CN102363769B

CN102363769B - Chicken Marek's disease Meq gene deleted vaccine strain, construction method thereof, and application thereof

Info

Publication number: CN102363769B
Application number: CN 201110307837
Authority: CN
Inventors: 刘长军; 张艳萍; 李志杰
Original assignee: Harbin Veterinary Research Institute of CAAS
Current assignee: Harbin Veterinary Research Institute of CAAS
Priority date: 2011-10-12
Filing date: 2011-10-12
Publication date: 2013-09-11
Anticipated expiration: 2031-10-12
Also published as: CN102363769A

Abstract

The invention discloses a chicken Marek's disease (MD) Meq gene deleted vaccine strain, a construction method thereof, and an application thereof. The chicken Marek's disease rMS delta Meq gene deleted vaccine strain has a microbe reservation number of CGMCC No. 4612. According to the invention, on a basis of a parent strain which is MDV MS strain, a 468bp base sequence on a front part of a main oncogene is deleted thorough two times of homologous recombination, such that the chicken Marek's disease Meq gene deleted vaccine strain is obtained. The invention also relates to the application of the gene deleted vaccine strain in preparation of medicine used for controlling chicken Marek's disease, and in detection and disgnosis methods used for distinguishing a vaccine strain and a chicken Marek's disease wild strain, wherein the methods are designed aiming at the deleted gene sequence of the gene deleted strain. The gene deleted vaccine strain provided by the invention has good safety and good immuno-protection effect upon chicken Marek's diseases. The vaccine strain can be used for preparing monovalent vaccines or combined vaccines used for controlling chicken Marek's disease.

Description

The strain of chook MDV Meq gene-deleted vaccine, its construction process and application

Technical field

The present invention relates to a kind of because the attenuated vaccine strain that genetically deficient obtains relates in particular to the strain of chicken Marek's disease virus Meq gene-deleted vaccine, also relate to its application in preparation control chicken Marek's medicine, belong to biomedicine field.

Background technology

Chicken Marek's disease (MD, Marek ' s Disease) is to cause by infecting Marek poison (MDV, Marek ' s Disease virus), is a kind of hyperinfection, neoplastic disease of serious harm aviculture development.This disease can cause chicken generation malignant lymphoma, causes chicken depletion, death.Damage the immune organ of chicken body simultaneously, produce serious immunosuppression, easy concurrent other diseases.This disease course of disease is longer, and this takes place often causes eliminating of whole chicken group after being ill, in case this disease takes place, loses often huge especially.Vaccine is the main means of this disease of control, and the MD vaccine is the vaccine that must use in breeder flock, laying hen group, uses this vaccine can improve breed efficient greatly among the broiler chicken group.Cause of disease-Mareks disease virus of MD (MDV) virulence is the trend of continuous evolution.In recent years, along with the more appearance of strong virus force strain of MDV, the appearance of especially special virulent, the currently available vaccines, existing vaccines strain comprises that the HVT of widespread use, CVI988 vaccine strain can not carry out excellent protection to it.In the poulty house of China different areas, MD vaccine immune chicken group often has the generation of MD.Nearest report shows, even use state-of-the art MDV vaccine, some MDV virulent strains can cause that also vaccinated flock is near 50% MD mortality ratio.

Our study group is separated to the MDV of strain more than 20 virulent strain from the poulty house of terrain MD immuning failure recent years continuously; the immune challenge test of part strain is wherein shown; some strain can be broken through the immunoprotection of the CVI988 vaccine of HVT vaccine, HVT+SB1 bivalent vaccine and serum 1 type; the virulence of the wild poison of the proof popular MDV of China is in progressively improve, and existing all MD vaccines all can not provide effective protection.Therefore, press for the new MD vaccine strain of development, so that effective prevention and control MDV.

MDV lacks tumorigenicity forfeiture behind a certain gene, and that its replication does not have is destroyed, and with the MD vaccine of this virus development, its immune protection will be very high.The progress of MDV functional gene was very fast in recent years, the RLORF4 gene of disappearance MDV RB1B strain bacterial artificial chromosomes such as Jarosinski (BAC), the RBIB strain virulence attenuation of in vivo and in vitro after finding to lack; Silva etc. inoculate the SPF chicken with parental virus, also the avirulence reducing tendency in the same manner with 2 copy 132bp tumor-necrosis factor glycoproteins disappearances of Md5 strain.Reddy seminar removes the Meq gene of Md5 strain in order to study the Meq gene function, has made up a strain Meq gene-deleted strain rMd5 Δ Meq.The disappearance strain is stable in growth in vitro, has proved that also the Meq gene is nonessential in the lymphocyte period of infection simultaneously.No matter its immune protective effect is the artificial challenge test in laboratory or simulation field test with commercialization vaccine strain CVI988 if being better than existing, can both bring out high-caliber immune response, can resist the attack of Md5 (vv) and 648A (vv+).Street strain's disappearance Meq gene at different multiplication capacities has very high researching value.

At present the structure of recombinant mdv adopts BAC technology-be that the BAC carrier is inserted into the nonessential site of viral genome more, makes up virus infection clones.Also there are some shortcomings in this method, and the one, in viral genome, inserted foreign gene (BAC composition), there is potential unfavorable factor.The 2nd, viral genome need be bred in prokaryotic cell prokaryocyte and increase in operating process.Because the MDV viral genome is very big, in prokaryotic system, breed the easier transgenation that causes.

This research is on the basis of the biological characteristics of analyzing many strains MDV epidemic isolates that this laboratory in recent years is separated to from terrain, selecting MDV MS strain is parent's strain, adopt genetic engineering means, the method by twice homologous recombination has obtained recombinant virus-rMS Δ Meq.The method of this construction of recombinant virus has been avoided some disadvantageous effects that adopt the BAC technology to bring.This strain has good security to chicken; With this strain immunization chicken, can provide anti-MDV immanoprotection action efficiently.The another one important feature of this vaccine strain is the genetic marker that has genetically deficient, can distinguish vaccine strain and wild strain accordingly, and the MDV that is conducive to the chicken group infects and detects and the immunity monitoring.Simultaneously, also to have preparation be the purposes of the recombinant virus of other foreign proteins of live vector construction expression with it in this gene-deleted vaccine strain.

Summary of the invention

Technical problem to be solved by this invention is the deficiency that overcomes existing attenuated vaccine, provide a kind of and can effectively prevent chicken Marek's disease, and have molecule marker, be beneficial to the wild virus infection of vaccinated flock and the new chicken Marek's disease gene-deleted vaccine strain of immunity monitoring.The vaccine prepared with this vaccine strain can provide the good immune protection effect to the popular chicken Marek's disease virus of present China.

One of technical problem to be solved by this invention has provided a kind of method that makes up the strain of chicken Marek's disease virus Meq gene-deleted vaccine, method of the present invention is characterized in that: the strain of described Meq gene-deleted vaccine is to obtain through twice homologous recombination on the basis of parent's strain MDV MS strain, and for the first time homologous recombination is to obtain the intermediate virus strain by the base sequence of 468bp that inserts reporter gene lacZ and replace the first half of main oncogene Meq gene simultaneously on the basis of parent's strain MDV MS strain; By the second time homologous recombination remove the reporter gene that inserts in the intermediate virus strain, namely get the strain of described Meq gene-deleted vaccine, the base sequence of the first half 468bp of described Meq gene is shown in SEQ ID NO.1.

In a specific embodiment of the present invention, make up the method for chicken Marek's disease virus Meq gene-deleted vaccine strain, concrete may further comprise the steps:

(1) structure of transfer vector

With reference to the strong malicious GA strain genes involved sequence of having delivered of MDV, the GeneBank accession number is No.AF147806, Segment A, B at Meq gene both sides have designed primer respectively to Primer A and Primer B, and Segment A, B are as the homologous sequence that makes up metastasis transplanting physique grain;

Described primer is as follows to Primer A and Primer B sequence:

Primer A upstream primer: 5 ' CCGGCATGCGCCCTCCGTATAATGTAAAT 3 '

Downstream primer: 5 ' GTCGACTGCCCGCCTTCTCCCTGGTAT 3 '

Primer B upstream primer: 5 ' GTCGACACTCCTCCACCTCCCTCAC 3 '

Downstream primer: 5 ' GCGAGCTCGAATGTCCATCCTGTTATCT 3 '

DNA is template with MDV MS pnca gene group, obtains Meq gene fragment A by PCR method, cuts through Sal I and Sph I enzyme, is connected with pUC19, obtains plasmid pUCA; Pcr amplification obtains Meq gene fragment B, after Sal I and Sac I enzyme are cut, is connected among the pUCA, obtains plasmid pUCAB; Cut the LacZ expressing gene box that obtains through the SalI enzyme, be connected in the pUCAB plasmid, obtain plasmid pALacZB;

(2) homologous recombination for the first time: the total DNA of MDV MS pnca gene group and metastasis transplanting physique grain pALacZB cotransfection chick embryo fibroblast, obtain chicken Marek's disease virus Meq genetically deficient intermediate virus strain by the base sequence that inserts reporter gene lacZ and replace the first half 468bp of main oncogene Meq gene simultaneously on the basis of parent's strain MS strain, the base sequence of the first half 468bp of described Meq gene is shown in SEQ ID NO.1;

(3) homologous recombination for the second time: the genome DNA and the metastasis transplanting physique grain pUCAB cotransfection chick embryo fibroblast that adopt the chicken Marek's disease virus Meq genetically deficient intermediate virus strain that homologous recombination obtains through the first time, screening obtains removing the Meq gene-deleted vaccine strain of the reporter gene that inserts in the intermediate virus strain, namely gets the strain of described chicken Marek's disease virus Meq gene-deleted vaccine.

Wherein said parent's strain MDV MS strain is (referring to document: structure and the growth in vitro rule thereof of the strain of marek's disease virus miRNA disappearance, Yang Wen rushes, Liu Changjun etc., China veterinary science .2011,41 (03)) provided by the preservation of veterinary institute fowl transmissible disease research department, Harbin.) characteristics of this strain are: (1) has more highly pathogenic to chicken; (2) strong at the inside and outside multiplication capacity of chicken body; (3) behind the infection chicken, the chicken disease time early.

Two of technical problem to be solved by this invention has provided the chicken Marek's disease virus Meq gene-deleted vaccine strain that is prepared by described method.And

The chicken Marek's disease virus Meq genetically deficient intermediate virus strain that is prepared by described method.

Obtained the described gene-deleted vaccine strain of a strain by specific embodiments of the invention, called after rMS Δ Meq, classification called after avian herpetoviruses 2 types (Gallid herpesvirus 2) of suggestion, be deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center, its microbial preservation numbering is: CGMCCNo.4612.The address is in Yard 1, BeiChen xi Road, Chaoyang District, Beijing City institute of microbiology of the Chinese Academy of Sciences, and preservation date is on February 24th, 2011.

Three of technical problem to be solved by this invention has provided the purposes of described chicken Marek's disease virus Meq gene-deleted vaccine strain in preparation control chicken Marek's medicine.

It is a kind of vaccine composition that four of technical problem to be solved by this invention provides, and it is characterized in that being made up of carrier or the adjuvant of the strain of described Meq gene-deleted vaccine and pharmaceutically acceptance.

Five of technical problem to be solved by this invention has provided a kind of for the method for distinguishing gene-deleted vaccine strain of the present invention and Mareks disease virus street strain, it is characterized in that with the sequence shown in the SEQ ID NO.1 as template sequence, carry out pcr amplification by the design primer and detect.

Preferably, described primer is as follows to sequence:

5‘GGGAAATGACAGGTGAATTGTG?3’

5‘GCAGGAAAATTTGTTACCCCAG?3’

Construction strategy and the technical characterstic of the chicken Marek's disease gene-deleted vaccine strain among the present invention: at first, this research adopts twice recombinant technology to make up.Construction strategy is that at first the application report gene replaces the target deletion sequence, and then disappearance is fallen reporter gene.The advantage of this method is: lack in the operating process of goal gene in viral genome, do not introduce any other exogenous gene sequence, avoided because the negative impact that the insertion of exogenous genetic fragment brings.The entire operation process is all carried out under eukaryotic system simultaneously, can effectively improve virus genomic fidelity.These two aspects characteristics all are very favorable to the gene-deleted vaccine that makes up MDV.

Secondly, in the selection for deletion fragment, selection is carried out recombination deficient to the base sequence of the first half 468bp of main oncogene Meq gene.This is because the ORF of the open reading frame (ORF) of Meq gene and a coding 23KD albumen has partly oppositely overlapping, in order not influence the expression of this 23KD albumen, only lacked the base sequence of the first half 468bp of Meq gene ORF, destroy its ORF, and don't influence other gene structure.

The chicken horse Garrick gene-deleted vaccine strain that the present invention obtains, but genetic stability, to the chicken no pathogenicity, and can be used as vaccine and provide effective immanoprotection action to the attack of MDV virulent.In preparation control chicken Marek's disease vaccine, have been widely used.

In addition, the chicken Marek's disease virus Meq gene-deleted vaccine strain among the present invention and the chicken Marek's disease genetically deficient intermediate virus strain of expressing the disappearance Meq gene of LacZ gene can be used as other foreign proteins of virus of live vaccine vector expression.Because in oneself genome through being inserted into chicken Marek's disease genetically deficient intermediate virus strain fully of LacZ gene, and can this albumen of continuous expression, the LacZ gene can be directly as the mark that oppositely screens, the method that adopts homologous recombination, gene to replace, insert other foreign genes, express the albumen of other pathogenies, for the vaccine of developing other poultry diease bigger using value is arranged.

Therefore, another technical problem to be solved by this invention chicken Marek's disease genetically deficient intermediate virus strain of disappearance Meq gene of having provided chicken Marek's disease virus Meq gene-deleted vaccine strain or having expressed the LacZ gene is as the purposes in the recombinant virus of other foreign proteins of live vector construction expression.

Technical problem to be solved by this invention is achieved through the following technical solutions:

The recombinant mdv scheme of disappearance MDV Meq Gene Double copy of the present invention is composed of the following components: recombinant virus transferring plasmid structure, calcium phosphate transfection method carry out homologous recombination, recombinant virus plaque screening purifying, recombinant virus evaluation and biological property analysis.

The vaccine strain preparation of disappearance MDV Meq Gene Double copy among the present invention may further comprise the steps:

1, the recombinant virus metastasis transplanting physique grain makes up

Design and synthesize for amplification homology arm and recombinant virus primers designed, obtain the upstream and downstream homology arm A, B fragment of Meq genetically deficient position by PCR method after, A fragment and B fragment are cloned in the pUC19 plasmid successively, obtain plasmid pUC-AB, the LacZ expression cassette is connected among the positive plasmid pUC-AB, cut evaluation through PCR and enzyme, obtain plasmid pALacZB.Make up thus and obtained 2 metastasis transplanting physique grain pUC-AB, pALacZB, be used for construction of recombinant virus.

2, calcium phosphate transfection method carries out homologous recombination

The total DNA of MDV MS pnca gene group and metastasis transplanting physique grain DNA calcium phosphate precipitation method cotransfection chick embryo fibroblast (CEF).Concrete grammar is as follows: will grow up to the CEF of individual layer, and be passaged to Tissue Culture Dish after the digestion.The CEF genome DNA, plasmid pALacZB, TE damping fluid, the 2molL that in aseptic 1.5mL centrifuge tube, add deionized water, MS strain infection ^-1CaCl ₂Behind the mixing, slowly add 2 * HEPES again, hatch after 30min is packaged into fine particle, resuspended, join for cell prepare CEF time, cultivate 2h after, the processing of suffering a shock.Being cultured to MDV typical case plaque appears and after, carry out plaque clone and purifying.

3, recombinant virus plaque screening purifying

With calcium phosphate precipitation method cotransfection CEF, be cultured to MDV typical case plaque appears and after, add X-Gal, carry out blue hickie screening.Select blue plaque to carry out clone purification, take turns plaque purification through 10, the final plaque that forms all be blueness.Identify correct virus, called after behind the purifying: rMS-LacZ Δ Meq through order-checking.Carry out the reorganization second time on this basis and remove LacZ, called after: rMS Δ Meq.

4, recombinant virus is identified

Extract rMS Δ Meq according to a conventional method and infect the total DNA of CEF, LacZB identifies with primer, and the MS strain can not amplify the result, and rMS Δ Meq strain amplification conforms to expection, has proved the correct position of LacZ reorganization.Identify that with primer ALB parent MS strain amplification size is 656bp, the about 4400bp of reorganization rMS Δ Meq conforms to expection.Thereby two Meq genes of proof recombinant virus rMS Δ Meq all lack.

5, biological property analysis

5.1 genetic stability

Under identical culture condition, cultivate parental virus MS strain and recombinant virus rMS Δ Meq strain respectively, microscopically is observed 2 strain growth in vitro characteristics, observes the changing conditions that leading indicator has plaque size, refractivity, shape and form.Reorganization poison behind the purifying continues continuously on CEF and passed for 10 generations, and each generation all with X-Gal dyeing, is observed plaque and whether is blueness.When virus was passaged to for 5 and 10 generations, carry out PCR with the detection primer and detect, whether two Meq genes that detect recombinant virus rMS Δ Meq lack.

5.2 multiplication characteristic

For analyzing virus multiplication characteristic in vivo and in vitro, SPF chicken and CEF are inoculated in parental virus MS strain and recombinant virus rMS Δ Meq strain respectively, the every hole 10PFU of 24 porocyte culture plates, SPF chicken 2000PFU/ only, the cell of inoculation respectively at inoculation back 1,2,3,4,5 and 7d after collecting cell, the SPF chicken is in

inoculation

1,2,3,4,6 weeks of back, gather feather pulp, extract feather pulp, extract cell and feather pulp DNA, carry out the viral level in the real-time fluorescence quantitative PCR detection feather pulp, draw the kinetic curve of viral growth, analyze the growth rhythm of virus.

5.3 pathogenic to chicken

The SPF chicken is divided into two groups at random, every 20000PFU of first group of abdominal cavity inoculation recombinant virus rMS Δ Meq, the second winding kind equivalent 0.2mL PBS is as negative control.The inoculation back is observed the mental status of chicken every day and is had or not the Marek clinical symptom, all cut open after 15 ages in week and kill, the observation experiment chicken has or not the MD symptom: tissues such as skin, sciatic nerve, glandular stomach, liver, kidney, spleen, French capsule, thymus gland have or not pathology, and chorista are carried out pathology detect.

5.4 anti-marek's disease virus immunogenicity is analyzed

Analyze the immunogenicity of this recombinant virus; itself and 814 strains of domestic vaccine strain are attacked poison protection experimental analysis; be about to recombinant virus rMS Δ Meq and 814 strains and inoculate 1 age in days SPF chicken; inoculate back 7 days inoculation virulent Md5 and attack poison; observe and record the body weight change situation of chicken in experiment chicken clinical symptom, death condition and the experimental period every day, and calculate vaccine protection index.

Description of drawings

Fig. 1 is vector plasmid pALacZB synoptic diagram provided by the invention;

Fig. 2 cuts qualification result for plasmid pALacZB enzyme provided by the invention;

Fig. 3 is the plaque coloration result of recombinant virus rMS-LacZ Δ Meq provided by the invention on CEF;

Fig. 4 is the PCR qualification result of the Meq genetically deficient of recombinant virus rMS-LacZ Δ Meq provided by the invention;

Fig. 5 is recombinant virus genomes Meq gene copy number PCR qualification result provided by the invention;

Fig. 6 is the Meq gene PCR qualification result of recombinant virus rMS Δ Meq provided by the invention and parental virus;

Fig. 7 is parent poison MS provided by the invention and recombinant strain rMS growth curve detected result on CEF;

Fig. 8 is the real-time fluorescence quantitative PCR detected result of the replication of recombinant virus provided by the invention in the chicken feather pulp;

Fig. 9 is recombinant virus immunoprotection efficiency test result provided by the invention.

Embodiment

Further illustrate beneficial effect of the present invention by the following examples, it should be understood that these embodiment only are used for the purpose of illustration, never limit the scope of the invention.

Embodiment 1 recombinant virus transferring plasmid makes up:

1, test materials: MDV MS strain is (referring to document: structure and the growth in vitro rule thereof of the strain of Mareks disease virus miRNA disappearance, Yang Wen rushes, Liu Changjun etc., China veterinary science .2011,41 (03)), MDVMd5 is (referring to document: Marek poison highly virulent strain (Md5, RB1B) virulence test, sweet military discipline Liu Xiu Wu of ancient India is long new, the China collection of thesis .2002 of the ten scientific seminar of animal and veterinary disease of poultry branch of association), 814 strains of Marek's disease virus are (referring to document: Marek's disease virus 814 strain gE, gI, the clone of gp82 gene and sequential analysis. Zhang Yanping, Liu Changjun etc. the animal science progress, 2007 (3)) preserved by veterinary institute fowl transmissible disease research department, Harbin, provide; No-special pathogen (SPF) chicken embryo, chicken are provided by Harbin veterinary institute animal center; Bacillus coli DH 5 alpha is that Harbin veterinary institute Experimental Animal Center is preserved.PUC19 buys from TaKaRa (Dalian) company.

2, test method

1) primer design is with synthetic: with reference to the strong malicious GA strain genes involved sequence of having delivered of MDV (No.AF147806), designed primer respectively to Primer A and Primer B, at the Segment A of Meq gene both sides, B as the homologous sequence that makes up metastasis transplanting physique grain.On the LacZ gene, whether the downstream is on reorganization arm B, for the identification of recombinating to the upstream of LacZB for primer; On reorganization arm A, the downstream is on reorganization arm B, for the identification of disappearance position and number to the upstream of ALB for primer.If if primer ALB amplification size 660bp shows not disappearance of Meq gene, if the amplification size is inserted the predetermined position for 4288bp shows LacZ; The upstream of primer Meq, the downstream lays respectively at the both sides of Meq gene, the PCR that is used for recombinant vectors rMS-LacZ Δ Meq identifies, detection for parental virus MS strain, because meq gene complete, therefore the amplified fragments size is about 1.4Kb, it has lacked the 468bp (nucleotide sequence shown in the SEQ ID NO.1 for recombinant strain rMS Δ Meq, the chook MDV Meq gene nucleotide series of disappearance, specific as follows: 5 ' CGGTACAGGTGTAAAGAGATGTCTCAGGAGCCAGAGCCGGGCGCTATGCCCTACAG TCCCGCTGACGATCCGTCCCCCCTCGATCTTTCTCTCGGGTCGACTTCGAGACGGA AAAAAAGGAAAAGTCACGACATCCCCAACAGCCCCTCCAAACACCCCTTCCCTGAC GGCCTATCTGAGGAGGAGAAACAGAAGCTGGAAAGGAGGAGAAAAAGGAATCGTGA CGCCGCTCGGAGAAGACGCAGGGAGCAGACGTACTATGTAGACAAACTCCATGAAG CATGTGAAGAGCTGCAGAGGGCCAATGAACACCTACGTAAGGAAATTCGAGATCTA AGGACTGAGTGCACGTCCCTGCGTGCACAGTTGGCTTGTCATGAGCCAGTTTGCCC TATGGCGGTACCCCTAACGGTGACCCTTGGACTGCTTACCGCCCCGCACGATCCCG TTCCTGAACCTCCCATTTGC 3 '), amplification is about 1kb.Primer is given birth to worker's biotechnology company limited by Shanghai and is synthesized.Primer title and sequence are as shown in table 1:

The primer sequence of table 1 construction of recombinant virus provided by the invention

2) preparation of dna profiling: the SPF chicken embryo of 9 ages in days prepares chick embryo fibroblast (CEF) according to a conventional method.With MDV MS strain inoculation CEF, 37 ℃ of 5mL/L CO ₂Cultivate in the incubator, after the pathology rate reaches 80%, with the cell dissociation results, extract total DNA according to a conventional method, with TE (pH7.4) dissolving of proper volume.

3) homologous fragment amplification and reclaiming: be that template increases with the total DNA of the viral genome of said extracted.Reaction system is 25 μ L: ultrapure water 17.5 μ L, 10 * PCR reaction buffer, 2.5 μ L, dNTP (10mmolL-1) 1 μ L, each 1 μ L of upstream and downstream primer (10pmolL-1), rTaq enzyme (5U μ L-1) 1 μ L, DNA 2 μ L (0.5 μ g μ L-1).Two PCR reaction conditionss are: 94 ℃ of sex change 5min, and 94 ℃ of sex change 1min then, 57 ℃ of annealing (58 ℃ of B segment annealing) 1min, 72 ℃ are extended 1min, 30 circulations, last 72 ℃ are extended 10min.1.0% agarose electrophoresis of amplified production through containing bromination second pyridine (EB) identified.Identify that correct product carries out the fragment gel and reclaims.

4) structure of metastasis transplanting physique grain: DNA is template with MDV MS pnca gene group, obtains Meq upstream region of gene fragment homology arm A by PCR method, cuts through Sal I and Sph I enzyme, is connected with pUC19, obtains plasmid pUCA; Pcr amplification obtains the B fragment, after Sal I and Sac I enzyme are cut, is connected among the pUCA, obtains plasmid pUCAB.Cut the LacZ expressing gene box that obtains through Sal I enzyme, be connected in the pUCAB plasmid, obtain plasmid pALacZB (as shown in Figure 1), the plasmid enzyme restriction qualification result as shown in Figure 2.Extract plasmid with extraction reagent kit in the Qiagen plasmid, the pH value is 7.4 TE dissolving, and-20 ℃ of preservations are standby.

Acquisition and the evaluation of embodiment 2 recombinant viruses-rMS Δ Meq

Reorganization for the first time: 1) cotransfection: the total DNA of MDV MS pnca gene group and metastasis transplanting physique grain pALacZB calcium phosphate precipitation method cotransfection CEF, concrete grammar is as follows: the preparation chick embryo fibroblast, when growing up to the CEF of individual layer in the 24h, go down to posterity after the digestion Tissue Culture Dish of diameter 60mm, the CEF inoculum size is each ware 9 * 10 ⁶Individual.At first the deionized water 388 μ L with nuclease free join in the 1.5mL centrifuge tube of cleaning sterile; Add CEF genome DNA (0.8 μ g μ L-1) 10～18 μ L and plasmid pALacZB (1 μ g μ L-1) 2 μ L that prepared MS strain is infected again successively; Add 30～36 μ L TE (pH7.4); Slowly add 62 μ L 2molL-1CaCl ₂, slow mixing; Slowly add 2 * HEPES, 500 μ L from the bottom with the 1mL pipettor, blow about 20 bubbles from the bottom with the micropipet of 200 μ L ranges and make its mixing, place in 37 ℃ of incubators and hatch 30min, be packaged into tiny deposit seeds therebetween; Calcium phosphate DNA is blown and beaten gently resuspended, evenly add to for cell surface prepared CEF time, jiggle Tissue Culture Dish several times, at this moment nutrient solution presents yellowish-orange, puts 37 ℃ of 5%CO ₂Incubator 2～3h; Outwell the upper strata nutrient solution, with the nutrient solution of serum-free or with aseptic PBS damping fluid flushing 3 times, add 15% glycerol shock liquid 2mL and make its shock 90s, wash 3 times with the nutrient solution of serum-free or with aseptic PBS damping fluid again; Add 3% foetal calf serum nutrient solution and promote that cell grows into individual layer, put 37 ℃ of 5%CO ₂Cultivate in the incubator, whole process is all operated under aseptic condition.When cultivating general 4～6d, wait to occur horse Garrick typical case plaque after, carry out next step clone and purifying, the plaque result of recombinant virus rMS-LacZ Δ Meq provided by the invention on CEF as shown in Figure 3.

2) plaque of recombinant virus clone and purifying: after treating that plaque occurs, be placed under the inverted microscope and observe in turn, prevent omission.Outwell nutrient solution and add 2mL 3% and keep liquid, adding 20 μ L X-Gal (20mgmL-1), to make its total concn be 0.2mgmL-1,37 ℃, and 5%CO ₂The middle 2h that cultivates selects blue plaque to digest clone purification.Drip 0.25% pancreatin at the plaque of irising out, digested several minutes, draw several following with the rifle point, pick up Digestive system, add and to grow up in the chick embryo fibroblast of individual layer, sucking-off is partly kept liquid and is washed plaque that iris out and digestion in the long plate that monolayer cell arranged, and adds to grow up in the chick embryo fibroblast of individual layer, 37 ℃, 5%CO ₂Continue to cultivate, after waiting to grow plaque, purifying again.All plaques all are blue up to the clone back.

3) evaluation of recombinant virus: the recombinant virus of plaque purification is inoculated on the former generation CEF, treated the plaque 70% o'clock harvested cell of growing, extract total DNA by method on the molecular cloning.Increase with LacZB primer and ALB primer respectively, reaction system is 25 μ L: ultrapure water to 17 μ L, 0 * PCR reaction buffer, 2.5 μ L, dNTP (10mmolL-1) 1 μ L, each 1 μ L of upstream and downstream primer (10pmol), rTaq enzyme (5U μ L-1) 1 μ L, recombinant virus dna 2 μ L (0.5 μ g μ L-1).Two PCR reaction conditionss are: 94 ℃ of sex change 5min, and 94 ℃ of sex change 1min then, 57 ℃ of annealing (58 ℃ of the annealing temperatures of primer ALB) 1min, 72 ℃ of extensions (the extension time 4min of primer ALB) 1min, 30 circulations, last 72 ℃ are extended 10min.The PCR product connects the pMD-18T carrier, and bacterium liquid is served the order-checking of extra large handsome Bioisystech Co., Ltd and further identified, through the viral nomenclature of order-checking purification Identification is: rMS-LacZ Δ Meq.The PCR that recombinant virus rMS-LacZ Δ Meq uses primer LacZB to carry out detects, and qualification result obtains and expects band of the same size (1300bp) as shown in Figure 4.

Meq genetically deficient copy number is identified, identifies with primer ALB, and parent MS strain amplification size is about 656bp, the about 4388bp of rMS-LacZ Δ Meq that recombinates, the result as shown in Figure 5, swimming lane 1:DL2000 molecular mass standard; Swimming lane 2: parent's Meishan strain; Swimming lane 3: recombinant strain; Swimming lane 4: feminine gender; Swimming lane; 5:DL1000 molecular mass standard, the result: size conforms to expection, illustrates to make up correctly, proves that also two Meq genes of recombinant virus rMS-LacZ Δ Meq all lack simultaneously.

Reorganization for the second time: method is reorganization for the first time together, adopts the MDV rMS-LacZ Δ Meq total DNA of pnca gene group and metastasis transplanting physique grain pUCAB during cotransfection, thus the recombinant virus rMS Δ Meq strain that obtains to lack Meq and do not have LacZ.

RMS Δ Meq virus strain authentication method: extract rMS Δ Meq according to a conventional method and infect the total DNA of CEF, carry out pcr amplification with the Meq primer, the clip size that parental virus MS strain F5 detects is 1.4Kb, the malicious rMS Δ Meq strain F25 that recombinates is 1Kb for amplification, no 1.4Kb band, as shown in Figure 6, swimming lane 1:rMS Δ Meq strain; Swimming lane 2,3: parental virus MS; Swimming lane 4:DL2000 molecular mass standard, result: conform to expection, prove that two Meq genes of reorganization poison all lack.Sequencing result shows the preceding 468bp disappearance of Meq gene ORF, conforms to the expected results of test design.

Embodiment 3 recombinant virus biological characteristicses

1) growth characteristics of recombinant virus detect

In vitro tests: the viral growth curves behind the purifying is drawn, be illustrated in figure 7 as parent poison MS provided by the invention and recombinant strain rMS Δ Meq growth curve detected result on CEF, concrete steps are as follows: recombinant virus rMS Δ Meq and parental virus MS respectively inoculate the 24 porocyte culture plates (every hole 10PFU) of a CEF cell monolayer, inoculate back viral growth 1 respectively, 2,3,4,5 and 7d after, use 0.25% trysinization, piping and druming, collect the cell that infects virus, and be inoculated into respectively on 6 well culture plates of fresh cell monolayer, every day, the collecting cell poison was done 4 repetitions simultaneously; Behind the 6d, microscopically is observed and is recorded the plaque number in each hole, and calculates the total and average plaque number of each day plaque.

In vivo test: parental virus MS strain and recombinant virus rMS Δ Meq strain (are added calf serum 2%, penicillin 100 units/ml, Streptomycin sulphate 100 μ g/ml with vaccine diluent in the newborn Han Shi liquid, pH7.2-7.4) dilution, only inoculate SPF chicken abdominal injection SPF chicken 2000PFU/ respectively, 1,2,3,4 and 6 ages in week after the inoculation, gather feather pulp, extract feather pulp, extract cell and feather pulp DNA, carry out the viral level in the real-time fluorescence quantitative PCR detection feather pulp.Draw the kinetic curve of viral growth, analyze the growth rhythm of virus.

2) genetic stability of recombinant virus rMS Δ Meq detects: parental virus MS strain and recombinant virus rMS Δ Meq strain under the identical growth conditions, examine under a microscope the growth in vitro characteristic, mainly observe the changing conditions of plaque size, refractivity, shape and form.When virus was passaged to for 5 and 10 generations, carries out PCR with the detection primer and detect.

3) pathogenic test: 22 1 age in days SPF chickens are divided into two groups at random, 11 every group, raise in the negative pressure shield retaining chick free choice feeding and drinking-water respectively.Every 20 000PFU of first group of abdominal cavity inoculation recombinant virus rMS Δ Meq (being called for short the recombinant immune group), the second winding kind equivalent 0.2mL PBS is as negative control.The inoculation back is observed the mental status of chicken every day and is had or not horse Garrick clinical symptom, all cut open to enter to go after 15 ages in week and cut open inspection, observation has or not the Mareks disease symptoms: tissues such as skin, sciatic nerve, glandular stomach, liver, kidney, spleen, French capsule, thymus gland have or not pathology.Doubtful tissue is carried out pathology to be detected.Behind the

abdominal injection

1,2,3,4,6,7 and 15 ages in week, the feather pulp of 5 chickens of random acquisition carries out the AGP detection and extracts feather pulp DNA respectively, utilizes the viral level in the real-time fluorescence quantitative PCR detection feather pulp.The duplicating dynamics tracing analysis result of recombinant virus provided by the invention in the chicken feather pulp as shown in Figure 8.

4) the recombinant virus immune protection effectiveness is estimated

160 SPF white of 1 age in days Leghorn is divided into 6 groups at random, wherein preceding 5 groups every group 30, the 6th group 10, the 1st group is recombinant virus rMS Δ Meq immune group (being called for short the recombinant immune group), and the 2nd group is that the superpower MDV Md5 of recombinant immune attacks the poison group, and the 3rd group is 814 virus immunity groups, the 4th group is that the superpower MDV Md5 of 814 virus immunities attacks the poison group, the 5th group is that superpower MDV Md5 directly attacks the poison group, and the 6th group is that the blank group is raised in the negative pressure shield retaining chick free choice feeding and drinking-water respectively.Recombinant virus rMS Δ Meq and 814 virus immunity dosage are every 2000PFU.The toxic agent amount of attacking of the 7th day inoculation virulent Md5 after the immunity is every 1000PFU, abdominal injection.From inoculation, observation every day, record connect breeder flock and have or not abnormal symptom and death condition, and the interior dead chicken of 7d after attacking poison before and attacking poison is not counted.Observe chicken group's situation every day, record chicken group's abnormal conditions and clinical symptom; And to the morbidity chicken cut open inspection, record every chicken clinical symptom and internal organ pathology situation.After attacking malicious 15 weeks, all cut open inspection at last, record clinical symptom and the inner organ disease situation of every chicken.Sum up all clinical symptom and cut open the inspection symptom, determine whether it is MD, and do the biology statistics.Statistics vaccine immunity protection index (PI), result's (as shown in Figure 9) shows that this recombinant virus is suitable with 814 strains protection efficient.

The above only is the preferred embodiments of the present invention, only is illustrative for the purpose of the present invention, and nonrestrictive; Those of ordinary skills understand, and can carry out many changes to it in the spirit and scope that claim of the present invention limits, revise, even the equivalence change, but all will fall within the scope of protection of the present invention.

Claims

1. method that makes up the strain of chicken Marek's disease virus Meq gene-deleted vaccine, it is characterized in that: the strain of described Meq gene-deleted vaccine is to obtain through twice homologous recombination on the basis of parent's strain MDV MS strain, and for the first time homologous recombination is to obtain the intermediate virus strain by the base sequence of 468bp that inserts reporter gene lacZ and replace the first half of main oncogene Meq gene simultaneously on the basis of parent's strain MDV MS strain; By the second time homologous recombination remove the reporter gene that inserts in the intermediate virus strain, namely get the strain of described Meq gene-deleted vaccine, the base sequence of the first half 468bp of described Meq gene is shown in SEQ ID NO.1.

2. the method for structure chicken Marek's disease as claimed in claim 1 virus Meq gene-deleted vaccine strain, it is characterized in that: concrete may further comprise the steps:

(1) structure of transfer vector

With reference to the strong malicious GA strain genes involved sequence of having delivered of MDV, the GenBank accession number is No.AF147806, Segment A, B at Meq gene both sides have designed primer respectively to Primer A and Primer B, and Segment A, B are as the homologous sequence that makes up metastasis transplanting physique grain;

Described primer is as follows to Primer A and Primer B sequence:

Primer A upstream primer: 5 ' CCGGCATGCGCCCTCCGTATAATGTAAAT3 '

Downstream primer: 5 ' GTCGACTGCCCGCCTTCTCCCTGGTAT3 '

Primer B upstream primer: 5 ' GTCGACACTCCTCCACCTCCCTCAC3 '

Downstream primer: 5 ' GCGAGCTCGAATGTCCATCCTGTTATCT3 '

DNA is template with MDV MS pnca gene group, obtains Meq gene fragment A by PCR method, cuts through Sal I and Sph I enzyme, is connected with pUC19, obtains plasmid pUCA; Pcr amplification obtains Meq gene fragment B, after Sal I and Sac I enzyme are cut, is connected among the pUCA, obtains plasmid pUCAB; Cut the LacZ expressing gene box that obtains through Sal I enzyme, be connected in the pUCAB plasmid, obtain plasmid pALacZB;

3. the chicken Marek's disease virus Meq gene-deleted vaccine strain that is prepared by claim 1 or 2 described methods.

4. chicken Marek's disease virus Meq gene-deleted vaccine as claimed in claim 3 strain, it is characterized in that the strain of described Meq gene-deleted vaccine is rMS △ Meq, be deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center, its microbial preservation numbering is: CGMCC No.4612.

5. preparing the purposes of preventing and treating in the chicken Marek's medicine as claim 3 or 4 described Meq gene-deleted vaccine strains.

6. be purposes in the recombinant virus of other foreign proteins of live vector construction expression as claim 3 or 4 described Meq gene-deleted vaccine strains with it in preparation.

7. the chicken Marek's disease virus Meq genetically deficient intermediate virus strain that is prepared by claim 1 or 2 described methods.

8. Meq genetically deficient intermediate virus strain as claimed in claim 7 is purposes in the recombinant virus of other foreign proteins of live vector construction expression with it in preparation.

9. a vaccine composition is characterized in that being made up of the claim 3 of significant quantity or carrier or the adjuvant of 4 described gene-deleted vaccine strains and pharmaceutically acceptance.

10. method of be used for distinguishing claim 3 or 5 described gene-deleted vaccine strains and Mareks disease virus street strain is characterized in that with the sequence shown in the SEQ ID NO.1 carrying out pcr amplification by the design primer and detecting as template sequence.

11. method as claimed in claim 10 is characterized in that described primer sequence is as follows:

5‘GGGAAATGACAGGTGAATTGTG3’

5‘GCAGGAAAATTTGTTACCCCAG3’。