CN103382460B - Strain of Marek's disease virus vaccine strain, and separation and identification and application thereof - Google Patents
Strain of Marek's disease virus vaccine strain, and separation and identification and application thereof Download PDFInfo
- Publication number
- CN103382460B CN103382460B CN201310239720.9A CN201310239720A CN103382460B CN 103382460 B CN103382460 B CN 103382460B CN 201310239720 A CN201310239720 A CN 201310239720A CN 103382460 B CN103382460 B CN 103382460B
- Authority
- CN
- China
- Prior art keywords
- strain
- cvtr
- chicken
- vaccine
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the field of animal virology, and provides a strain of chicken Marek's disease (MD) vaccine strain, and separation and identification and a production process thereof. A strain of MDV named a CVTR strain is separated in a healthy chicken farm that has no immune MD vaccine but where tumor disease does not break out for years, and the separated MDVCVTR strain is found to not induce chicken tumors and have no immune inhibition effect on chicken flocks. The CVTR strain virus in a chicken embryo fibroblast (CEF) or in a chicken body proliferates more quickly than a widely used CVI988/Rispens vaccine strain. The CVTR strain is used as the vaccine prepared by a production virus strain of the Marek's disease live vaccine, is used for preventing chicken Marek's disease induced by the ultra-strong virus MDV, and has a protective immune effect which is obviously superior to the CVI988/Rispens strain vaccine which is most widely applied in domestic and foreign markets at present.
Description
Technical field
The present invention relates to animal virology field, the invention provides the CVTR strain of strain chicken Marek's disease vaccine virus and isolation identification and an application.
Background technology
Marek (Marek ' s disease, MD) be a kind of infectivity neoplastic disease of chicken, be formed as feature with lymphadenosis and tumour.This disease causes by chicken Marek's disease virus (Marek ' s disease virus, MDV), and virus can air-borne transmission, and infectivity is very strong, and when serious, infection rate can reach 100%.MD generally shows as peripheral nerve, sexual gland, iris, various internal organs, muscle and skin generation monocyte infiltration, MDV can cause several functions obstacle and can cause infected chicken to produce tumour and death, also cause chicken group's immunosuppression simultaneously, cause heavy economic losses (Sevoian M to aviculture, Chamberlain DM, Counter FT.Avian lymphomatosis.I.Experimental reproduction of the neural and visceral forms.Vet Med1962; 57:500-1.Biggs PM, Payne LN.Studies on Marek ' s disease.I.Experimental transmission.J Natl Cancer Inst1967; 39:267-80).
Up to the present, also not having effective way to treat MD and suffer from chicken, is to control these pathogenetic unique effective ways by vaccine prevention, and this disease is first neoplastic disease that can prevent with vaccine in the world.According to three of MDV kinds of serotypes, researcher has been developed serum I type, II type and III type vaccine, commercialization MDV vaccine is to cause weak I type CVI988/Rispens strain at present, the II type SB1 strain of no pathogenicity and III type herpes turkey virus (herpesvirus of turkey, HVT) FC126 strain (Rispens BH, Van Vloten J, Mastenbroek N, Maas HJL, Schat KA.Control of Marek ' s disease in the Netherlands.I.Isolation of an avirulent Marek ' s disease virus (strain CVI988) and its use in laboratory vaccination trials.Avian Dis1972, 16:108-25.SchatKA, Calnek BW.Characterization of an apparently nononcogenicMarek ' s disease virus.J Natl Cancer Inst1978, 60:1075-82.Kawamura H, King DJJ, Anderson DP.A herpesvirus isolated from kidney cell culture of normal turkeys.Avian Dis1969, 13:853-63).Along with the appearance of virulent, develop again on this basis divalence, trivalent (multivalence) vaccine (Witter RL.Protection by attenuated and polyvalent vaccines against highly virulent strains of Marek ' s disease virus.Avian Pathol1982; 11:49-62.Schat KA, Calnek BW, Fabricant J.Characterization of two highly oncogenic strains of Marek ' s disease virus.Avian Pathol1982; 11:593-605).In recent years, scientist utilizes the whole bag of tricks to build various MDV candidate strains to attempt to improve the effect of vaccine, but all unsuccessful.For example; Witter and Kreager etc. have compared the protective immunity effect of the new vaccine candidate strain of 10 strains; but result is all unlike CVI988/Rispens strain good (Witter RL and Kreager KS.Serotype1viruses modified by backpassage or insertional mutagenesis:Approaching the threshold of vaccine efficacy in Marek ' s disease.Avian Dis.2004,48:768-782).But according to MDV development law in past more than 40 year, its virulence probably can become stronger at a few years from now on.Obviously, be necessary, before the new pathogenic stronger MDV street strain of protective immunity that can break through CVI988/Rispens strain occurs and comes into vogue, should develop more effective vaccine by new method as soon as possible.
Before more than ten years, just found, when Mareks disease virus (Marek ' s Disease Virus, MDV) with fowl reticuloendotheliosis virus (Reticuloendotheliosis virus, REV), on cell when continuous passage, the terminal repeat (LTR) of REV can be integrated into the genome of MDV.Witter etc. (1997) find that a strain RM1 of MDV inserts REV-LTR sequence, this strain virus can copy in vivo well, relatively high-caliber immune response (Witter also can be provided, Retroviral insertional mutagenesis of a herpesvirus:a Marek ' s disease virus mutant attenuated for oncogenicity but not for immunosuppression or in vivo replication.Avian diseases, 1997,41,407-421).Domestic have a report that is separated to the natural MDV of being integrated into of LTR field strain isolated, research shows, LTR inserts MDV postgenome can increase multiplication capacity and the horizontal transmission ability (Sun of MDV, 2010, Functional evaluation of the role of reticuloendotheliosis virus longterminal repeat (LTR) integrated into the genome of a field strain of Marek ' s disease virus.Virology397,270-276).
Foreign scholar compares one group of candidate vaccine strain with hyperimmunization power and the poor candidate vaccine strain of another group protection, they find, there is often strong (the Gimeno IM of replication in vivo of vaccine strain of height protection, Witter RL, Hunt HD, et al.Biocharacteristics shared by highly protective vaccines against Marek ' s disease.Avian Pathol, 2004, 33:59-68), but how to apply this discovery and obtain the vaccine of better immune effect, all do not realize breakthrough always.
Summary of the invention
The invention provides the virus attenuated strain of a strain chicken Marek's disease, this virus has the homology of height in sequence with CVI988/Rispens strain, but natural Reticulendotheliosus virus (the reticuloendotheliosis virus that integrated of while in its sequence, REV) LTR sequence, therefore this strain is a kind of brand-new chicken Marek's disease virus, contriver finds that this virus all shows the replication higher than CVI988/Rispens strain in CEF cell and chicken body, in the time that the strong poison of MDV infects, can play better immanoprotection action than CVI988/Rispens strain as vaccine.
Contriver names this isolated strain, and biological preservation has been carried out in called after CVTR strain simultaneously, and its deposit number is: CGMCC No.7453.
In the present invention, the LTR sequence of REV is natural to be integrated in MDV, and the region of integration is the nonessential region of viral growth in MDV genome, and the DNA sequence dna mode chart of this recombinant virus as shown in Figure 1.
For above-mentioned CVTR strain, contriver verifies it, finally, except verifying that it is chicken Marek's disease virus, has also verified and has wherein contained LTR sequence:
The CVTR of 100PFU virus quantity, CVI988/Rispens and vv Md5 are inoculated in the CEF cell that has been paved into individual layer on 6 porocyte culture plates.Cultivate after 5d, growth media is outwelled, with acetone: ethanol (V/V, 3: 2) the fixing 5-10min of stationary liquid, use again phosphate buffered saline buffer (PBS) to wash 1 time, in each hole, add 0.5mL (1: 100V/V dilution) MDV serum I type monoclonal antibody, be positioned in 37 DEG C of constant incubators and react 1h, with PBS cleaning 3 times, moisture is dried, add the anti-mouse IgG of 0.5mL FITC mark fluorescence antibody (sigma, by specification configuration effort concentration), be positioned in 37 DEG C of constant temperature biochemical cultivation cases and react 1h, wash 3 times with PBS, moisture is dried, in adding each hole, respectively add 1 50% glycerine (glycerine: PBS solution=1: 1V/V mixes), under inverted fluorescence microscope, observe.The results are shown in Figure 2 and 3, CVTR and control group infect CEF cell plaque and all occurred specificity green fluorescence, show that CVTR of the present invention is MDV serum I C-type virus C.
The both sides design primer CVTR-LTR-F:aaccacagcgtgtctcct of the natural integration site of LTR sequence of the REV in MDV genome, its gene order is as shown in Seq ID No:2; CVTR-LTR-R:acaatgcctactatttcca, its gene order, as shown in Seq ID No:3, is carried out pcr amplification taking CVTR genome as template, and the same terms carries out pcr amplification with the genome of 814 vaccine strains for contrasting with CVI988/Rispens simultaneously.
Result demonstration, the sequence of other Genotype I vaccine strain (comprising CVI988/Rispens and 814 vaccine strains) amplification is 1187bp, and CVTR strain extension increasing sequence is 1725bp (Fig. 4), and its gene order is as shown in Seq ID No:1.Through sequence verification, the fragment of this 1725bp is except containing two pairs of primer sequences, also contain the special sequence of 533bp, sequence is relatively shown in Fig. 5, the sequence of 533bp is passed through after sequence alignment, the LTR homology of finding itself and domestic REV HLJR0901 strain (GenBank:GQ415646.2) is 100%, the natural LTR sequence of having integrated REV in the recombinant virus CVTR pnca gene group of known acquisition.
In addition, contriver for verify obtained recombinant virus CVTR in vivo with external stability, also carried out stability experiment in the external body of CVTR as follows:
Obtained recombinant virus CVTR is gone down to posterity 50 times in CEF cell, utilize above-mentioned primer (CVTR-LTR-F:aaccacagcgtgtctcct; CVTR-LTR-R:acaatgcctactatttcca) increase, result still can amplify the band of 1725bp, shows still to keep stable (Fig. 6) after invented CVTR passed for 50 generations in cell;
The recombinant virus CVTR subcutaneous vaccination SPF chicken that the present invention of 2500PFU is obtained, after inoculation 3,4,5 and 6 weeks, collect peripheral blood and inoculate CEF cell from the chicken of inoculation, cultivate 5-7 days, after growing plaque, dye by the monoclonal antibody of anti-MDV serum I type, all plaques are all positive, simultaneously by above-mentioned primer (CVTR-LTR-F:aaccacagcgtgtctcct for peripheral blood DNA; CVTR-LTR-R:acaatgcctactatttcca) increase, result still can amplify the band of 1725bp, shows that it is stable (Fig. 7) that CVTR goes down to posterity in vivo.
Further, contriver is applied to recombinant virus CVTR in the immunization experiment of SPF chicken, and concrete steps are as follows:
160 1 age in days SPF chickens, are divided into 4 groups at random.First group of inoculation CVTR, immunizing dose is 2000PFU/; Second group of inoculation CVI988/Rispens, immunizing dose is 2000PFU/; The 3rd group for attacking malicious control group, and the 4th group is blank group.7 ages in days carry out MDV virulent Md5 to be attacked, and observed and recorded chicken death after attacking is cutd open after 100 days and entered row naked eyes pathological observation taking internal organ 10% formaldehyde and fix to make pathological study.Result shows; CVTR immune group chicken size homogeneous; there is no macroscopic pathology with dead; tissue slice is not found the distinctive pathological change of MD; CVI988/Rispens immune group shows 12.5% MD light symptoms; attack malicious control group and show 97% the distinctive death of obvious MD and tissue injury phenomenon; as calculated; in the time that virulent Md5 attacks; in the time attacking with virulent vvMd5, CVTR (protective index is 100) can provide than CVI988/Rispens (protective index is 87.5) and better protect.
Meanwhile, contriver is also prepared into vaccine by recombinant virus CVTR, carries out immune operation to facilitate, and the preparation method of vaccine is as follows:
By recombinant virus CVTR inoculated into chick embryo inoblast, rolling bottle inoculum density is every 1cm
2the recombinant virus of area inoculation 1000-2000PFU, after inoculation, observe 1-2 every day, and generally in inoculation latter 48 hours, while having 70% above monolayer cell to occur typical cytopathy (CPE), remove nutrient solution, add appropriate trysinization liquid, at room temperature digest about 10 minutes, cell monolayer occurs loosening and draws in the net to approach while departing from bottle wall phenomenon, add immediately with Digestive system equivalent containing the nutritive medium of 10vt% bovine serum, stop digestion.Shake gently rolling bottle, make cell all depart from a bottle wall, the cell of centrifugal collection adds appropriate frostproofer DMSO, shakes up rear packing, and liquid nitrogen is preserved.
In sum; the invention provides a kind of recombination chicken marek's disease virus (CVTR strain); it is actually natural being integrated in MDV genome of LTR sequence of fowl RE hyperproliferative disorder; this strain is a kind of brand-new chicken Marek's disease virus; this virus all shows the replication higher than CVI988/Rispens strain in cell and chicken body; in the time that the strong poison of MDV infects, can play better immanoprotection action than CVI988/Rispens strain as vaccine.
Contriver has carried out biological preservation to the chicken Marek's disease virus (CVTR) of restructuring disclosed in this invention, and concrete preservation information is as follows:
Preservation information
The preservation time: on April 15th, 2013
Depositary institution's title: China Committee for Culture Collection of Microorganisms's common micro-organisms center
Deposit number: CGMCC No.7453
Depositary institution address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica
Classification And Nomenclature: Mareks disease virus
Brief description of the drawings
Fig. 1 is MDV CVTR genome pattern gray-scale map,
Known in figure, CVTR strain is except having the typical genome structure of MDV, the natural LTR sequence of having integrated REV in the IRS in its genome and TRS region;
Fig. 2 is CVTR serotype result of determination schematic diagram,
Utilization can be carried out indirect immunofluorescence assay to CVTR strain with the Idiotype monoclonal antibody of MDV serum I type, taking MDV serum I type vaccine strain CVI988/Rispens and highly virulent strain Md5 as contrast; Result demonstration, can there is specific reaction in CVTR and MDV serum I type monoclonal antibody, can judge that CVTR strain is as MDV serum I C-type virus C;
Fig. 3 is the colored schematic diagram of Fig. 2;
Fig. 4 is respectively taking the genome of CVTR, CVI988/Rispens and 814 vaccine strains as template, with primer (CVTR-LTR-F:aaccacagcgtgtctcct; CVTR-LTR-R:acaatgcctactatttcca) carry out pcr amplification result figure,
In figure, the sequence of visible CVI988/Rispens and the amplification of 814 vaccine strains is 1187bp, and CVTR strain extension increasing sequence is 1725bp;
Fig. 5 is the relatively schematic diagram of LTR integration site sequence of CVTR, CVI988/Rispens and 814 strains,
Sequence relatively shows, the genome of CVTR strain has all had more the LTR sequence of 533bp than CVI988/Rispens and 814 vaccine strains;
Fig. 6 for going down to posterity obtained recombinant virus CVTR 50 times in CEF cell, and the viral genome of getting respectively 5,10,15,20,25,30,35,40,45,50 generations is template, with primer (CVTR-LTR-F:aaccacagcgtgtctcct; CVTR-LTR-R:acaatgcctactatttcca) carry out pcr amplification result figure;
Visible every generation CVTR strain 1725bp sequence that all successfully increases, wherein M is DL2000MarKer;
Fig. 7 is by CVTR subcutaneous vaccination SPF chicken, and after inoculation 3,4,5 and 6 weeks, collecting peripheral blood DNA from the chicken of inoculation is template, with primer (CVTR-LTR-F:aaccacagcgtgtctcct; CVTR-LTR-R:acaatgcctactatttcca) carry out pcr amplification result figure,
The visible 1725bp band that all successfully amplifies weekly, wherein M is DL2000MarKer;
Fig. 8 is CVTR, CVI988/Rispens, virulent vvMd5 strain and domestic strong malicious GX0101 strain Meq genetic comparison, and in MDV serum I type, Meq gene can be distinguished the virulence of MDV,
Result demonstration, different with domestic strong malicious GX0101 strain Meq gene from virulent vvMd5 strain, CVTR strain is identical with the Meq gene order of CVI988/Rispens strain, demonstrates the typical gene sequence characteristic of weak poison;
Fig. 9 is MDV CVTR strain inside and outside multiplication capacity, CVTR and the CVI988/Rispens strain rate of propagation comparison diagram in CEF cell (external),
Can find, at inoculation CEF cell, after 96 hours, CVTR virus plaque (PFU) rate of propagation obviously accelerates than CVI988/Rispens;
Figure 10 is MDV CVTR strain inside and outside multiplication capacity, and CVTR and CVI988/Rispens be at the rate of propagation comparison diagram of SPF chicken (in body),
Viremia analysis can be found, is inoculating SPF chicken after 14 days, and the rate of propagation of CVTR in chicken body is obviously fast than CVI988/Rispens;
Figure 11 is the colored schematic diagram of Fig. 1.
Embodiment
The isolation identification of embodiment 1 chicken Marek's disease virus CVTR strain
1, the separation of CVTR strain and preliminary evaluation
Examine healthy chicken from facing of a chicken house that MD do not occur for many years and be separated to a strain MDV, detailed process is as follows: aseptic collection anticoagulation 1ml, with the aseptic separation peripheral blood lymphocyte of lymphocyte separation medium, inoculation grows up to the CEF cell of good individual layer, and 37 DEG C of cultivations, change liquid after 24h, continue to cultivate until cytopathy variability (CPE) reaches more than 50%, harvested cell, liquid nitrogen cryopreservation, isolated strain called after CVTR strain.
CVTR strain is inoculated into 1 age in days SPF chicken, do not cause chicken group's immunosuppression and the distinctive pathology of MD and death, toxicity test proves that this strain virus is Natural Avirulent Strain, this strain is carried out to sequencing, find that this strain has the similarity of height on key gene with CVI988/Rispens, but its rate of propagation in CEF is faster than CVI988/Rispens.
2, CVTR strain serotype is judged
The CVTR of 100PFU virus quantity, CVI988/Rispens and vv Md5 are inoculated in the CEF cell that has been paved into individual layer on 6 porocyte culture plates.Cultivate after 5d, growth media is outwelled, acetone with cold: ethanol (V/V, 3: 2) the fixing 5-10min of stationary liquid, use again phosphate buffered saline buffer (PBS) to wash 1 time, in each hole, add 0.5mL (1: 100V/V dilution) MDV serum I type monoclonal antibody, be positioned in 37 DEG C of constant incubators and react 1h, with PBS cleaning 3 times, moisture is dried, add the anti-mouse IgG of 0.5mL FITC mark fluorescence antibody (sigma, by specification configuration effort concentration), be positioned in 37 DEG C of constant temperature biochemical cultivation cases and react 1h, wash 3 times with PBS, moisture is dried, in adding each hole, respectively add 1 50% glycerine (glycerine: PBS solution=1: 1V/V mixes), under inverted fluorescence microscope, observe.The results are shown in Figure 2 and 3, CVTR and control group infect CEF cell plaque and all occurred specificity green fluorescence, show that CVTR is MDV serum I C-type virus C.
3, the pathogenic related gene of CVTR strain (Meq) sequential analysis
The Meq gene of MDV is the current known carcinogenic genes involved of unique tumorigenesis, the sequence of the Meq gene poison that can effectively tell the men from the boys, and design primer Meq-F:atgtctcaggagccagagccg, its gene order is as shown in Seq ID No:4; Meq-R:tcagggtctcccgtcacctgg, its gene order is as shown in Seq ID No:5, utilize the Meq gene of PCR method amplification CVTR strain, with the vaccine strain CVI988/Rispens delivering, virulent vv Md5 and domestic virulent strain GX0101 genome sequence in contrast, after sequence amplification, carry out sequence alignment, the results are shown in Figure 8, interpretation of result is found, CVTR strain Meq gene order and CVI988/Rispens are in full accord, have more the base sequence of about 170bp than virulent vv Md5 strain and GX0101 strain, show the characteristic feature of serum I type vaccine strain.
4, the identification feature of Mareks disease vaccine virus CVTR strain
CVTR strain belongs to MDV I C-type virus C, can react with the specific monoclonal antibody of identification MDV Genotype I.The distinctive that this virus is different from other vaccine strain is masked as the natural LTR sequence of integrating fowl RE hyperproliferative disorder in its genome, and its identification symbol is as follows:
(1) integration site is shown in Fig. 1, and the natural integration site of LTR sequence lays respectively at HeTRS district of MDV genome Zhong IRS district.
(2) the LTR sequence of natural integration is shown in Fig. 5, and sequence relatively shows, the genome of CVTR strain has all had more the LTR sequence of 533bp than CVI988/Rispens and 814 vaccine strains;
(3) CVTR-LTR-F:aaccacagcgtgtctcct is drawn in design, and its gene order is as shown in Seq ID No:2; CVTR-LTR-R:acaatgcctactatttcca, its gene order is as shown in Seq ID No:3, carry out pcr amplification taking CVTR genome as template, PCR reaction system is 25 μ L:10 × PCR Buffer2.5 μ L, the each 1 μ L of upstream and downstream primer (25 μ M), dNTP (2.5mM each) 2 μ L, the about 200ng of template DNA, rTaq2U, sterilizing distilled water is mended to 25 μ L.
PCR response procedures is as follows: 95 DEG C of 10min, and by 95 DEG C of 1min, 58 DEG C of 1min, 72 DEG C of 2min carry out 30 circulations; Last 72 DEG C are extended 10min.
The same terms carries out pcr amplification with the genome of 814 vaccine strains for contrasting with CVI988/Rispens simultaneously.
Result demonstration, the sequence of other Genotype I vaccine strain (comprising CVI988/Rispens and 814 vaccine strains) amplification is 583bp, CVTR strain extension increasing sequence is 1725bp (Fig. 4).Through sequence verification, the fragment of this 1725bp, except containing two pairs of primer sequences, also contains the LTR sequence of 533bp, and sequence is relatively shown in as shown in Figure 5, the natural LTR sequence of having integrated REV in the recombinant virus CVTR pnca gene group of known acquisition.
Embodiment 2CVTR inside and outside proliferation experiment
The in-vitro multiplication speed trial of CVTR strain carries out on CEF, and parent poison CVI988/Rispens and CVTR are inoculated in respectively to 26 porocyte culture plates, the virus of every hole inoculation 100PFU.0h after inoculation respectively, 24h, 48h, 72h, 96h, 120h, 144h observes plaque number;
The proliferation in vivo speed trial of CVTR carries out in SPF chicken, 2 group of 1 age in days SPF fowl raising is in 4 SPF animal rearing cages with positive press filtration air, every group 10, with 2000PFU/ dosage only intraperitoneal inoculation CVI988/Rispens vaccine strain and CVTR respectively.7d after inoculation, 14d, 21d and 28d separating blood medium size lymphocyte inoculation CEF, inoculates and after 5-7 days, measures positive plaque number in CEF.
CVTR inside and outside rate of propagation is shown in Fig. 9 and 10, wherein Fig. 9 is CVTR and the rate of propagation comparison of CVI988/Rispens strain in CEF cell (external), can find, at inoculation CEF cell, after 96 hours, CVTR virus plaque (PFU) rate of propagation obviously accelerates than CVI988/Rispens;
Figure 10 is CVTR and the CVI988/Rispens rate of propagation comparison SPF chicken (in body), and viremia analysis can find, inoculation SPF chicken, after 14 days, the rate of propagation of CVTR in chicken body is obviously fast than CVI988/Rispens.
Embodiment 3CVTR strain stability test
CVTR is gone down to posterity 50 times in CEF cell, utilize primer (CVTR-LTR-F:aaccacagcgtgtctcct; CVTR-LTR-R:acaatgcctactatttcca) increase, result still can amplify the band of 1725bp, and band reclaims order-checking and shows still to keep stable (Fig. 6) after invented CVTR passed for 50 generations in cell.
By the CVTR subcutaneous vaccination SPF chicken of 2500PFU.After inoculation 3,4,5 and 6 weeks, collect peripheral blood and inoculate CEF cell from the chicken of inoculation, cultivate 5-7 days, after growing plaque, dye by the monoclonal antibody of anti-MDV serum I type, all plaques are all positive, simultaneously by above-mentioned primer (CVTR-LTR-F:aaccacagcgtgtctcct for peripheral blood DNA; CVTR-LTR-R:acaatgcctactatttcca) increase, result still can amplify the band of 1725bp, shows that it is stable (Fig. 7) that CVTR goes down to posterity in vivo.
Pathogenic and the immune efficacy of embodiment 4CVTR strain virus to chicken
1, pathogenic to SPF chicken of MDV CVTR strain virus
CVTR strain is infected 50 1 age in days SPF chickens with 5000PFU dosage, infects after 13 weeks, without the death of MD specificity and pathology, forms without tumour; Its body weight and central immune organ thymus gland and fabricius bursa index all with blank chicken without significant difference, can not cause chicken group's immunosuppression.
2, MDV CVTR strain virus immune protection effectiveness is evaluated
160 of SPF chick, are divided into four groups, and 40 every group, the CVTR of the 1st group of 1 age in days nape subcutaneous vaccination 2000PFU, the CVI988/Rispens vaccine of the 2nd group of 1 age in days nape subcutaneous vaccination 2000PFU, the 3rd group for attacking malicious control group, and the 4th group is blank group.When 7 age in days, 1,2,3 group of chicken inoculates respectively the chicken Marek's disease virulent vv Md5 strain of 1000PFU virus quantity through abdominal cavity, and four groups of chickens are all cutd open and kill in the time of 90 age in days, and statistics is in table 1.There is 12.5% MD specific lesions in the 2nd group (CVI988/Rispens immune group), comprises the MD specificity death in early stage; There is 100% MD specific lesions in the 3rd group (attacking malicious control group); And all there is not MD specific lesions and death in one (CVTR immune group), four groups (blank groups).Result shows that CVTR (protective index is 100) can provide than CVI988/Rispens (protective index is 87.5) and better protects.
The immune protective effect of table 1CVTR to SPF chicken
| Vaccine | Attack poison strain | Peculiar pathology/the % of MD | PI |
| CVTR | Md5 | 0/40(0) | 100 |
| CVI988/Rispens | Md5 | 5/40(12.5) | 87.5 |
| - | Md5 | 40/40(100) | - |
| - | - | 0/40(0) | - |
Embodiment 5CVTR strain virulence is returned strong test
Seed culture of viruses is with 45000PFU virus quantity, and 10 of neck subcutaneous vaccination 1 age in days SPF chick, raise in shield retaining respectively.5 chickens of taking a blood sample when 7 age in days, separate white corpuscle, measure viral level in chicken body and through another 10 the 1 age in days SPF chick of neck subcutaneous vaccination, and inoculum size is 2,000 ten thousand white corpuscles/only.Remain 5 chickens and support to 70 ages in days, blood sampling is measured the viral level in chicken body and is cutd open inspection and has or not specific MD pathology.Establish 10 chickens of control group, 5 chickens of taking a blood sample when 7 age in days separate white corpuscle and detect virus, remain 5 chickens and support to 70 ages in days, weigh, cut open and kill simultaneously, and inspection is without any illness.By above method, virus was transmitted for 6 generations continuously in chicken body, every generation test chicken all cuts open inspection at 70 ages in days, and visual inspection is without specificity MD pathology.Result shows, CVTR strain continuous passage 6 times in chicken body, does not cause any pathogenic symptom to chicken, does not cause any infringement of each organ, and virulence is not returned by force.
Embodiment 6 vaccine preparations
By recombinant virus CVTR inoculated into chick embryo inoblast, by every rolling bottle (growth area 680cm
2) inoculation 4 × 10
8individual cell packing cell-culturing rotating bottle, rolling bottle speed of rotation be 9-11 turn/hour, 37 DEG C cultivate 18-20 hour, inoculum density is every 1cm
2the recombinant virus of area inoculation 1000-2000PFU, after inoculation, observe 1-2 every day, and generally in inoculation latter 48 hours, while having 70% above monolayer cell to occur typical cytopathy (CPE), remove nutrient solution, add appropriate trysinization liquid, at room temperature digest about 10 minutes, cell monolayer occurs loosening and draws in the net to approach while departing from bottle wall phenomenon, add immediately with Digestive system equivalent containing the nutritive medium of 10% bovine serum, stop digestion.Shake gently rolling bottle, make cell all depart from a bottle wall, the cell of centrifugal collection adds appropriate frostproofer, shakes up rear packing, and liquid nitrogen is preserved.
Claims (2)
1. a strain Marek's disease virus vaccine strain, its deposit number is: CGMCC No.7453.
2. Marek's disease virus vaccine strain as claimed in claim 1, is characterized in that: the LTR sequence of having integrated Reticulendotheliosus virus in its gene order.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310239720.9A CN103382460B (en) | 2013-06-17 | 2013-06-17 | Strain of Marek's disease virus vaccine strain, and separation and identification and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310239720.9A CN103382460B (en) | 2013-06-17 | 2013-06-17 | Strain of Marek's disease virus vaccine strain, and separation and identification and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103382460A CN103382460A (en) | 2013-11-06 |
| CN103382460B true CN103382460B (en) | 2014-07-30 |
Family
ID=49490389
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310239720.9A Active CN103382460B (en) | 2013-06-17 | 2013-06-17 | Strain of Marek's disease virus vaccine strain, and separation and identification and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103382460B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106397602B (en) * | 2016-08-02 | 2019-06-18 | 青岛明勤生物科技有限公司 | A kind of reinforced chicken Marek's disease protein engineering vaccine of molecule adjuvant |
| CN106754761B (en) * | 2017-01-20 | 2021-01-12 | 北京邦卓生物科技有限公司 | Construction and application of recombinant marek's disease virus meq and vIL-8 double-gene deletion strain |
| CN107296956A (en) * | 2017-06-29 | 2017-10-27 | 青岛易邦生物工程有限公司 | A kind of genetic recombination live vector vaccine |
| CN114480297B (en) * | 2022-03-16 | 2023-03-24 | 河南省农业科学院 | Serum type 1 Marek's disease virus MEQ monoclonal antibody, preparation method and application |
| CN114717200B (en) * | 2022-03-16 | 2023-03-24 | 河南省农业科学院 | Marek's disease virus super virulent strain and construction and application of gene deletion strain thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102628053B (en) * | 2010-12-14 | 2013-10-09 | 山东农业大学 | Construction and application of recombinant Chicken Marek's Disease Virus SC9-1 strain and SC9-2 strain |
-
2013
- 2013-06-17 CN CN201310239720.9A patent/CN103382460B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103382460A (en) | 2013-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105412921B (en) | A kind of I group of 4 type aviadenovirus vaccine | |
| CN101935637B (en) | Recombinant low-virulent vaccine strain of chicken infectious bursal disease viruses (IBDV) and application thereof | |
| CN103382460B (en) | Strain of Marek's disease virus vaccine strain, and separation and identification and application thereof | |
| CN102220287B (en) | Avian infectious bronchitis cold adaptation attenuated vaccine strain and application thereof | |
| CN102363769B (en) | Chicken Marek's disease Meq gene deleted vaccine strain, construction method thereof, and application thereof | |
| CN102851257A (en) | Attenuated vaccine strain for avian infectious bronchitis virus and application thereof | |
| CN103305474A (en) | Porcine pseudorabies virus strain as well as inactivated vaccine and applications thereof | |
| CN107384874A (en) | Pseudorabies virus epidemic strain gI/gE gene deletion mutants and structure and application | |
| CN105543180A (en) | Isolation, identification and purification method and application of gene VII type Newcastle disease virus strain | |
| CN104498441A (en) | Duck hepatitis A virus III type attenuated strain, live vaccine prepared from same and application of live vaccine | |
| CN104099301A (en) | Coxsackie virus A16 virus strain, uses of strain, vaccine and preparation method of vaccine | |
| CN110343671A (en) | A kind of I type Marek's disease virus vaccine strain of recombination for expressing VP2 gene | |
| CN104726414A (en) | Serum type 3 duck hepatitis A virus live vaccine and preparation method thereof | |
| CN109207436A (en) | One plant of 4 type aviadenovirus strain of I group and its application | |
| CN105441393B (en) | Very virulent infectious bursal disease virus DF-1 cell adapted strain and its application | |
| CN104928260A (en) | Infectious bovine rhinotracheitis virus IBRV-JN03 isolate and application thereof | |
| CN104087559B (en) | A kind of infectious bursa of Fabricius virus, inactivated vaccine and preparation method thereof | |
| CN102154224A (en) | Construction of recombinant chicken marek's disease vaccine virus SC9-1 strain and application thereof | |
| CN104130981A (en) | Application of avian infectious bronchitis virus vaccine strain in preparation of inactivated vaccine | |
| JP2002247979A (en) | Marek's disease vaccine and method for producing the same | |
| CN106701693A (en) | Construction and application of recombinant herpesvirus of turkey for expressing GB gene of serum I type Marek's disease virus | |
| CN103923885A (en) | Infectious bursal disease virus Vero cell-adapted strain and application thereof | |
| CN109207437B (en) | Group I8 avian adenovirus strain and application thereof | |
| CN105727275A (en) | Duck hepatitis bivalent live vaccines and preparation method thereof | |
| CN102533673B (en) | Chicken infectious bursal disease very virulent cell adapted strain and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20160630 Address after: 526238 No. 5, pioneering Road, hi tech Industrial Development Zone, Guangdong, Zhaoqing Patentee after: Zhaoqing Dahuanong Biological Pharmaceutical Co., Ltd. Patentee after: GUANGDONG WENS DAHUANONG BIOTECHNOLOGY CO., LTD. Patentee after: Beijing Bangzhuo Biological Science & Technology Co., Ltd. Address before: 526238 No. 5, pioneering Road, hi tech Industrial Development Zone, Guangdong, Zhaoqing Patentee before: Zhaoqing Dahuanong Biological Pharmaceutical Co., Ltd. Patentee before: Guangdong Dahuanong Animal Health Products Co., Ltd. Patentee before: Beijing Bangzhuo Biological Science & Technology Co., Ltd. |