV)with a recombinant MDV expressing IBDV VP2.Virology 1999,257:352-362.)。

Structure MDV recombinant live-vector vaccines mainly use homologous recombination method and bacterial artificial chromosome (BAC) at present Method.Wherein homologous recombination method be by foreign gene be inserted into the introduction plasmid with homology arm transfected virus infection cell or with Viral genome cotransfection permissive cell, recombinant virus is obtained by the homologous recombination process in cell.This method building process It is complicated time-consuming and less efficient, it is necessary to add riddled basins and carry out the purifying of recombinant virus.Bacterial artificial chromosome (BAC) method is that complete MDV genomes are inserted into BAC and are transformed to it in bacterium.BAC methods are built upon homologous It is same to have the shortcomings that building process is complicated, the cycle is long on the basis of restructuring；And BAC its own sequences are difficult to remove so that after The recombinant virus that phase obtains carries unnecessary exogenous gene sequence, and there are security risk.Establish a kind of quick, efficient, safety MDV live vector vaccines construction platform currently there is important theory significance and application prospect.

Inventor establishes 814 plants of multiple clips clay infection clones of MDV attenuated vaccines in research before Rescue system (Publication No. CN104830883A).On this basis, inventor identified in MDV genomes for Foreign gene insertion Nonessencial region, and by IBDV VP2 genes insertion MDV genomes inside, construct expression IBDV The recombinant mdv vaccine strain of VP2 genes, can make SPF chickens produce good confrontation IBDV for specific pathogen free chicken (SPF chickens) to be immunized Antibody, while do not influence the immune effect of MDV also.

The present invention successfully obtains expression and passes by using 814 plants of infection clones rescue platforms of chicken Marek's disease vaccine 814 vaccine strain of recombinant mdv of metachromia bursal disease virus VP 2 gene, at home and abroad still belongs to pioneering.

The content of the invention

The technical problems to be solved by the invention are to provide a kind of recombination chicken for expressing infectious bursal disease virus VP 2 gene Marek's disease virus vaccine strain and its construction method, the vaccine strain that present invention structure obtains can make animal body produce good pair The antibody of anti-ibd V, while do not influence the immune effect of MDV also.

In order to achieve the above object, present invention employs following technological means：

Inventor establishes MDV on the basis of the MDV attenuated vaccine strain multiple clips rescue systems that early period establishes The infectious recombinant clone system of 814 plants of attenuated vaccine, in favor of insertion of the foreign gene to MDV genomes.Then, by IBDV (US2 genes are the duplication dispensable genes of MDV, do not influence MDV after missing in VP2 gene expression constructs insertion MDV US2 genes Duplication and pathogenic), construct the recombinant mdv vaccine strains of expression VP2 genes, research shows that the vaccine strain has and parent The equal replicative capacity ira vitro of malicious 814 vaccine strains, can good expression VP2 genes, and in vitro steady with good heredity It is qualitative.With the recombinant virus to can not only be provided after chicken primary immune response and the suitable protection to MDV highly virulent strains of former vaccine strain Effect, can also provide IBDV highly virulent strains and completely attack malicious protection.Recombinant virus is immunized after chicken attacks malicious IBDV virulents, energy Enough survivals completely, without any clinical symptoms, experiment chicken bursa occurs without atrophy and lesion.It can be seen from the above that the present invention obtains The recombinant mdv vaccine strain rMDV-VP2 of expression IBDV VP2 genes can be used for preparing infection prevention bursal disease and chicken horse The medicine of vertical creutzfeldt jakob disease.

A kind of specifically, recombination chicken marek's disease virus of expression infectious bursal disease virus VP 2 gene of the present invention Vaccine strain, is to be inserted into the expression frame CAG-VP2 comprising infectious bursal disease virus VP 2 gene and CAG promoter sequences The US2 gene internals of 814 plants of chicken Marek's disease virus attenuated vaccine, obtain and are inserted into CAG-VP2 expression cassettes in US2 gene internals The recombinant cosmid of frame, the recombination chicken marek's disease virus epidemic disease of expression infectious bursal disease virus VP 2 gene is obtained by its rescue Miao Zhu, wherein, the US2 gene delections nucleotide of wherein the 15th to 630, is instead inserted into CAG-VP2 expression frames, described CAG-VP2 expression frame structure be cmv enhancer-Chickenβ-actin promoter-VP2 genes-sv40PolyA.

In the present invention, it is preferred to, the nucleotides sequence of the CAG-VP2 expression frames is classified as shown in SEQ ID NO.1.

Further, the invention also provides a kind of restructuring for building the expression infectious bursal disease virus VP 2 gene The method of chicken Marek's disease virus vaccine strain, comprises the following steps：

(1) reverse genetic operating system of 814 plants of marek's disease virus attenuated vaccine is built

The system contains 814 pnca gene group 1-47873 of marek's disease virus attenuated vaccine successively comprising 5 difference Position, 40028-79118,72447-113806,106337-139612 and 129115-172541 nucleotide sequences Recombinant cosmid, wherein the GeneBank accession number of described 814 plants of whole genome sequences of marek's disease virus attenuated vaccine is JF742597,5 recombinant cosmids in the system are by by 814 pnca gene group 1- of marek's disease virus attenuated vaccine 47873,40028-79118,72447-113806,106337-139612 and 129115-172541 nucleotides sequences What row obtained after being connected with pCC1Fos carriers, p814-1, p814-2, p814-3, p814-4 and p814-5 are respectively designated as, Wherein p814-5 includes the US2 genes of marek's disease virus, and the nucleotide sequence of US2 genes is as shown in SEQ ID No.2；

(2) structure of the recombination mutation clay p814-5US2VP2 containing CAG-VP2 expression frames

US2 gene internals insertion CAG-VP2 expression frame in the recombinant cosmid p814-5 that step (1) structure obtains is simultaneously The 15th to 630 nucleotide for replacing US2 genes obtains the recombination mutation clay p814- containing CAG-VP2 expression frames The structure of 5US2VP2, CAG-VP2 expression frame is cmv enhancer-Chickenβ-actin promoter-VP2 gene-sv40 PolyA；

(3) rescue of the recombination chicken Marek's disease virus vaccine strain of infectious bursal disease virus VP 2 gene is expressed

To obtained five clays of recombinant cosmid p814-1, p814-2, p814-3, p814-4 and p814-5US2VP2 into Row linearization process, by calcium phosphate transfection method by five clay cotransfection second generation CEF, is placed in 37 DEG C of incubators and cultivates, After transfecting 4 h, cell conditioned medium is discarded, is washed cell one time with DMEM；2 ml glycerol shock liquid are added, are incubated at room temperature 2 min；With After DMEM is washed 3 times, the DMEM complete culture solution cultures containing 10%FBS are added, suffers a shock after 12 h, cell culture fluid is changed to and is contained 3%FBS, 1% dual anti-DMEM continue to cultivate, after transfection 4-5 days 2 generation of blind passage the appearance of cytopathy can be observed, save out Recombinant virus be express infectious bursal disease virus VP 2 gene recombination chicken Marek's disease virus vaccine strain, be named as rMDV-VP2。

In the present invention, it is preferred to, the structure of the recombination mutation clay p814-5US2VP2 containing CAG-VP2 expression frames Build, comprise the following steps：

(1) structure of pKS KanccdB plasmids

Using R1F and R1R as primer, expanded from pDEST22 and obtain attR1 sequences；Using P6KanF and p6KanR as primer, Amplification obtains kalamycin resistance gene (Kan) from pMOD6；Using ccdBR2F and ccdBR2R as primer, expand from pDEST22 Increasing obtains ccdB-attR2 genes；Purify 3 DNA fragmentations obtained above respectively, and using this 3 fragments as template, with R1F and CcdBR2R is primer, and amplification obtains attR1-Kan-ccdB-attR2 expression frames, the attR1-Kan-ccdB- that will be obtained AttR2 expresses frame and is cloned into pBluescript II KS (+) carrier using XbaI and HindIII restriction enzyme sites, obtains pKS KanccdB；

R1F：GCGTCTAGAGATGATGAAGATACCCCACCA(XbaI)

R1R：GTGTGCGTCGGGTGATGCTGCCAA

P6KanF：TTGGCAGCATCACCCGACGCACACATCTCAACCATCATCG

P6KanR：ATCTGGCTTTTAGTAAGCCGGATCCACCGAGCTCGAATTCGATGAA

ccdBR2F：GGATCCGGCTTACTAAAAGCCAGAT

ccdBR2R：GCGAAGCTTCGGCCATCAAACCACTTTGTACAAG(HindIII)

(2) structure of the recombination mutation clay p814-5US2KanccdB with Kan/ccdB resistant genes

AttR1-Kan- with homologous recombination arm is expanded as primer from pKS KanccdB using US2hmL and US2hmR CcdB-attR2 expresses frame：

US2hmL：5’-ATCTAATTGGTAGCAAGTAGGTCTGTCGAATAACAGCTAATGACTACCGGGGGTGGGTC GAATCAAACAAGTTTGT-3 ',

US2hmR：5’-TGGGTGTGCCCATAATCGCCAGAGCTGCAGACCTATTCCGTTTTGCCAAAGCGGCCATC AAACCACTTTGTACAAG-3’；

The fragment expanded is cloned into Counter-Selection BAC Modification Kit kits In US2 genes in p814-5,15-630 nucleotide sequences of 814 pnca gene group US2 gene orders are replaced, instead AttR1-Kan-ccdB-attR2 expresses frame, obtains recombination mutation clay p814-5US2KanccdB；

(3) structure of pENTR1 entry vectors

By the gus gene elminations in pENTR-gus plasmids, BglII-SalI-XbaI-NotI-EcoRI-KpnI- is replaced with Ten restriction enzyme sites of SmaI-SacI-HindIII-BamHI, obtain entry vector, are named as pENTR1；

(4) structure of pCAGGS-VP2 expression plasmids

With primer VP2F and VP2R, using plasmid pUC57-VP2 as template, amplification obtains VP2 genes, by after purification PCR product EcoRI and ClaI digestions, are cloned into pCAGGS vector multiple cloning sites, and successfully structure obtains pCAGGS-VP2, its Middle VP2 genes are located at CAG promoters downstream, SV40PolyA upstreams, between the 1719-1736 positions nucleotide of pCAGGS carriers, Wherein plasmid pUC57-VP2 is by that will enter in pUC57 carriers to obtain according to the VP2 gene clonings after chicken codon optimization；

VP2F：5’-TTTGAATTCGCCGCCACCATGACCAACCTGCAGGACCAGAC-3’

VP2R：5’-TTTATCGATTCAGCGGCGCAGGGCGCGGATGATGTCC-3’

(5) structure of VP2 introduction expression plasmids pENTR1-VP2

The VP2 expression plasmids pCAGGS-VP2 of step (4) structure is subjected to double digestion, digestion production with SalI and HindIII VP2 expression frame CAG-VP2 are obtained after thing recycling, the VP2 expression frame CAG-VP2 of acquisition is passed through into SalI and HindIII enzymes Enzyme site is cloned into pENTR1 entry vectors, obtains VP2 introduction expression plasmids pENTR1-VP2；

(6) structure of the recombination mutation clay p814VP2 containing VP2 expression frames

Above-mentioned VP2 introduction expression plasmid pENTR1-VP2 and recombination mutation clay p814-5US2KanccdB are utilizedClonase^TMII Enzyme Mix carry out LR reactions, make the Kan-ccdB tables in above-mentioned recombination mutation clay The VP2 replaced with up to frame in pENTR1-VP2 plasmids expresses frame, so as to obtain in the US2 genes of marek's disease virus It is inserted into the recombinant cosmid p814-5US2VP2 of VP2 expression frames.

Further, the invention also provides the recombination chicken horse of the expression infectious bursal disease virus VP 2 gene Purposes of the Garrick disease virus vaccine strain in prevention and treatment chicken Marek's disease and Bursal Disease medicine is prepared.

The present invention, for carrier, constructs the restructuring disease of expression IBDV VP2 genes with 814 plants of MDV serum 1 types attenuated vaccine Poison.Compared with other viral vectors, 814 vaccine strain vectors have unrivaled advantage：1) 814 vaccine strains are current using most One of extensive serum 1 type MDV vaccine strains, it is suitable with CVI988/Rispens plants of immune effects, can be special to currently a popular MDV Virulent (vv+MDV) provides good protection, and immune effect is significantly stronger than HVT vaccines；2) 814 vaccine strains are one plant naturally weak Strain, character is stablized, and since last century, the eighties succeeded in developing, safety adapted to for more than 30 years, without any adverse reaction；3) conduct Herpetoviridae member, MDV have the characteristic of persistent infection, are conducive to long-term expression exogenous antigen in vivo, excitating organism Produce stronger immune response；4) IBDV, which infects severity of consequence and the age of chicken, much relations, 3-6 week old Chick is to the neurological susceptibility highest of infection, and MDV vaccines must carry out immunity inoculation in 1 age in days, therefore helps to help chicken as early as possible Body establishes the early stage active immunity responsing reaction for IBDV；5) MDV is single-minded cell combination type virus, by cell and carefully Direct contact between born of the same parents is propagated, therefore smaller by maternal antibody interference.

To sum up, the recombinant vaccine that the present invention is built overcomes the deficiency of existing IBD attenuated vaccines, safely and effectively, is produced into This is low, can effectively prevent the important birds infectious diseases of IBD and two kinds of MD at the same time.The recombinant vaccine meet IBD regularties of epidemic and The market demand, it is expected to promote, and export goods and earn foreign currency in the whole nation, can have a tremendous social and economic benefits.

Brief description of the drawings

Fig. 1 is MDV genomic DNA fragment pulsed field gel electrophoresis figures；

Wherein, M, low scope PFG Marker；1, MDV genomic DNA；2, genomic DNA shearing post-fragment；3, after recycling 35-48kb DNA；

Fig. 2 is pCC1Fos Vector maps；

Fig. 3 is the cytopathy that rescue poison rMDV and original MDV vaccines strain virus produce on CEF cells；

Wherein, rMDV：MDV vaccine strains rescue poison；MDV：Former MDV vaccines strain virus；Mock：Normally poison cell is not connect；

Fig. 4 is the HindIII restriction enzyme mappings of rescue poison rMDV and original MDV vaccine strain virus genom DNAs；

Wherein, M1：Low scope PFG Marker；M2：15kb DNA moleculars amount marks；rMDV：MDV vaccine strains rescue poison； MDV：Former MDV vaccines strain virus；

Fig. 5 is pKS KanccdB plasmid maps；

Fig. 6 is recombination mutation clay p814-5US2KanccdB structure diagrams；

Fig. 7 is entry vector pENTR1 collection of illustrative plates；

Fig. 8 is purpose gene expression plasmid pCAGGS-VP2 collection of illustrative plates；

Fig. 9 is introduction expression plasmid pENTR1-VP2 collection of illustrative plates；

Figure 10 is the recombination mutation clay that VP2 expression frames are inserted into 814 genome US2 gene internals of MDV vaccine strains P814-5US2VP2 (p814VP2) collection of illustrative plates；

Figure 11 is the cytopathy that recombinant virus and original MDV vaccines strain virus produce on CEF cells；

Wherein, rMDV-VP2：Express the recombinant mdv of VP2 genes；MDV：Former MDV vaccines strain virus；Mock：Do not connect normally Poison cell；

Figure 12 is the virion that recombinant virus and original MDV vaccines strain virus are formed on CEF cells；

Figure 13 identifies for recombinant virus and original MDV vaccine strain virus genom DNAs PCR；

Wherein, rMDV-VP2：Express the recombinant mdv of VP2 genes；MDV：Former MDV vaccines strain virus；DL2000：2000 points Son amount Marker；DL15000:15000bp molecular weight Marker；

Figure 14 is the expression of the VP2 of indirect immunofluorescence assay testing goal gene；

Figure 15 is the expression of Western blot testing goal genes VP2；

Wherein, rMDV-VP2：Express the recombinant mdv of VP2 genes；MDV：Former MDV vaccines strain virus；CEF：Normally poison is not connect CEF cells；

Figure 16 is that PCR methods detect inheritance stability situations of the foreign gene VP2 in recombinant virus passage；

Wherein, rMDV-VP2_P5, P10, P20 are respectively the 5th, 10,20 generation recombinant viruses；MDV：Former MDV vaccine strains disease Poison；DL15000:15000bp molecular weight Marker；

Figure 17 is that indirect immunofluorescence assay detects stabilization expressions of the foreign gene VP2 in recombinant virus passage；

Wherein, rMDV-VP2_P5, P10, P20 are respectively the 5th, 10,20 generation recombinant viruses；Mock：It is normal not connect poison carefully Born of the same parents；

Figure 18 is the facsimile log of recombinant virus rMDV-VP2 and parent's poison MDV on CEF；Wherein, rMDV-VP2：Expression The recombinant virus of VP2 genes；MDV：Parent MDV viruses；

Figure 19 is virus loads of the recombinant virus rMDV-VP2 and parent's poison MDV in immune rear 7 days feather pulps；

Wherein, rMDV-VP2：Express the recombinant virus of VP2 genes；MDV：Parent MDV viruses；Mock：Non- Blank immunization pair According to；

Rear ELISA antibody and neutralizing antibody detection is immunized for recombinant virus rMDV-VP2 and parent's poison MDV in Figure 20；

Wherein, rMDV-VP2：Express the recombinant virus of VP2 genes；MDV：Parent MDV viruses；Mock：Normal control chicken；

Figure 21 is immunized chicken for recombinant virus rMDV-VP2 and parent's poison MDV and attacks survival rate and clinical symptoms point after malicious IBDV Value；

Figure 22 is immunized chicken for recombinant virus rMDV-VP2 and parent's poison MDV and attacks bursa of farbricius weight ratio (F/B after malicious IBDV ) and bursal index (BBIX) ratios；

Figure 23 for recombinant virus rMDV-VP2 and parent's poison MDV be immunized chicken attack after malicious IBDV bursa of farbricius pathology situation of change and Pathological change score value (HBLS).

Wherein, rMDV-VP2：Express the recombinant virus of VP2 genes；MDV：Parent MDV viruses；Mock：Normal control chicken.

Embodiment

The invention will now be further described with reference to specific embodiments, the advantages and features of the present invention will be with description and It is apparent.But these embodiments are only exemplary, do not form any restrictions to the scope of the present invention.People in the art Member it should be understood that without departing from the spirit and scope of the invention can to the details of technical solution of the present invention and form into Row modifications or substitutions, but these modifications and replacement are each fallen within protection scope of the present invention.

The structure in 1 MDV vaccines of embodiment, 814 pnca gene group Fosmid libraries

Marek's disease virus attenuated vaccine 814 plants of (Zhang, F., Liu, C.J., Zhang, Y.P., et al.Comparative full-length sequence analysis of Marek's disease virus vaccine strain 814.Arch Virol.2012,157(1):177-183.) protected by Harbin Veterinary Medicine Inst., China Academy of Agriculture Deposit, there is provided.The GenBank accession number of described 814 plants of whole genome sequences of marek's disease virus attenuated vaccine is JF742597。

Said according to Epicentre companies CopyControlTM Fosmid Library Production Kit kits The structure in bright progress MDV genome Fosmid libraries.Method is as follows：

814 strain virus genomic DNA of MDV vaccines is aspirated into 50- repeatedly with physical method with 200 μ L suction pipette heads 100 times, pass through pulsed field gel electrophoresis (BioRad companies CHEFXA Pulsed Field Electrophoresis System z system, condition are：0.5 × TBE of electrophoretic buffer, gum concentration 1%, program 5-220kb) analysis, to its fragment length Between 30-50kb (Fig. 1).DNA after shearing is put down with End-Repair Enzyme Mix (Epicentre companies) Ending and 5 ' phosphorylation modifications.Take it is end modified after DNA carry out pulsed field gel electrophoresis, condition is as described above.Recycling size is Genomic DNA fragment (Fig. 1) between 35-48kb.DNA is connected with pCC1Fos carriers (Fig. 2) after fetching receipts.By connection product Packed with reagent MaxPlax Lambda Packaging Extracts (being purchased from Epicentre companies) are packed, transfect large intestine bar Bacterium EPI300-T1R (is purchased from Epicentre companies).Bacterium solution is coated on the LB tablets containing 12.5 μ g/ml chloramphenicol and was cultivated At night, count colony counts, calculate the titre (cfu/ml) of cosmid library, be as a result 1.8 × 10⁶cfu/ml。

300 clones of picking, alkaline lysis method of extracting clay, with primer pCC1F from culture plate：5’- GGATGTGCTGCAAGGCGATTAAGTTGG-3 ' and pCC1R：5 '-CTCGTATGTTGT GTGGAATTGTGAGC-3 ' are to restructuring Clay carries out gene order-checking.As a result 273 being obtained altogether and cloning the recombinant cosmid for there are MDV genetic fragments, Insert Fragment length exists Between 32-46kb.Calculated with each Insert Fragment 30kb, this 273 clones are to the coverage rate of 814 vaccine strain genomes of MDV 47.6 (273 × 30kb/172kb), show that it is enough to cover MDV full-length genomes.Successfully build 814 pnca gene group of MDV vaccines Fosmid libraries.

2 virus rescue of embodiment

Analyzed according to recombinant cosmid end sequencing, therefrom choose 6 group of 5 clay combination.Equal gram of 5 clays in each combination It is grand to have 814 pnca gene group DNA fragmentation of MDV vaccines, contain overlapping areas and the sliceable complete MDV genomes of covering.With Extraction reagent kit extracts selected cosmid DNA in QIAGEN companies.The clay of extraction is linearized with NotI (NEB companies) Processing：NotI restriction endonuclease 100U, clay 10 μ g, 37 DEG C of effect 2h.Digestion products phenol-chloroform-isoamyl alcohol extraction, ethanol precipitation Prepare transfection and use MDV genomic DNAs.

Using calcium phosphate transfection method by 5 sections of MDV genomic DNA fragment cotransfection second generation CEF cells.The system of CEF cells Preparation Method is as follows：9-10 age in days SPF chicken embryos are taken, sterile taking-up chicken embryo, is placed into and fills the flat of Hank ' s liquid (being purchased from HyClone) Washed in ware, remove head, four limbs and internal organ, shredded with scissors；Washed twice with Hank ' s liquid, add 0.25% pancreatin (4mL/ embryos), 37 DEG C of incubation 10min；Most pancreatin is abandoned, adds and (is purchased from containing 5%FBS, 1% dual anti-DMEM nutrient solutions HyClone), piping and druming disperses cell repeatedly.With being made 8 × 10 after 6 layers of filtered through gauze⁵The cell suspension of cell/mL, is sub-packed in Cultivated in Tissue Culture Flask in 37 DEG C of incubators.

Calcium phosphate transfection process is as follows：The primary CEF cells pancreatin for cultivating 16-18h is digested, with containing 10% FBS, wash twice without dual anti-DMEM, with being dispensed into after 6 layers of filtered through gauze (4 × 10 in 60mm culture dishes⁶Cell/ware). 388 μ l aqua sterilisas are mixed in 1.5ml EP pipes, 50 μ l DNA (are the MDV genomic DNA pieces of 200ng/ μ l comprising 5 concentration Section, i.e. 2 μ g of each 10 μ l of fragment), 62 μ l 2M CaCl₂；500 2 × HBS of μ l bufferings are added in another 1.5ml EP pipe Liquid；By CaCl₂- DNA mixed liquors are slowly added into 2 × HBS buffer solutions dropwise, are mixed；It is incubated at room temperature 30min.By preparation Calcium phospate-DNA precipitate is added dropwise on the second generation CEF cells of preparation, and slight mixing, which is placed in 37 DEG C of incubators, cultivates.Turn After contaminating 4h, with 2ml glycerol shocks liquid (15% glycerine, 1 × HBS) shock 2min, the DMEM complete culture solutions containing 10%FBS are added Culture.Suffer a shock after 12h, cell culture fluid is changed to and continues to cultivate containing 3%FBS, 1% dual anti-DMEM.

After transfection 4-6 days, the production of cytopathy is observed.The result shows that selected 6 groups of clays combination transfection It may occur in which MDV typical cells lesions after CEF cells.The preferable one group of clay combination of repeatability is chosen, carries out follow-up experiment. The virus of this group 5 clay cotransfections rescue is harvested, is named as rMDV.It is thin that rMDV with original MDV vaccines strain virus is inoculated with CEF respectively Born of the same parents, culture are observed after 4-6 days, find the plaque forms that are produced on CEF cells of rMDV and size and original MDV vaccines strain virus without Notable difference (Fig. 3).Extraction rescue poison rMDV and original MDV vaccine strain virus genom DNAs, with HindIII (being purchased from NEB companies) After carrying out digestion, its restriction enzyme mapping is analyzed with pulsed field gel electrophoresis, shows to save malicious rMDV physical map of genome and provirus MDV Completely the same (Fig. 4).Illustrate that selected 5 clay combines and successfully save MDV.

The present inventor by selected 5 clay group membership be respectively designated as p814-1, p814-2, p814-3, p814-4, P814-5, its DNA fragmentation being inserted into is respectively 1-47873 of 814 pnca gene group of MDV vaccines, 40028-79118, 72447-113806,106337-139612 and 129115-172541.DNA fragmentation contained by this 5 recombinant cosmids Energy is overlapped and can cover full MDV genomes, and (US2 gene nucleotide series are such as US2 genes of the wherein p814-5 comprising MDV Shown in SEQ ID No.2).

Embodiment 3 is dashed forward in the restructuring of MDV genome US2 gene internals insertion VP2 gene expression constructs (SEQ ID No.1) Become the structure of clay

Based on above-mentioned established MDV multiple clips clay rescue system, in selected 5 clay group membership p814-5 The US2 gene internals of MDV genomes, specifically, US2 genes common 813bp, in this research, US2 gene delections the wherein the 15th to 630 nucleotide, being instead inserted into CAG-VP2 expression frame, (nucleotides sequence of CAG-VP2 expression frames is classified as SEQ ID NO.1, its structure are cmv enhancer-Chickenβ-actin promoter-VP2 genes-sv40PolyA), build 1 recombination mutation clay P814-5US2VP2 (abbreviation p814VP2).

The building process of recombination mutation clay p814-5US2VP2 is summarized as follows：

The structure of 3.1 pKS KanccdB plasmids

Multiplexed PCR amplification is carried out to pDEST22 plasmids and pMOD6 plasmids respectively with 3 pairs of primers shown in table 1.

Its building process is summarized as follows：Using R1F and R1R as primer, expanded from pDEST22 and obtain attR1 sequences；With P6KanF and p6KanR is primer, is expanded from pMOD6 and obtains kalamycin resistance gene (Kan)；With ccdBR2F and CcdBR2R is primer, is expanded from pDEST22 and obtains ccdB-attR2 genes；3 DNA fragmentations obtained above are purified respectively, And using this 3 fragments as template, using R1F and ccdBR2R as primer, amplification obtains attR1-Kan-ccdB-attR2 expression cassettes Frame.Obtained attR1-Kan-ccdB-attR2 expression frames are cloned into using XbaI and HindIII restriction enzyme sites PBluescript II KS (+) carrier, obtains pKS KanccdB, as shown in Figure 5.

Table 1 is used for the PCR primer for cloning Kan-ccdB expression frames

Primer	Sequence (5 ' -3 ')
		R1F	GCGTCTAGAGATGATGAAGATACCCCACCA(XbaI)
R1R	GTGTGCGTCGGGTGATGCTGCCAA
		P6KanF	TTGGCAGCATCACCCGACGCACACATCTCAACCATCATCG
P6KanR	ATCTGGCTTTTAGTAAGCCGGATCCACCGAGCTCGAATTCGATGAA
		ccdBR2F	GGATCCGGCTTACTAAAAGCCAGAT
ccdBR2R	GCGAAGCTTCGGCCATCAAACCACTTTGTACAAG(HindIII)

The structure of the 3.2 recombination mutation clay p814-5US2KanccdB with Kan/ccdB resistant genes

The attR1-Kan-ccdB-attR2 with homologous recombination arm is expanded with following primer from pKS KanccdB to express Frame, US2hmL：5’-ATCTAATTGGTAGCAAGTAGGTCTGTCGAATAACAGCTAATGACTACCGGGGGTGGGTC GAATCAAACAAGTTTGT-3 ', US2hmR：5’-TGGGTGTGCCCATAATCGCCAGAGCTGCAGACCTATTCCGT TTTGCCAAAGCGGCCATCAAACCACTTTGTACAAG-3’.With Counter-Selection BAC Modification The fragment expanded is cloned into the US2 genes in p814-5 by Kit kits, replaces 814 pnca gene group US2 gene orders 15-630 nucleotide sequences, instead attR1-Kan-ccdB-attR2 expression frame, obtains recombination mutation clay p814- 5US2KanccdB, its forming types are as shown in Figure 6.

The structure of 3.3 pENTR1 entry vectors

It is of the invention by the gus in pENTR-gus plasmids for ease of being inserted into exogenous gene expression frame into MDV genomes Gene elmination, replaces with ten enzymes of BglII-SalI-XbaI-NotI-EcoRI-KpnI-SmaI-SacI-HindIII-BamHI Enzyme site, process are as follows：With ENTR1F (5 '-GAATTCTCGCGGCCGCTCTAGAATC TGTCGACAGATCTGGTTT CTACAGGACGGACCATG-3 ') and ENTR1R (5 '-GAATTCGGTACCCGGGAGCTCAAGCTTGGATCCGGT GAAAAACCGCAGCAGGGAGG-3 ') it is primer, using pENTR-gus as template, PCR amplification is carried out,.PCR after purification is produced Thing EcoR1 digestions.Digestion products carry out itself connection after purification, with T4DNA ligases, convert Escherichia coli, are got started Carrier pENTR1 (as shown in Figure 7).

The structure of 3.4 pCAGGS-VP2 expression plasmids

With primer VP2F：5 '-TTTGAATTCGCCGCCACCATGACCAACCTGCAGGACCAG AC-3 ' and VP2R：5’- TTTATCGATTCAGCGGCGCAGGGCGCGGATGATGTCC-3 ' obtains VP2 genes by template amplification of plasmid pUC57-VP2, Total length 1359bp, wherein plasmid pUC57-VP2 are carried by will enter pUC57 according to the VP2 gene clonings after chicken codon optimization Obtained in body.By EcoRI the and ClaI digestions of PCR product after purification, pCAGGS vector multiple cloning sites are cloned into, success PCAGGS-VP2 is built, VP2 genes are located at CAG promoters downstream, SV40PolyA upstreams, in the 1719-1736 of pCAGGS carriers Between nucleotide, as shown in Figure 8.

The structure of 3.5 VP2 introduction expression plasmids pENTR1-VP2

The VP2 expression plasmids pCAGGS-VP2 of above-mentioned structure is subjected to double digestion with SalI and HindIII, digestion products return VP2 expression frames are obtained after receipts.The VP2 expression frames of acquisition are cloned into pENTR1 by SalI and HindIII restriction enzyme sites Entry vector, obtains VP2 introduction expression plasmid pENTR1-VP2 (as shown in Figure 9).

The structure of the 3.6 recombination mutation clay p814VP2 containing VP2 expression frames

Above-mentioned VP2 introduction expression plasmid pENTR1-VP2 and recombination mutation clay p814-5US2KanccdB are utilizedClonase^TMII Enzyme Mix carry out LR reactions, make the Kan-ccdB tables in above-mentioned recombination mutation clay The VP2 replaced with up to frame in pENTR1-VP2 plasmids expresses frame, is inserted into so as to obtain in the US2 genes of MDV genomes VP2 expresses the recombinant cosmid p814VP2 of frame (collection of illustrative plates of the recombination mutation clay is as shown in Figure 10).Specifically, with described The 15th of CAG-VP2 expression frames (SEQ ID No.1) replacement 814 plants of US2 genes of MDV vaccines (SEQ ID No.2) is arrived 630 nucleotide fragments.

Embodiment 4 expresses rescue, identification and the biological property analysis of the recombinant mdv of IBDV VP2 genes

The rescue of 4.1 recombinant viruses

P814-1, p814-2, p814-3, p814-4 are extracted (by embodiment 1-2 structures with the middle extraction reagent kit of QIAGEN companies Build and screen), five cosmid DNAs of p814VP2.Linearization process is carried out to the clay of extraction with NotI (NEB companies)：In NotI Enzyme cutting 100U, clay 10 μ g, 37 DEG C of effect 2h.Digestion products phenol-chloroform-isoamyl alcohol extraction, ethanol precipitation prepare transfection and use DNA。

Five clay cotransfection second generation CEF, virus rescue process are described below by calcium phosphate transfection method：Take 9-10 Age in days SPF chicken embryos, sterile taking-up chicken embryo, is placed into the plate for filling Hank ' s liquid (being purchased from HyClone) and washs, removal head, Four limbs and internal organ, are shredded with scissors；Washed twice with Hank ' s liquid, add 0.25% pancreatin (4mL/ embryos), 37 DEG C of incubations 10min；Most pancreatin is abandoned, add makes cell point containing 5%FBS, 1% dual anti-DMEM nutrient solutions (being purchased from HyClone), repeatedly piping and druming Dissipate.With being made 8 × 10 after 6 layers of filtered through gauze⁵The cell suspension of cell/mL, is sub-packed in Tissue Culture Flask in 37 DEG C of incubators Culture.

The primary CEF cells pancreatin for cultivating 16-18h is digested, is prepared as second generation CEF cells.Preparing second generation The preparation of calcium phospate-DNA precipitate is carried out while CEF cells.388 μ l aqua sterilisas, 50 μ l DNA are mixed in 1.5ml EP pipes (including the MDV genomic DNA fragments that 5 concentration are 200ng/ μ l, i.e. 2 μ g of each 10 μ l of fragment), 62 μ l 2M CaCl2； 500 μ l 2 × HBS buffer solutions are added in another 1.5ml EP pipe；CaCl2-DNA mixed liquors are slowly added into 2 dropwise × In HBS buffer solutions, then blowing 5-6 bubble in tube bottom makes its mixing；It is incubated at room temperature 30min.By the calcium phospate-DNA precipitate of preparation It is added dropwise on the second generation CEF cells of preparation, slight mixing, which is placed in 37 DEG C of incubators, cultivates.After transfecting 4h, discard thin Born of the same parents' supernatant, is washed cell one time with DMEM；2ml glycerol shocks liquid (15% glycerine, 1 × HBS) is added, is incubated at room temperature 2min；With After DMEM is washed 3 times, the DMEM complete culture solution cultures containing 10%FBS are added.Suffer a shock after 12h, cell culture fluid is changed to and is contained 3%FBS, 1% dual anti-DMEM continue to cultivate.The appearance of cytopathy can be observed in 2 generation of blind passage after transfecting 4-5 days, saves out Recombinant virus be named as rMDV-VP2.

The identification of 4.2 recombinant viruses

Rescue poison is identified in terms of cytopathy, electron microscopic observation and sequencing three.By rMDV-VP2 and original MDV epidemic diseases Seedling strain virus is inoculated with second generation CEF cells respectively, and culture observes the more viral plaque feelings produced on infection cell after 4-6 days Condition.Saved with transmission electron microscope observing in poison rMDV-VP2 infection cells and whether there is typical MDV virion.Use primer VP2F：5 '-ATGACCAACCTGCAGGACCAGAC-3 ' and US2R：5 '-TGGGTGTGCCCATAATCGCCAGAG-3 ' are to restructuring Virus carries out PCR identifications and is sequenced.

4.3 recombinant virus target gene VP2 expressions

The recombinant virus rMDV-VP2 that above-mentioned rescue is obtained is with original MDV vaccines strain virus with 100PFU inoculated and cultureds in six CEF cells in orifice plate, cell is collected after cultivating 120h, and the anti-mouse secondary antibody marked with VP2 monoclonal antibodies and FITC is into the ranks Connect immunofluorescent test (IFA).Process is as follows：Poison cell will be connect and fix 20min with absolute ethyl alcohol room temperature.It will be fixed with PBST Culture plate wash one time.Add 1:100 diluted VP2 monoclonal antibodies, are incubated 1h in 37 DEG C of wet box.Washed 5 times with PBST.Add 1:100 The sheep anti-mouse igg of diluted FITC mark, is incubated 1h in 37 DEG C of wet box.Washed 5 times with PBST, in fluorescence microscopy Microscopic observation knot Fruit.

It is carried out at the same time Western blotting (Western blot) detection：500 μ L cell pyrolysis liquids are added per hole and (are purchased from green cloud Its company), 4 DEG C of cracking 30min discharge the VP2 in cells.By the 10%SDS-PAGE separation gels electricity of supernatant obtained by cell cracking Swimming.Albumen is gone into NC films by protein adhesive with half-dried transferring film instrument (Bio-Rad companies).After the completion of transferring film, by film VP2 monoclonals The anti-mouse secondary antibody (KPL companies) of antibody and DyLight-800 marks carries out Western blot experiments：After the completion of transferring film, by film It is placed in 5% skimmed milk in 4 DEG C of closings overnight.Film is washed three times with PBST, 5min/ times.Film VP2 monoclonal antibodies are incubated at room temperature 1.5h, same method are washed 3-5 times.Film is placed in the anti-mouse secondary antibody of infrared markers and is incubated at room temperature 1h, washed 3-5 times.Use albumen Matter trace scanning system observes result.

The genetic stability of 4.4 recombinant viruses

Recombinant virus rMDV-VP2 was continuously passed into for 20 generations in CEF, extracts virus genom DNA, with primer VP2F and US2R carries out PCR and sequencing identification.Virus inoculation is incubated at CEF cells, carries out indirect immunofluorescence assay, testing goal base Because of the expression of VP2.

The replication in vitro curve of 4.5 recombinant viruses

Recombinant virus rMDV-VP2 and original MDV vaccines strain virus are incubated at 100PFU dose inoculations secondary in 6 orifice plates For CEF cells, viral (the every kind of virus of each time point does 3 repeating holes) is collected every 24h after infection, after infection 144h.Titre viral collected by Each point in time is measured, draws growth curve, recombinant virus rMDV-VP2 is on CEF for detection Facsimile log it is whether consistent with parent's poison.

As a result：

Rescue, identification and the biological property analysis of 4.6 recombinant virus rMDV-VP2

4.6.1 the identification of recombinant virus rMDV-VP2

Recombinant virus rMDV-VP2 and original MDV vaccines strain virus are inoculated with CEF cells respectively, culture observes ratio after 4-6 days The more viral plaque situation produced on infection cell.It was found that the plaque shape that recombinant virus rMDV-VP2 is produced on CEF cells State and size and original MDV vaccine strain virus no significant differences (Figure 11).Found with transmission electron microscope observing, it is thin in rMDV-VP2 infection Visible a large amount of typical MDV virion (majority is exposed prematurity virus), form with former MDV vaccines strain virus in born of the same parents Virion no significant difference (Figure 12).RMDV-VP2 infection cell genomic DNAs are extracted, PCR identifications are carried out to recombinant virus. The result shows that parent's MDV vaccines strain virus is feminine gender because not containing VP2 genes, amplification；The PCR productions of recombinant mdv vaccine strain Thing length is 2477bp, the US2 Gene Partials sequence (Figure 13) comprising VP2 full length genes and VP2 expression cassettes downstream.PCR is produced Thing is sequenced, and the 1-1359bp nucleotide sequences of PCR product and the VP2 gene orders shown in SEQ ID NO.1 are completely the same.

4.6.2 target gene VP2 expressions

72h collects cell after recombinant virus rMDV-VP2 and original MDV vaccines strain virus are inoculated with CEF cells respectively, uses IFA With the expression of Western blot testing inspection target gene VP2.IFA the result shows that, rMDV-VP2 infection cell warp VP2 monoclonal antibodies detect visible green fluorescence signal, and MDV parental virus have no fluorescence (Figure 14) with not connecing poison cell.Western Blot is the results show that VP2 gene expression products about 50kDa, size are consistent (Figure 15) with expection.Therefore recombinant virus RMDV-VP2 can be with successful expression target gene VP2.

4.6.3 the genetic stability of recombinant virus

Recombinant virus rMDV-VP2 was continuously passed into for 20 generations in CEF.The 5th, 10,20 generation recombinant virus genomes DNA are extracted, PCR identifications are carried out with target gene sense primer VP2F and downstream homology arm primer US2R.The results show that above generation virus is It is amplifiable to obtain the purpose fragment that size is 2477bp, it is consistent (Figure 16) with expection.Sequencing result shows, the restructuring of above generation The VP2 genes being inserted into virus and the VP2 gene orders shown in SEQ ID No.1 are completely the same, there are no mutation or missing hair It is raw.By the 5th, 10,20 generation virus inoculation CEF cells, the expression of recombinant protein is detected with indirect immunofluorescence assay.As a result table It is bright, the viral expression VP2 destination proteins (Figure 17) that can stablize of above generation.To sum up illustrate, recombinant virus rMDV-VP2 With good genetic stability.

4.6.4 the replication in vitro characteristic of recombinant virus

Recombinant virus rMDV-VP2 and original MDV vaccine strains parental virus are inoculated with CEF with 100PFU, it is every 24 it is small when collect carefully Born of the same parents, titrate the facsimile log of virus.As shown in figure 18, from the point of view of growth curve, the titre of each time point rMDV-VP2 and MDV without Notable difference (P ＞ 0.05).Recombinant virus replicates titre with parent's poison after infection 120h and reaches top, is respectively 9.46 ×10⁴PFU/ml and 9.52 × 10⁴PFU/ml.Illustrate that duplication characteristics of the rMDV/IBDV-VP2 in CEF is consistent with MDV.

The immuning effect test of 5 recombinant mdv vaccine strain rMDV-VP2 of embodiment

5.1 recombinant viruses test the immune protection effectiveness of IBDV

45 1 age in days SPF leghorn chickens are taken to be randomly divided into 3 groups, every group 15.Group 1 is subcutaneous with 2000PFU/ dosage neck It is inoculated with recombinant vaccine strain rMDV-VP2；The inoculation MDV parental virus of group 2 are as negative control；Group 3 is not immune to be used as blank control. Take a blood sample weekly after immune, IBDV specific ELISA antibody is detected with IDEXX kits.4 weeks serum is neutralized after collection is immune Experiment, detects IBDV neutralizing antibodies.Neutralizing antibody assay method is：Sterile separation serum is put into 56 DEG C of water-bath 30min to go out It is living；With the DMEM without serum with 2 times of gradient dilutions after, add 100TCID₅₀The cell adapted strain virus of vvIBDV RHLJ0504ACC (is prepared and preserved as the National Veterinary biotechnology key lab where inventor), and 1h is acted in 37 DEG C； 96 orifice plate CEF are taken, get rid of nutrient solution, cell is cleaned once with D-HANK ' S liquid, add serum and virus mixture, effect 1 is small When add containing 2% serum DMEM continue cultivate 72h, observation count, with can completely inhibit the maximum serum of viral growth dilution Spend for its dilution factor.

4 weeks after immune, group 1 and 2 test chickens of group are respectively with 500ELD₅₀Dosage attacks malicious IBDV virulents (HLJ0504 plants).Attack Continuous observation 10 days, count each group test chicken survival condition and clinical symptoms after poison, count symptom score.With reference to OIE IBD ginsengs The IBD symptom score statistical methods for examining laboratory foundation are evaluated^[7], it is summarized as follows：0, test chicken does not have any clinical condition Shape, with control group chicken indifference；1, test chicken feather is fluffy, but activity is normal, and feather symptom disappears when movable；2, test chicken plumage Hair is fluffy, apathetic, and mobility weakens or loses, and the fluffy symptom of feather has been thrown away after activity；3, test chicken spirit is extremely withered Waste, crouch ground, exhaustion, and frequency is died on one's deathbed or death.

Attack after poison to cut open for 10 days and kill, gather the bursa of farbricius, statistics capsule is again than (F/B) and capsule index (BBIX), the F/B=(bursa of farbricius Weight/weight) × 1000；BBIX=test group chickens capsule is again than/blank control group chicken tumour ratio；Work as BBIX<When 0.7, Fa Shi is judged to Capsule atrophy；BBIX>When 0.7, it is normal to be judged to the bursa of farbricius.The bursa of farbricius tissue of collection is made into pathological section, carries out histopathology Learn observation, statistics lesion score value (HBLS).The statistical method of HBLS^[8]It is as follows：0, without any lesion；1, Minimal change；2, dissipate Or part folliculus lesion；3, lesion occurs for the folliculus less than or equal to 50%；Lesion occurs for 4,50%-75% folliculus； Lesion occurs for 5,75%-100% folliculus.As HBLS≤1, it is judged to protect；HBLS>When 1, it is judged to unprotected.

5.2 recombinant viruses test the immune protection effectiveness of MDV

60 SPF leghorn chickens are taken to be equally divided into 3 groups, every group 20, wherein 2 groups pass through neck subcutaneous vaccination respectively 814 vaccine of 2000PFU recombinant viruses rMDV-VP2 or parental virus, the 3rd group of inoculation sterilizing PBS attack malicious control as nonimmune. In addition set 10 with age in days chicken as normal healthy controls.7 days after immune, each group test chicken feather pulp is gathered, with quantitative fluorescent PCR side The duplication titres of method detection MDV in vivo.At the same time 7 days after immune, all test chickens are pressed by way of intraperitoneal injection The dosage of 1000PFU/ only carries out attacking poison with MDV highly virulent strains (Md5 plants).Attack after poison the morbidity of continuous viewing test chicken and dead Situation is died to attacking after poison 12 weeks.It is all attack dead test chicken after poison and experiment at the end of slaughter test chicken and carry out dissect sight Substantially lesion is examined, while gathers liver, kidney, spleen, Zuo Gu Zhong warps and skin histology and is consolidated with 10% neutral buffered formalin After fixed, pathological examination is carried out by literature method.Protective index is calculated according to the following formula：PI (%)=(% is compareed Group MD positive rate-% immune group MD positive rates)/% control group MD positive rates.

As a result：

5.3. recombinant virus rMDV-VP2 attacks malicious protecting effect to IBDV

5.3.1 the internal duplication characteristic of recombinant virus

7 days after experiment chicken immune recombinant virus rMDV-VP2, feather pulp, duplication drop of the detection recombinant virus in chicken body are gathered Degree, and compared with parental virus.The result shows that 7 days after immune, average virus of the recombinant virus rMDV-VP2 in feather pulp carries Measure as 4.2 × 10³Copy/10⁶Cell, average virus carrying capacity of the parental virus MDV in feather pulp are 4.5 × 10³Copy/10⁶Carefully Born of the same parents, the two does not have significant difference (P>0.05) (as shown in figure 19).

5.3.2 the detection of IBDV antibody titers

By rMDV-VP2 with 2000PFU/ 1 age in days SPF chicken of dose inoculation, take a blood sample weekly after immune, detection IBDV is special Property ELISA antibody, as a result as shown in figure 20.The last fortnight after immune, all immune chickens can't detect antibody.Exempt within three weeks after immune Epidemic disease chicken serum antibody starts to turn sun；4 weeks after immune, antibody titer continues to raise, and ELISA antibody positive rates reach 80%, average Antibody titer is 680 (Figure 20).The testing result of neutralizing antibody shows, 4 weeks after being immunized, all immune chickens produce IBDV neutralizations Antibody positive rate 100%, average neutralizing antibody titers are 2^8_.2(Figure 20).

5.3.3 IBDV attacks test chicken survival rate and clinical symptoms after poison

Malicious HLJ0504 plants of IBDV virulents are attacked within 4 weeks to each group test chicken after immune, are continuously observed 10 days after attacking poison.As a result Show, attack recombinant virus rMDV-VP2 after poison chicken is immunized and survive completely, survival rate reaches 100% (15/15) (Figure 21), and has no Any clinical symptoms (Figure 21).Test chicken survival rate is only 13% (2/15) after parent's poison MDV immune groups attack poison, it is seen that obvious IBD clinical symptoms.

5.3.4 IBDV tests chicken bursa atrophy situation after attacking poison

By test chicken after poison is attacked 10 days dissects, it turns out that, all test chickens of recombinant vaccine strain rMDV-VP2 immune groups The bursa of farbricius does not have atrophy symptom after attacking poison, and tumour ratio (F/B) does not have notable difference (P with blank control group test chicken>0.05)； And parent's poison MDV immune group test chickens attack the visible obvious atrophy of the bursa of farbricius after poison, tumour ratio is significantly lower than blank control group (P< 0.05).The statistical result of bursal index (BBIX) shows that BBIX is all higher than 0.7 after rMDV-VP2 immune group test chickens attack poison, Further illustrate that its bursa of farbricius does not have atrophy phenomenon；However, the bursa of farbricius that chicken attacks after poison 2 chickens to survive is immunized in parent's poison MDV Index is respectively less than 0.7, illustrates that atrophy (Figure 22) occurs in its bursa of farbricius.

5.3.5 IBDV tests chicken bursal disease reason situation of change after attacking poison

Chicken bursa sample preparation pathological section will be tested, carries out Histopathology detection, each experiment chicken bursa Histopathology testing result and lesion score value, as shown in figure 23.The result shows that the HBLS of rMDV-VP2 immune group test chickens points Value is no more than 1, wherein 8 chicken HBLS marking are 0 (i.e. no any pathological change), 7 chicken HBLS marking are (rarely seen solid for 1 Have the slight oedema of layer, without other pathological changes) (Figure 23), further confirming that chicken is immunized in recombinant virus rMDV/IBDV-VP2 can be with Reach complete protection.15 test chickens, 13 death in parent's poison MDV immune groups, remaining 2 experiments chicken bursal disease reason Histology shows that its bursa of farbricius lymph follicle atrophy, lymphocyte substantially reduces (HBLS 5.0), illustrates parent's poison MDV Immune chicken cannot be protected.

5.4 recombinant virus rMDV-VP2 attack malicious protecting effect to MDV's

To determine whether foreign gene can influence the immune protection effectiveness of recombinant virus to MDV in itself after being inserted into, use respectively 1 age in days SPF chickens of recombinant virus rMDV-VP2 and 814 vaccine immunity of parental virus, it is immune after 7 days with highly virulent strain Md5 plants carry out Poison is attacked, attacks after poison continuous observation experiment group and the morbidity of control group test chicken and death condition to attacking after poison 12 weeks.It is the results show that non- Occur typical MD clinical symptoms after immunized controls group test chicken attack MDV virulents, the death rate is fallen ill up to 80% (16/20) 4 control group test chickens for terminating still to survive to experiment afterwards are observed that characteristic cancer pathology changes through pathological examination (table 2).And rMDV-VP2 recombinant viruses immune group and 814 parental virus immune group test chickens attack and do not occur any clinical condition after poison Shape and microscopic lesion, protective index reach 100%, illustrate that recombinant virus is not affected by influence to the immune protection effectiveness of MDV.

Immune protection effectiveness result of the tests of the 2 recombinant virus rMDV-VP2 of table to MDV

In conclusion chicken, which is immunized, in rMDV-VP2 can produce significant IBDV specific antibodies and neutralizing antibody.rMDV- VP2 is immunized after chicken attacks malicious IBDV virulents, and test chicken survives and has no any IBD clinical symptoms completely；The bursa of farbricius has no atrophy, And without obvious pathological change, completely protection can be provided the attack of IBDV virulents.Meanwhile rMDV-VP2 be also capable of providing it is good The good immune effect to MDV.

Claims

1. express infectious bursal disease virus VP 2 gene recombination chicken Marek's disease virus vaccine strain, it is characterised in that be by Expression frame CAG-VP2 comprising infectious bursal disease virus VP 2 gene and CAG promoter sequences is inserted into chicken Marek's disease The US2 gene internals of 814 plants of virus attenuated vaccine, obtain the recombinant paramyxovirus in US2 gene internals insertion CAG-VP2 expression frames Grain, the recombination chicken Marek's disease virus vaccine strain of expression infectious bursal disease virus VP 2 gene is obtained by its rescue, wherein, The US2 gene delections nucleotide of wherein the 15th to 630, is instead inserted into CAG-VP2 expression frames, the CAG-VP2 The structure for expressing frame is cmv enhancer-Chickenβ-actin promoter-VP2 genes-sv40PolyA, the CAG-VP2 expression The nucleotides sequence of frame is classified as shown in SEQ ID NO.1.

2. the recombination chicken Marek's disease virus vaccine of expression infectious bursal disease virus VP 2 gene as claimed in claim 1 Strain, it is characterised in that the recombination chicken Marek's disease virus vaccine strain of the expression infectious bursal disease virus VP 2 gene, RMDV-VP2 is named as, is deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center, its culture presevation is compiled Number it is：CGMCC No.12009.

A kind of 3. restructuring chicken Marek's disease disease of the expression infectious bursal disease virus VP 2 gene built described in claim 1 The method of toxic vaccine strain, it is characterised in that comprise the following steps：

The system include 5 difference successively containing 814 pnca gene group of marek's disease virus attenuated vaccine 1-47873, The restructuring of 40028-79118,72447-113806,106337-139612 and 129115-172541 nucleotide sequences Clay, wherein the GeneBank accession number of described 814 plants of whole genome sequences of marek's disease virus attenuated vaccine is JF742597,5 recombinant cosmids in the system are by by 814 pnca gene group 1- of marek's disease virus attenuated vaccine 47873,40028-79118,72447-113806,106337-139612 and 129115-172541 nucleotides sequences What row obtained after being connected with pCC1Fos carriers, p814-1, p814-2, p814-3, p814-4 and p814-5 are respectively designated as, Wherein p814-5 includes the US2 genes of marek's disease virus, and the nucleotide sequence of US2 genes is as shown in SEQ ID No.2；

US2 gene internals insertion CAG-VP2 in the recombinant cosmid p814-5 that step (1) structure obtains expresses frame and replaces 15th to 630 nucleotide of US2 genes obtains the recombination mutation clay p814-5US2VP2 containing CAG-VP2 expression frames, The structure of CAG-VP2 expression frames is cmv enhancer-Chickenβ-actin promoter-VP2 genes-sv40PolyA, the CAG- The nucleotides sequence of VP2 expression frames is classified as shown in SEQ ID NO.1；

To obtained five clays of recombinant cosmid p814-1, p814-2, p814-3, p814-4 and p814-5US2VP2 into line Propertyization processing, by calcium phosphate transfection method by five clay cotransfection second generation CEF, is placed in 37 DEG C of incubators and cultivates, and transfects After 4h, cell conditioned medium is discarded, is washed cell one time with DMEM；2ml glycerol shock liquid is added, is incubated at room temperature 2min；Washed with DMEM After washing 3 times, add the DMEM complete culture solution cultures containing 10%FBS, after the 12h that suffers a shock, by cell culture fluid be changed to containing 3%FBS, 1% dual anti-DMEM continues to cultivate, after transfection 4-5 days 2 generation of blind passage the appearance of cytopathy can be observed, the restructuring saved out is sick Poison is the recombination chicken Marek's disease virus vaccine strain for expressing infectious bursal disease virus VP 2 gene.

4. the recombination chicken Marek's disease virus vaccine of the expression infectious bursal disease virus VP 2 gene described in claim 1 or 2 Purposes of the strain in prevention and treatment chicken Marek's disease and Bursal Disease medicine is prepared.