CN103881981A

CN103881981A - Living-vector vaccine of H5N1 subtype of avian influenza virus and duck enteritis virus

Info

Publication number: CN103881981A
Application number: CN201410030998.XA
Authority: CN
Inventors: 金梅林; 李淑云; 邹忠
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2013-08-26
Filing date: 2014-01-22
Publication date: 2014-06-25
Anticipated expiration: 2034-01-22
Also published as: CN103497967A; CN103882056A; CN103881982A; CN103881981B; CN104293820A

Abstract

The invention belongs to the technical field of animal genetic engineering, and particularly relates to a living-vector vaccine of an H5N1 subtype of avian influenza virus and a duck enteritis virus. A vaccine strain rDEV-HA5 is preserved at the typical culture preservation centre in China, wherein the preservation number is CCTCC NO:V201404. The building method disclosed by the invention comprises the following steps: inserting a segment of an H5N1 subtype of avian influenza virus ha gene into an artificial chromosome plasmid pBAC-C-KCE of the duck enteritis virus, so as to obtain recombinant plasmids pBAC-C-KCE-HA5, wherein the gene structure composition of the plasmid pBAC-C-KCE is shown in a figure 7; the gene structure composition of the plasmids pBAC-C-KCE-HA5 is shown in a figure 14. Biological function verification proves that the vaccine disclosed by the invention has the effect of simultaneously preventing duck enteritis and the H5N1 subtype of avian influenza, and can achieve the target of simultaneously preventing two diseases by a needle.

Description

A kind of H5N1 subtype avian influenza virus and duck enteritis virus live vector vaccine

Technical field

The invention belongs to animal gene engineering technology field, be specifically related to a kind of H5N1 subtype avian influenza virus and duck enteritis virus live vector vaccine construction and application.

Background technology

Duck viral enteritis (Duck Virus Enteritis, DEV) have another name called duck plague (Duck Plague, DP), by duck enteritis virus (Duck Enteritis Virus, DEV) one of the Anseriformes such as duck, the goose bird causing is acute, contagious disease, and the bird at each age all can fall ill.The report that duck viral enteritis has this disease in a lot of countries, is also widely current in China.Because it is propagated rapidly, morbidity and mortality ratio are high, reach 50-100%, and one-tenth duck even, more than 90%, has become harm and supported one of main epidemic disease of duck industry.In recent years, had successively about the genomic research report of duck enteritis virus; 2009, duck enteritis virus genome sequence was announced and has been logged in Genbank (Li Y et al., 2009), for gene and the protein function of research DEV provide strong reference data.Its Genome Size is about 150kb, and 78 protein of encoding, wherein have 67 albumen and herpes simplex virus group to have homology, 1 albumen and γ-simplexvirus homology, 5 with avian herpetoviruses homology.By the whole genomic clone of simplexvirus in BAC plasmid, the foreign gene with immunogenicity of other viruses of then recombinating in bacterium, thus build bivalent vaccine.

For the so large genomic viral (being greater than 100kb) of simplexvirus, the difficulty of manipulation in vitro is very large, and conventional vitro enzyme is cut with the method being connected and is not suitable for.The classical way of construction of recombinant virus is by the transfer vector with goal gene and viral genome cotransfection mammalian cell, and in cell, homologous recombination obtains recombinant virus.Owing to there is the interference of wild-type virus, generally need to could screen and obtain pure recombinant virus (Domi A et al., 2005 through too much bye spot purifying; Horsburgh B C et al., 1999), this is a very loaded down with trivial details job, sometimes also can run into the recombinant virus unsettled problem that goes down to posterity.In order to overcome the limitation of this method, researchist attempts directly viral genome being modified in intestinal bacteria.What first attempt is intestinal bacteria Cosmid carrier.Because virogene is very large, and this carrier finite capacity (about 40kb) must be divided into several sections by viral genome, forms a set of overlapping carrier, is assembled into complete viral genome through intracellular repeatedly homologous recombination, produces restructuring poison.Cosmid carrier is unstable in intestinal bacteria, the efficiency of cotransfection is low, in addition, these carriers will be through homologous recombination repeatedly in cell, its accuracy is difficult to ensure, there is deletion mutantion higher, thereby to the recombinant virus the being separated to further Analysis and Identification of still needing, be not a kind of well method.

Under the needs of genomics research work, researchist has developed a series of carrier and host systems that are applicable to large dna fragment cloning, bacterial artificial chromosome carrier (BAC) as derivative in yeast artificial chromosome's carrier (YAC), colibacillary F-factor and taking phage replication as basic carrier (PAC).BAC carrier can be cloned the fragment to 300kb greatly, and can stable copying in intestinal bacteria (McGeoch D J et al., 1994).In recent years, a series of large double-stranded viruses genomes are successively by BACization (Adler H et al., 2000; Borst E M et al., 1999; Azab W et al., 2002; Smith B N et al., 2000).After the viral genome transfectional cell of these BACization, in cell, can produce infectious virus particle, this makes to utilize the genetic tool operation virus of bacterium to become possibility.But, due to some unknown cause, being arranged in genome BAC carrier part less stable, after the viral genome transfectional cell of BACization, can there is disappearance in various degree in carrier and both sides virus genome sequence thereof.In order to address this problem, a loxP site has respectively been introduced in BAC carrier both sides, this carrier proceeds in the zooblast of expressing Cre recombinase, the recombining reaction of Cre enzyme meeting catalysis between two sites, thereby the carrier framework part in protokaryon source is removed from viral genome, only leave the sequence of the loxP of 34bp, genomic fidelity and integrity are ensured, avoid as much as possible the impact of protokaryon source on the contiguous viral gene expression of on position, it is more perfect that the bacterium genetic tool that utilizes like this BAC to clone operates large genomic viral, the method is successfully used in BAC clone (the Smith G A et al. of Pseudorabies virus, 2000).Homologous recombination and locus specificity restructuring are the methods that is extensively used to modify BAC clone.RecA homologous recombination system is the intestinal bacteria homologous recombination system of knowing for people the earliest.But the required homologous region of homologous recombination being mediated by RecA reaches 1000bp left and right, the difficulty of operation is large, time and effort consuming relatively, thus its application is limited significantly.RecE/RecT homologous recombination system can occur between the homologous region of 20-25bp in the reaction of catalysis homology, homologous recombination efficiency higher (Muyrers J P et al., 2000; Muyrers J P et al., 2000a).Red-gam system and RecE/RecT are similar, and recombination efficiency higher (Muyrers J P et al., 2000b; Jamsai D et al., 2003).So far, people combine (Red/ET) these two kinds of recombinant technologys and have realized the directly target practice modification to aim sequence using PCR product as donor molecule, can effectively carry out the modifications such as point mutation, insertion and disappearance to any gene on BAC clone.Locus specificity restructuring is to be recombinated by the generation locus specificity between site-specific recombinase mediation specific site.General system has the Cre-loxP system (Smith G A et al., 2000) of P1 phage, enters the Int-att system (Suzuki Y et al., 2005) of phage, and the Flp-FRT system of yeast (Cherepanov P P et al., 1995).Site-specific recombination targeting is strong, recombination efficiency is high, is also the effective tool of modifying BAC clone.This whole process is all carried out in bacterial body, can avoid to a great extent isolated operation to macromolecular damage.2005, Li M Z et al. developed an effective means, built in vivo the auxiliary genetic integration clone of recombinant DNA molecules-mating (MAGIC) (Li M Z et al., 2005) for homologous recombination method.

Bird flu (Avian influenza, AI) is the viral deadly infectious disease being caused by A type influenza virus (Avian influenza virus, AIV), is to endanger at present one of the world and the most important epidemic disease of China's aviculture.Bird flu (Avian influenza, AI) is a kind of acute infectious disease being caused by the A of orthomyxoviridae family type influenza virus, claims again fowl plague or European checken pest.Within 1878, this disease occurs and constantly spreads in Italy first; At the beginning of the year ends to 2,004 2003, occur again popular on a large scale in Asia: and 1997 and within 2004, occur in respectively the bird flu of Hong Kong and Vietnam, broken through between kind obstacle direct infection people and caused death.Bird flu in recent years frequently breaks out, and causes crushing blow to world's aviculture.The loss that only country in Southeast Asia infects poultry because of destruction just exceedes 1,000 hundred million dollars, and the tens million of plumages of poultry are destroyed by China, and loss reaches hundred million yuan of hundreds ofs.Within 2005, break out the high pathogenic avian influenza in Qinghai Lake, the safety of wild Migrants is arrived in serious threat, and has spread all over rapidly Europe, has caused huge harm.H5N1 avian influenza virus causes global 553 people to infect, 323 people's death, and mortality ratio reaches 58.4%, and China 40 people infect, 26 people's death.High pathogenic avian influenza broken through species barrier can direct contagion to people, human health in serious harm.H9 subtype avian influenza virus is separated in turkey body by Hommee and Easterday (1970) the earliest.1994, Chen Bailun etc. were separated to H9 hypotype AIV in sick laying hen body.After this, H9 hypotype AIV extensively exists in China, is low pathogenicity more and infects, and be the gesture spreading gradually.To 1997, H9 hypotype AIV was distributed widely in each continent.The report that the states such as Korea S, Ireland, Italy have H9 bird flu to break out, illustrates that it has set up stable germline in poultry.Within 1998, in family's pig body in Hong Kong, be separated to 2 strain H9 subtype influenza viruses, this is in mammalian body, to be separated to H9 subtype influenza virus first.1999 are separated to two strain H9 influenza viruses in girl's body of Hong Kong trouble influenza, the analysis of this two strain virus is shown to gene fragment and AIV-A/Quail/Hong Kong/G1/97 (H9) the height homology that they are all, be typical fowl source and course Influenza Virus, this strain is that Hong Kong native infects H5N1 and the closely-related branch of H9 hypotype representative strains.2000-2001, the aquatic bird (being mainly a duck) to southern area of China carries out influenza virus monitoring and finds that approximately 10% aquatic bird is infected by H9, and infection rate is 4 times of 20 century 70s.Although also do not have ample evidence to show that H9 subtype influenza virus can be in interpersonal propagation, it has become one of Important Infectious Diseases of current serious harm human health.

Current, vaccine immunization may be to prevent bird flu epidemic situation and duck viral enteritis popular most economical method on a large scale.But adopt the operation of traditional method structure H5 and H9 subtype avian influenza vaccine strain more difficult, utilize the genetic manipulation means such as bacterial artificial chromosome technology, the restructuring duck enteritis virus live vector vaccine that structure contains influenza virus ha gene, for the development of bird vaccine provides new technique means.

Summary of the invention

The object of the invention is to overcome the defect of prior art, a kind of restructuring duck enteritis virus live vector vaccine of the H5N1 of containing subtype avian influenza virus ha gene is provided.First we build the plasmid that obtains duck enteritis virus bacterial artificial chromosome, be the bacterial artificial chromosome plasmid of duck enteritis virus (DEV) vaccine strain (C-KCE), a kind of restructuring duck enteritis virus live vector vaccine and application thereof of the H5N1 of expression subtype avian influenza virus ha gene are provided on this basis.The present invention utilizes large intestine bar (for example DH10B) and chick embryo fibroblast (CEF cell) again to save out fast DEV.Further, the restructuring duck enteritis virus live vector vaccine of construction expression H5N1 subtype avian influenza virus ha gene of the present invention, can utilize plasmid pRTHGA1, insert H5N1 subtype avian influenza virus ha gene, utilize the auxiliary genetic integration clone of mating (being MAGIC method) restructuring, can obtain the restructuring duck enteritis virus live vector vaccine strain that contains H5N1 subtype avian influenza virus ha gene.

Realize main technical schemes of the present invention and step as described below:

(1) the full genome of duck enteritis virus (C-KCE) (GenBank ID:KF263690) is inserted into and on BAC plasmid, is obtained a kind of duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE by the method for homologous recombination.The intestinal bacteria DH10B-1S that contains this plasmid ₂/ BAC-C-KCE, Escherichia coli DH10B-1S ₂/ BAC-C-KCE, delivers China on August 20th, 2013. Wuhan. and the center preservation of Wuhan University's Chinese Typical Representative culture collection, deposit number is CCTCC NO:M2013377;

(2) transform plasmid pRThGA as pRTHGA1, on pRTHGA1 plasmid, insert respectively H5N1 subtype avian influenza virus ha gene (temporary GenBank accession NO:KJ003987) and H9N2 subtype avian influenza virus ha gene (GenBank ID:DQ465400.1) and obtain its structure of recombinant plasmid pRTHGA-HA5(as shown in figure 11) and its structure of recombinant plasmid pRTHGA-HA9(is as shown in figure 12);

(3) use the method for MAGIC respectively by the insertion duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE of the avian influenza virus ha gene fast and stable in plasmid pRTHGA-HA5 and pRTHGA-HA9, thereby the recombinant plasmid pBAC-C-KCE-HA5 that obtains containing avian influenza virus ha gene and duck enteritis virus gene and pBAC-C-KCE-HA9(wherein pBAC-C-KCE-HA5 plasmid structure as shown in Figure 16, its nucleotide sequence total length is 169,784bp; The structure of pBAC-C-KCE-HA9 plasmid is shown in Figure 17, and its nucleotide sequence total length is 169,766bp).The intestinal bacteria DH10B-1S that contains recombinant plasmid pBAC-C-KCE-HA5 ₂/ BAC-C-KCE-HA, Escherichia coli DH10B-1S ₂/ BAC-C-KCE-HA, delivers China on August 20th, 2013. Wuhan. and the center preservation of Wuhan University's Chinese Typical Representative culture collection, deposit number is CCTCC NO:M2013378.The intestinal bacteria DH10B-1S that contains recombinant plasmid pBAC-C-KCE-HA9 ₂/ BAC-C-KCE-HA9, Escherichia coli DH10B-1S ₂/ BAC-C-KCE-HA9, delivers China on December 31st, 2013. Wuhan. and the center preservation of Wuhan University's Chinese Typical Representative culture collection, deposit number is CCTCC NO:M2013740.

(4) respectively recombinant plasmid pBAC-C-KCE-HA5 and pBAC-C-KCE-HA9 transfection CEF cell are rejected after BAC skeleton, can obtain respectively the restructuring duck enteritis virus live vector vaccine strain rDEV-HA5 that expresses H5N1 subtype avian influenza virus ha gene, deliver China on January 2nd, 2014. Wuhan. the center preservation of Wuhan University's Chinese Typical Representative culture collection, preserving number is CCTCC NO:V201404, with the restructuring duck enteritis virus live vector vaccine strain rDEV-HA9 that expresses H9N2 subtype avian influenza virus ha gene, deliver China on January 2nd, 2014. Wuhan. the center preservation of Wuhan University's Chinese Typical Representative culture collection, preserving number is CCTCC NO:V201403.

(5) utilize the vaccine strain of step (4) gained to prepare respectively H5N1 subtype avian influenza virus and duck enteritis virus live vector vaccine and H9N2 subtype avian influenza virus and duck enteritis virus live vector vaccine.

The duck enteritis virus live vector vaccine of H5N1 hypotype prepared by the present invention and the restructuring of H9N2 subtype avian influenza virus can be applied in to be controlled in duck group in H5N1 hypotype and H9N2 subtype avian influenza and duck viral enteritis, can effectively control the problem of H5N1 hypotype and H9N2 subtype avian influenza and duck viral enteritis in duck group.

More detailed technical scheme is referring to " embodiment ".

Beneficial effect of the present invention is:

1, utilize the duck enteritis virus bacterial artificial chromosome in the present invention greatly to shorten the cycle that obtains recombinant virus.

2, after the duck enteritis virus bacterial artificial chromosome in the present invention restructuring foreign gene, carrier is rejected, non-functional exogenous array inserts, on genome also without impact, the possibility that does not exist genetic material to occur to shift across species.

3, utilize recombinant viral vaccine rDEV-HA5 in the present invention and rDEV-HA9 can reach the effect of preventing duck viral enteritis and H5 subtype influenza or H9 subtype influenza simultaneously.By parity of reasoning, utilizes the duck enteritis virus bacterial artificial chromosome restructuring foreign gene in the present invention can reach a pin anti-even object of various diseases of two diseases simultaneously.

Brief description of the drawings

Sequence table SEQ ID NO:1 is the nucleotide sequence of recombinant plasmid pBlue-UL26-UL27, length 12545bp, and wherein the sequence of underscore mark is respectively the nucleotide sequence of restriction enzyme SalI, PacI, NotI.Wherein, 1-6401 is the partial nucleotide sequence of PBlue-lox carrier, length is 6401bp, 6394-6401 is the nucleotide sequence of restriction enzyme NotI, length is 8bp, 6402-6435 is the partial nucleotide sequence of LoxP, length is 34bp, 6436-7679 is the nucleotide sequence of UL26, length is 1244bp, 7680-7687 is the nucleotide sequence of restriction enzyme PacI, length is 8bp, 7688-9519 is the nucleotide sequence of amp replicon, length is 1832bp, 9520-9527 is the nucleotide sequence of restriction enzyme PacI, length is 8bp, 9528-10694 is the nucleotide sequence of UL27, length is 1167bp, 10695-12503 is the nucleotide sequence of red fluorescence gene, length is 1809bp, 12504-12511 is the nucleotide sequence of restriction enzyme SalI, length is 8bp, 12512-12545 is the partial nucleotide sequence of LoxP, length is 34bp.

Sequence table SEQ ID NO:2 is chicken β-actin promotor and the expression cassette of rabbit β-globin ployA and the nucleotide sequence of homology arm of plasmid pCAGGS, and length is 2380bp.

Sequence table SEQ ID NO:3 is Loxp sequence, and length is 644bp, only stays the sequence in next 34bpLoxp site from 485-518bp is excision BAC skeleton.

Sequence table SEQ ID NO:4 excises the sequence of only staying next Loxp site after BAC skeleton in sequence table SEQ ID NO:3, sequence length is 34bp.

Sequence table SEQ ID NO:5 is the sequence of pRTHGA1, and sequence length is 4263bp, and at 3687-3642 of this sequence, and 3698-3703 be respectively restriction endonuclease sites SmalI and XhoI.Wherein, between restriction enzyme site SmalI and XhoI, insert fowl influenza virus strain A/Duck/Hubei/xn/2007(H5N1) HA sequence (length of nucleotides is 1704bp) can to obtain recombinant plasmid pRTHGA-HA5(nucleotide sequence length be 5961bp); It is 5943bp that the HA sequence (length of nucleotides is 1685bp) of inserting fowl influenza virus strain A/Duck/HuBei/W1/2004 (H9N2) between restriction enzyme site SmalI and XhoI can obtain recombinant plasmid pRTHGA-HA5(nucleotide sequence length).

Fig. 1: the structure schema that is transfer vector pBlue-UL27-UL26 of the present invention.

Fig. 2: be pcDNA3.1+ plasmid schematic diagram in structure transfer vector pBlue-UL27-UL26 process of the present invention.

Fig. 3: the gene structure composition schematic diagram that is transfer vector pBlue-UL27-UL26 of the present invention.

Fig. 4: be carrier pBlue-lox schematic diagram in structure transfer vector pBlue-UL27-UL26 process of the present invention.CMV Promoter in figure is CMV promotor.

Fig. 5: be transfer vector pBlue-UL27-UL26 plasmid schematic diagram of the present invention.

Fig. 6: be the transfer vector pBlue-UL27-UL26 of the present invention schematic diagram of breeding on the inoblast of chicken on duck enteritis virus of recombinating.Wherein: Fig. 6 A is that transfer vector pBlue-UL27-UL26 recombinates and on the inoblast of chicken, forms separately the photo of plaque on duck enteritis virus;

Fig. 6 B is that transfer vector pBlue-UL27-UL26 recombinates on duck enteritis virus, and through the schematic diagram at the fibroblast proliferation of chicken after plaque purifying repeatedly.

Fig. 7: being the genomic constitution schematic diagram of duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE of the present invention, is to replace the DNA fragmentation (UL26+UL27+amp in transfer vector pBlue-UL27-UL26 by the full length nucleotide sequence D EV with duck enteritis virus C-KCE ^r) obtain.

Fig. 8: be the schematic diagram of duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE of the present invention, wherein CMV.P is CMV promotor, and RFP is red fluorescent protein gene.

Fig. 9: be the schematic diagram that pRThGA carrier of the present invention is transformed into recombinant plasmid pRTHGA1.Wherein: the CMVPromoter in the picture left above in Fig. 9 is CMV promotor; Chicken beta-actin promoter in top right plot in Fig. 9 and lower figure is Chicken beta-actin promotor, and CMV.IE enhancer is CMV.IE enhanser.

Figure 10: the schema that is construction recombination plasmid pRTHGA-HA5 of the present invention and pRTHGA-HA9.It is that the ha gene that inserts respectively H5 subtype avian influenza virus and H9 subtype avian influenza virus between the restriction endonuclease sites SmalI of plasmid pRTHGA1 and XhoI obtains.

Figure 11: the schematic diagram that is the recombinant plasmid pRTHGA-HA5 that builds of the present invention.Wherein, the Chicken beta-actin promoter in figure is the promotor of Chicken beta-actin, and CMV.IE enhancer is CMV.IE enhanser; Plasmid is with Amp(penbritin) resistance.

Figure 12: the schematic diagram that is the recombinant plasmid pRTHGA-HA9 that builds of the present invention.

Figure 13: the structure schema that is rDEV-HA5 vaccine strain of the present invention and rDEV-HA9 vaccine strain.

Figure 14: the genomic constitution schematic diagram that is the recombinant plasmid pBAC-C-KCE-HA5 that contains H5 subtype avian influenza virus ha gene and duck enteritis virus gene that builds of the present invention.That the red fluorescent protein gene (RFP) of plasmid pBAC-C-KCE is replaced with to the ha gene of H5 subtype avian influenza virus and obtains.

Figure 15: the genomic constitution schematic diagram that is the recombinant plasmid pBAC-C-KCE-HA9 that contains H9 subtype avian influenza virus ha gene and duck enteritis virus gene that builds of the present invention.That the red fluorescent protein gene (RFP) of plasmid pBAC-C-KCE is replaced with to the ha gene of H9 subtype avian influenza virus and obtains.

Figure 16: be the schematic diagram of the recombinant plasmid pBAC-C-KCE-HA5 that contains H5 subtype avian influenza virus ha gene and duck enteritis virus gene that builds of the present invention, its nucleotide sequence total length is 169,784bp.

Figure 17: be the schematic diagram of the recombinant plasmid pBAC-C-KCE-HA9 that contains H9 subtype avian influenza virus ha gene and duck enteritis virus gene that builds of the present invention, its nucleotide sequence total length is 169,766bp.

Figure 18: be to use Western Blot to detect the result of rDEV-HA5 and rDEV-HA9 expression ha gene.

In upper figure in Figure 18 the monoclonal antibody of rDEV-HA5 recombinant strain and anti-HA react produce obvious band be positive, DEV strain is negative, and proves that rDEV-HA5 recombinant strain successfully constructs.In the middle figure of Figure 18 the monoclonal antibody of rDEV-HA9 recombinant strain and anti-HA react produce obvious band be positive, DEV strain is negative, and proves that rDEV-HA9 recombinant strain successfully constructs.In figure below of Figure 18 the monoclonal antibody of rDEV-HA recombinant strain and DEV strain and internal reference GAPDH all react produce obvious band be positive, prove that this experiment is effective.

Figure 19: the monitoring schematic diagram that is the HI antibody titer of duckling immunity rDEV-HA5 vaccine front and back to highly pathogenic bird flu virus H 5 N 1 (XN) in the present invention.

Figure 20: be before and after duckling immunity rDEV-HA5 vaccine, the ELISA of duck enteritis virus serum antibody to be monitored to schematic diagram in the present invention.

Figure 21: be the protection ratio schematic diagram of rDEV-HA5 vaccine to H5 subtype highly pathogenic avian influenza virus in the present invention.

Figure 22: be the protection ratio schematic diagram of rDEV-HA5 vaccine to duck enteritis virus in the present invention.

Figure 23: be in the present invention before and after duckling immunity rDEV-HA9 vaccine to avian influenza virus H9N2(W1) the monitoring schematic diagram of HI antibody titer.

Figure 24: be before and after duckling immunity rDEV-HA9 vaccine, the ELISA of duck enteritis virus serum antibody to be monitored to schematic diagram in the present invention.

Figure 25: be the protection ratio schematic diagram of rDEV-HA9 vaccine to H9 subtype avian influenza virus in the present invention.

Figure 26: be the protection ratio schematic diagram of rDEV-HA9 vaccine to duck enteritis virus in the present invention.

Embodiment

The structure of embodiment 1BAC homology arm and the formation of multiple copied

1, the virus genomic extraction of duck viral enteritis (DEV)

Frozen this biomaterial of duck enteritis virus vaccine strain C-KCE(is delivered, referring to document 16(Chen et al.Wei Zou et al.Construction of a full-length infectious bacterial artificial chromosome clone of duck enteritis virus vaccine strain.Virology Journal2013,10:328) its genomic dna sequence is submitted to, sees GenBank ID:KF263690.This strain is that state Key Laboratory of Agricultural Microbiology gathered pathological material of disease in duck field, Hubei China province Xianning in 2010.Preparation method is as follows: the duck field pathological material of disease collecting is added and carry out homogenate after 0.9% physiological saline and by the supernatant inoculated into chick embryo after centrifugal, after blind passage three generations, collect chick embryo allantoic liquid and obtain duck enteritis virus vaccine strain C-KCE) the continuous freeze thawing of sick cell 3 times, the 4 DEG C of centrifugal 20min sedimentation cell of 8000rpm fragments.Collect supernatant, 30% (w/w) sucrose solution is rebasing, the 4 DEG C of centrifugal 60min precipitation of 16000rpm virus particle.Discard supernatant, add distilled water that virus particle is suspended.Add Proteinase K to final concentration 500 μ g/rnL, sodium lauryl sulphate (SDS) is to final concentration l%.Put 56 DEG C of water-bath l h.To digest isopyknic V for after product (phenol): V (chloroform)=volume ratio and be l:l and the each extracting of chloroform once, the centrifugal 15min of 16000rpm.Get supernatant liquor and add wherein to have and add isopyknic Virahol to mix gently ,-20 DEG C of precipitate nucleic acids 2h.The 4 DEG C of centrifugal 20min precipitation of 16000rpm DNA, 70% cold washing with alcohol once, reclaims nucleic acid precipitation, is resuspended in TER (TE that contains RNA enzyme) room temperature effect 10min, fully digests RNA, after digestion, uses as template.

2. be the portion gene group sequence of duck enteritis virus at UL26 and UL27(UL26 and UL27, GenBank:EU082088.2) between, insert BAC carrier: (upstream and downstream primer is respectively UL26-F and UL26-R to the restriction enzyme site of UL26 two ends introducing NotI and PacI, the concrete sequence of primer is in table 1), the restriction enzyme site (upstream and downstream primer is respectively UL27-F and UL27-R, and the concrete sequence of primer is in table 1) of Pac I is introduced in UL27 upstream.Taking the genome of C-KCE as template, homology arm is got off with pcr amplification.With pcDNA3.1(as shown in Figure 2, this plasmid is given by professor Ma Lixin of Life Science College, Hubei Univ.) be template amplification amp replicon, and introduce the restriction enzyme site (upstream and downstream primer is respectively Amp-F and Amp-R, and the concrete sequence of primer is in table 1) of Pac I at two ends.Taking pRTRA plasmid (being given by professor Ma Lixin of Life Science College, Hubei Univ.) as template amplification RFP gene, and introduce the restriction enzyme site (upstream and downstream primer is respectively RFP-F and RFP-R, and the concrete sequence of primer is in table 1) of Sal I in downstream.Pcr amplification system: Easy-Taq0.25 μ L; 10xbuffer2.5 μ L, dNTP2 μ L, template 2 μ L, the each 1 μ L of upstream and downstream primer (UL26-F and UL26-R, or UL27-F and UL27-R, or Amp-F and Amp-R, or RFP-F and RFP-R), ddH ₂o polishing 25 μ L, react by following program after mixing: 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, by each primer annealing temperature, 40s, extends 1min, 30 circulations, last 72 DEG C are extended 10min.

Adopt overlapping PCR method (pcr amplification system: Easy-Taq0.25 μ L; 10xbuffer2.5 μ L, dNTP2 μ L, template 2 μ L, the each 1 μ L of three pairs of upstream and downstream primers (UL26-F and UL26-R, UL27-F and UL27-R, RFP-F and RFP-R), ddH ₂o polishing 25 μ L, after mixing, react by following program: 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 52 DEG C of annealing, 40s, 72 DEG C are extended 5min, 30 circulations, last 72 DEG C are extended 10min) three is linked together, then be cloned into Sal I, the pBlue-lox carrier (as shown in Figure 4, being given by professor Ma Lixin of Life Science College, Hubei Univ.) that Not I enzyme is cut is upper, obtains restructuring pBlue plasmid.Amp replicon is cloned into and in the restructuring pBlue plasmid that PacI enzyme cuts, obtains with the transfer vector pBlue-UL27-UL26(length of amp replicon to be 12,545bp, to build flow process and see Fig. 1, and its gene structure composition is shown in Fig. 3, and plasmid figure is shown in Fig. 5).

Table 1 PCR and overlapping PCR primer

In primer, being with underscore part to be expressed as Loxp partial sequence, is the restriction enzyme enzyme sequence in each primer with point type underscore part.

Screening and the purifying of embodiment 2 recombinant viruses

The preparation of 1.CEF cell

Get the SPF chicken embryo (purchased from Beijing Cimmeria Wei Tong laboratory animal Technology Co., Ltd.) of 9-10 age in days, with after cotton ball soaked in alcohol sterilization, with aseptic taking-up chicken embryo after the de-iodine of tincture of iodine wiping air chamber portion, be placed in aseptic vial ware, and removal head, four limbs and internal organ shred with eye scissors.With phosphate buffered saline buffer (abbreviation PBS, the formula: Na of sterilizing ₂cO ₃1.59g, NaHCO ₃2.93g, uses ddH ₂o is settled to 1000ml, adjusting pH is 7.4) washed twice in bacterium bottle, add after 37 DEG C of water-baths digestion 30min of appropriate 0.25% pancreatin, pancreatin is abandoned in suction, with the appropriate DMEM substratum (purchased from GIBCO company) with twin antibiotic (penicillin 100u/mL, Streptomycin sulphate 100u/mL) containing foetal calf serum (10 %), piping and druming disperses cell, with after six layers of filtered through gauze, with appropriate density (10 ⁷) access cell bottle is for subsequent use.

2. the screening of recombinant virus and purifying

In six orifice plates, access DEV virus (duck enteritis virus vaccine strain C-KCE with 10MOI, source and sequence are with embodiment 1), after two hours, with the rBAC homology arm carrier of Pac1 linearization for enzyme restriction, (length is 10705bp in transfection, linearizing DNA homology recombination efficiency is higher), within after transfection 6 hours, changing opti-MEN(buys from GIBCO company), after 24 hours, collect virus particle.

By the virus particle of collecting 10 ^-4, 10 ^-5, 10 ^-6receive on the CEF cell (seeing the preparation of CEF cell in case study on implementation 2) that covers with approximately 90%, 37 DEG C, CO ₂in incubator, leave standstill after two hours, the agarose of the low melting point isopyknic 2% and containing phenol red 2X DMEM(purchased from GIBCO company) mix, add containing above-mentioned 1% dual anti-serum by 1% final concentration respectively, for example, after dropping to suitable temperature (37 DEG C), every hole adds 2mL agarose, places the formation of 3 days wait plaques of cell culture incubator after 4 DEG C of standing 10min.

The plaque forming is placed under fluorescent microscope, find the plaque with red fluorescence.The purifying of next round will be done with the plaque of red fluorescence, until be the plaque (as shown in Figure 6) of red fluorescence completely.

Recombinant virus electricity is proceeded to intestinal bacteria DH10B-IS by embodiment 3

The competent preparation of 1.DH10B-IS: the intestinal bacteria of-80 DEG C of preservations (DH10B-IS, Academy for Life Science, Hubei University professor Ma Lixin give) are rule on LB flat board, 37 DEG C of overnight incubation.Single the intestinal bacteria of activation bacterium colony is accessed to LB or adds corresponding microbiotic (paraxin (Cam), 34pg/mL, Streptomycin sulphate (Str) 50pg/mL) LB liquid nutrient medium in, 37 DEG C of 200～250r/min concussion overnight incubation transferase 10 .2～1mL overnight culture are to being equipped with in the triangular flask of 200mL LB.At 37 DEG C, thermal agitation is cultivated 2～6 hours, and timing detects OD ₆₀₀value.Work as OD ₆₀₀value reaches at 0.7～1.0 o'clock, takes out Erlenmeyer flask from shaking table, is placed in mixture of ice and water, ice bath 15min.Collect thalline with the aseptic centrifuge tube of precooling, 4 DEG C of centrifugal 10min of 6000r/min, abandon supernatant liquor.With 10% aseptic glycerine solution Eddy diffusion cell of precooling, centrifugal, careful abandoning supernatant.Repeating step above-mentioned steps once.With 10% glycerine resuspension cell to final volume be 1mL.Pack cell into Eppendorf tube by 100 μ L equal portions, for subsequent use in-80 DEG C of refrigerators.

2. intestinal bacteria electricity transforms: in aseptic 1.5mL centrifuge tube, add its gene of DEV recombinant virus genomes DNA5 μ g(of cyclisation to be transformed to form as shown in Figure 7), add the electricity of 20 μ L to turn competent cell, softly mix ice bath 1～2min.DNA and competent cell mixture are drawn in the electric revolving cup of ice-cold sterilizing of 0.1 μ m, knock gently electric revolving cup and make mixture evenly enter the bottom of electric revolving cup, ice bath 3-5min.Electricity turns condition and is set as 1500V, 200 Ω, 25 μ F.The globule of electric revolving cup surrounding is blotted with thieving paper, put into immediately electroporation chamber, click pulse key, hear buzzer and see the shock parameters having shocked by electricity on rear display screen, in electric revolving cup, add immediately SOC substratum (the LB substratum of the lmL of 37 DEG C, contain 0.2mmol/L glucose, 0.1mmol/L MgSO ₄, 0.1mmol/L MgCl ₂), after re-suspended cell, sucking-off is transferred in the aseptic Eppendorf pipe of 1.5mL, 37 DEG C, 225 revs/min are shaken bacterium recovery l h, get 20 μ L converted products and add 200 μ LSOC coated plates, every 100 μ L coat on 1 dual anti-property LB culture medium flat plate containing paraxin (Cam, 34pg/mL) and Streptomycin sulphate (Str50pg/mL), cultivate 24h for 37 DEG C and check conversion results.

The qualification that embodiment 4 contains the complete genomic BAC plasmid of DEV virus

1. contain the extraction of the DEV complete genomic BAC plasmid of virus (pBAC-C-KCE)

To clone with ordinary gel electrophoretic method preliminary evaluation BAC molecular cloning virus, with Qiagen plasmid Midi kit test kit, (in QIAGEN, amount is extracted test kit, purchased from Qiagen company) purifying: by the positive colony of preliminary evaluation BAC molecular cloning virus, line containing on the resistance LB culture medium flat plate of paraxin (Cam34pg/mL), cultivate 24h for 37 DEG C, picking positive colony, bottle shake after bacterium 16h again with in bottle shake bacterium 200mL, shake bacterium 16h to 18h, press the plasmid that test kit specification sheets and improved method are extracted BAC molecular cloning virus, with 500mL sterilizing centrifugal bottle, 4 DEG C, 6000 leave heart 15min, abandon supernatant as far as possible, add P1 solution (containing LyseBlue and RNaseA enzyme, purchased from Qiagen company) 10mL, thoroughly mix.Add P2 solution (purchased from Qiagen company) 15mL, mix gently immediately, until evenly blue.Add P3(purchased from Qiagen company) solution 15mL, mix gently immediately, thoroughly disappear till blue.4 DEG C, 20000 leave heart 30min, and supernatant is crossed to pillar, use Wash Buffer(purchased from Qiagen company) washed twice, add 200 μ L TE to elute for subsequent use.

2. the rescue of virus

The plasmid pBAC-C-KCE extracting is used to method (document 13 specifically sees reference) the transfection CEF cell of calcium phosphate, after 3 to 4 days, observe pathology, the plasmid pBAC-C-KCE that can produce pathology is delivered to the order-checking of south, Shanghai genome company, prove that it has complete DEV genome, by BAC-C-KCE plasmid called after duck enteritis virus artificial chromosome plasmid pBAC-C-KCE(correct checking as shown in Figure 8,), the preservation name of biological material specimens is called intestinal bacteria DH10B-1S ₂/ BAC-C-KCE, Escherichia coli DH10B-1S ₂/ BAC-C-KCE, delivers China on August 20th, 2013. Wuhan. and the center preservation of Wuhan University's Chinese Typical Representative culture collection, deposit number is CCTCC NO:M2013377.

The transformation of embodiment 5pRThGA carrier

Given by professor Ma Lixin of Life Science College, Hubei Univ. taking plasmid pCAGGS() be template, classify as taking pCAGGS-ISce1-H1F(nucleotides sequence: AAATAGGGATAACAGGGTAATGTTGAGCCTTTTTGTGGAGTGGGTTAAATTGTACT AGCGCGTTTCGCTTTGCAGTACATCTACGTATTAGTCATCGCTATTA) and pCAGGS-ISce1-H1R(nucleotides sequence classify as: the AAATAGGGATAACAGGGTAATTAGCATGCATAACTTCGTATAATGTATGCTATACG AAGTTATGCGGCCGCCACACAGGAAACAGCTATGACCATGATTAC) region as primer amplification CMV.IE enhancer to rabbit beta-globin polyA, introduce respectively homology arm H1 (sequence is GTTGAGCCTTTTTGTGGAGTGGGTTAAATTGTACTAGCGCGTTTCGCTTT) at two ends, H2(sequence is GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATGCATGCTA) and the restriction enzyme site of I-SceI, obtain product 1.

With pRThGA plasmid, (professor Ma Lixin of Life Science College, Hubei Univ. gives, see the picture left above of Fig. 9) be template, the region as primer amplification oriI to I-SceI taking Amp t (ISceI) F and oriT R6K (ISceI) R, the restriction enzyme site of I-SceI is introduced at two ends respectively, obtains product 2.Primer used is as table 2(pCAGGS-ISceI-H1F and pCAGGS-ISceI-H1R).Pcr amplification system: Easy-Taq0.25 μ L; 10xbuffer2.5 μ L, dNTP2 μ L, template 2 μ L, the each 1 μ L of upstream and downstream primer (pCAGGS-ISceI-H1F and pCAGGS-ISceI-H1R), ddH ₂o polishing 25 μ L, react by following program after mixing: 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 52 DEG C of annealing, 40s, 72 DEG C are extended 1min, 30 circulations, last 72 DEG C are extended 10min.

(referring to document 14) cut, reclaims, is connected, transformed to above product 1 with product 2 use I-SceI enzymes.Correct its nucleotide sequence of plasmid called after pRTHGA1(of order-checking qualification is shown in to SEQ ID NO:5, sees figure below of Fig. 9).

The design of primers of table 2PCR reaction

HA is building up to pRTHGA1 by embodiment 6

In the present embodiment, extract fowl influenza virus strain A/Duck/Hubei/xn/2007 (H5N1), deliver referred to as this biomaterial of xn/07(, referring to document 17(document: Wei Zou et al.The antigenic property of the H5N1avian influenza viruses isolated in central China.Virology Joumal2012,9:148, its genomic dna sequence is submitted to, temporary GenBank accession NO:KJ003984～KJ003991.Belong to H5N1 hypotype, this strain is that state Key Laboratory of Agricultural Microbiology gathered in pathological material of disease and separates and obtain in duck field, Hubei China province Xianning in 2007, method is in the duck field pathological material of disease collecting, after adding 0.9% physiological saline, carry out homogenate and by the supernatant inoculated into chick embryo after centrifugal, after blind passage three generations, collect chick embryo allantoic liquid and obtain fowl influenza virus strain A/duck/Hubei/xn/2007 (H5N1).

In the present embodiment, extract fowl influenza virus strain A/Duck/HuBei/W1/2004 (H9N2), deliver referred to as this biomaterial of W1/04(, referring to document 18:(document: Xiao-Juan Xu et al.Evolutionary characterization of influenza virus A/duck/Hubei/W1/2004 (H9N2) isolated from central China.Virus Genes (2008) 36:79 – 83)) its genomic dna sequence submits to, sees GenBank ID:DQ465400.Belong to H9N2 type, this strain is that state Key Laboratory of Agricultural Microbiology gathered pathological material of disease in duck field, Hubei China province Xianning in 2004, after adding 0.9% physiological saline, carry out homogenate and by the supernatant inoculated into chick embryo after centrifugal, after blind passage three generations, collect chick embryo allantoic liquid and obtain fowl influenza virus strain A/Duck/HuBei/W1/2004 (H9N2).

According to ordinary method, after the RNA of extraction fowl influenza virus strain xn/07 and W1/04, identify by RT-PCR, after qualification is correct, by frozen in-80 DEG C to above-mentioned seed culture of viruses xn/07 and W1/04, react the target gene fragment HA that obtains two strain virus by RT-PCR, react primer used in table 3, amplification obtains the HA sequence (sequence is referring to temporary GenBank accession NO:KJ003987 and GenBank ID:DQ465400.1) of two strain virus.Concrete building process is as follows:

The primer of table 3RT-PCR reaction

1.RNA extraction and cDNA's is synthetic

Fowl influenza virus strain xn/07 and W1/04 allantoic fluid sample being placed in to the centrifugal 10min of 12000rpm/min, getting supernatant 200 μ L, add 1mL TRIZOL(reagent) solution (purchased from precious biotechnology Dalian company limited) fully mixes, for subsequent use.Concrete grammar is with reference to the specification sheets of TRIZOL reagent, and concrete steps are as follows:

(1) get the about 1.2mL of processed good sample, add 200 μ L chloroforms, concuss, in mixing about 20s under state; Ice bath 10min immediately, the centrifugal 10min of 12000g under 4 DEG C of conditions;

(2) get supernatant, add equal-volume Virahol, mix, under room temperature, place 10min, the centrifugal 10min of 12000g;

(3) thoroughly abandon clean supernatant, add 1mL75% ethanol, mix, the centrifugal 10min of 7500g under 4 DEG C of conditions;

(4) repeated washing once;

(5) abandon supernatant, dry 5～10min under room temperature, not overdrying, with 30 μ L without RNase H ₂o dissolves, and puts 10min left and right; Get above-mentioned RNA product 25 μ L, add following reagent: AMV (50U/ μ L) 1 μ L, RRI (40U/ μ L) 0.5 μ L, 5 × buffer8 μ L, dNTP4 μ L, U12 (10pmol) 1 μ L, ddH ₂o polishing 40 μ L.Reaction conditions is 42 DEG C of 1h, 94 DEG C, and 5min.Reaction product is directly used in PCR or-20 DEG C of preservations.

2.PCR amplification and product reclaim

Get above-mentioned RT-PCR product (cDNA) 3 μ L, add following reagent: Easy-Taq0.25 μ L, 10xbuffer2.5 μ L, dNTP2 μ L, the each 1 μ L of upstream and downstream primer (H5SmalI F and H5XhoI R or H9SmalI F and H9XhoI R), ddH ₂o polishing 25 μ L, react by following program after mixing: 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 52 DEG C of annealing, 40s, extends 1min, 30 circulations, last 72 DEG C are extended 10min.Pcr amplification product and pRTHGA1 carrier are used respectively after SmaI and XhoI double digestion, by 0.8%-1.5% agarose gel electrophoresis, reclaim target fragment through test kit (GenClean pillar sepharose DNA reclaims test kit, purchased from Shanghai Jierui Biology Engineering Co., Ltd).

3. being connected of target fragment HA and carrier pRTHGA1, conversion

Ligation system is 10 μ L, wherein adds 3 μ L recovery product HA5 or HA9,1 μ L to reclaim product pRTHGA1,1 μ L T4DNAligase, and 5 μ L2xRapid ligation Buffer(connect test kits purchased from Promega company).16 DEG C of water-baths connect spends the night.To connect product (pRTHGA-HA) is transformed in donor bacterium E.coli strainDH10 β and is seeded in the LB liquid nutrient medium that has added 100pg/mL Amp, screening positive clone sequence verification, by plasmid difference called after pRTHGA-HA5(correct checking as shown in figure 11) and pRTHGA-HA9(is as shown in figure 12).

The embodiment 7MAGIC mediation HA upper red fluorescent protein that substitutes of DEV of recombinating

Respectively the donor bacterium E.coli strainDH10B that contains recombinant plasmid pRTHGA-HA5 and pRTHGA-HA9 is seeded in the LB liquid nutrient medium that has added 100pg/mL Amp, recipient bacterium E.coli DH10B-IS (containing plasmid pML300+pBAC-C-KCE) is seeded in the LB liquid nutrient medium that has added spectinomycin (50pg/mL) and kantlex (kan) (50pg/mL) He 0.2% (w/v) glucose to 30 DEG C of overnight incubation; Centrifugal collection next day recipient bacterium, wash this thalline twice with 2 times of volume LB liquid nutrient mediums, by donor bacterium (containing recombinant plasmid pRTHGA-HA or pRTHGA-HA9) and recipient bacterium all by the volume ratio of 1:25, l:50, l:100 or l:200, dilute with the LB liquid nutrient medium that has added 0.2% (w/v) rhamnosyl, then at 30 DEG C, cultivate 2h, until OD ₆₀₀reach 0.15-0.25; According to OD ₆₀₀value, by donor bacterium and recipient bacterium by volume the volume ratio of 1:1 mix, 37 DEG C leave standstill and cultivate 2h, then shaking culture 2h; 100 times of coatings of mixture diluted are added to the LB solid medium flat board of Cam (34pg/mL) and 0.2% (W/V) Amp, 42 DEG C of overnight incubation (techniqueflow as shown in figure 13).The plasmid called after pBAC-C-KCE-HA5(that PCR is identified to gained restructuring HA is as shown in Figure 14 and Figure 16), the plasmid called after pBAC-C-KCE-HA9(that PCR is identified to gained restructuring HA9 is as shown in Figure 15 and Figure 17).

The rescue of embodiment 8 recombinant viruses

Respectively by method (document 13 specifically sees reference) the transfection CEF cell of the BAC-C-KCE-HA5 plasmid extracting and BAC-C-KCE-HA9 plasmid utilization calcium phosphate, after 3 to 4 days, observe pathology, BAC-C-KCE-HA5 plasmid and the BAC-C-KCE-HA9 plasmid that can produce pathology are delivered to the order-checking of south, Shanghai genome company, prove that it has complete DEV and HA genome, the duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE-HA5 that the correct BAC-C-KCE-HA5 plasmid called after of checking is contained to expression of influenza virus H5 hypotype hemagglutinin, we deliver the called after intestinal bacteria DH10B-1S of the biological material specimens of preservation ₂/ BAC-C-KCE-HA, Escherichia coli DH10B-1S ₂/ BAC-C-KCE-HA, delivers to China on August 20th, 2013. Wuhan. and the center preservation of Wuhan University's Chinese Typical Representative culture collection, deposit number is CCTCC NO:M2013378.The duck enteritis virus artificial chromosome pBAC-C-KCE-HA9 plasmid that the correct BAC-C-KCE-HA9 plasmid called after of checking is contained to expression of influenza virus H5 hypotype hemagglutinin, we will deliver the biomaterial called after intestinal bacteria DH10B-1S of preservation ₂/ BAC-C-KCE-HA9, Escherichia coli DH10B-1S ₂/ BAC-C-KCE-HA9, delivers to China on December 31st, 2013. Wuhan. and the center preservation of Wuhan University's Chinese Typical Representative culture collection, deposit number is CCTCC NO:M2013740.

The deletion of the BAC skeleton of embodiment 9Cre-Loxp restructuring mediation

Referring to document: JichunWang et al., the method of 2011 reports, by the eukaryon expression plasmid transfection CEF cell of pCAGGS-NLS/cre, after 12 hours with 1 MOI(multiplicity of infection, multiplicity of infection dosage) respectively inoculation contain pBAC-C-KCE-HA5 or pBAC-C-KCE-HA9 virus, plaque purifying after 24 hours, by the method qualification (primers F: TTTATTCAACAGTGGCGAGTTC of PCR, R:TATGCCGGCGTACACCGAGA, 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 54 DEG C of annealing 40s, 72 DEG C are extended 1min, 30 circulations, last 72 DEG C are extended 10min) whether BAC skeleton cut, 3 to 4 obtain after taking turns not containing BAC skeleton, only stay rDEV-HA5 virus or the rDEV-HA9 virus in next 34bpLoxp site (its nucleotide sequence is shown in shown in sequence table SEQ ID NO:3 and 4).

Embodiment 10 utilizes Western Blot method to detect the expression of HA

When the recombinant virus of above-mentioned rDEV-HA5 and rDEV-HA9 purifying and DEV virus are connect to CEF cell and reaches 50% pathology, collecting cell albumen carries out SDS-PAGE electrophoresis (working method is referring to document 14).In the time that SDS-PAGE electrophoresis will finish, with distilled water drip washing graphite cake, dry with non-absorbent paper handkerchief.Put on one's gloves, cut 6 3MM filter paper and 1 nitrocellulose filter.The size of filter paper and film will equate or be slightly less than gel (otherwise contacting of two filter paper edges can cause short circuit current) completely with the size of gel, nitrocellulose filter float on a dish deionized water above, after first borrowing wicking action that film is soaked from the bottom up, film is immersed in water completely, soak 5min and remove bubble residual on filter membrane, make marks one jiao of filter membrane with soft pencil.In a pallet, add a small amount of electricity to turn damping fluid (take 2.9g glycine, 5.8g Tris alkali, 0.37g SDS, adds 200mL methyl alcohol, adding water to total amount is 1000mL), 6 filter paper are soaked in wherein.The installation transfer device that puts on one's gloves, keeps flat bottom electrode (anode), and graphite, is placed 3 filter paper that soaked on one side upward on this electrode, and Accurate align, drives bubble out of with glass stick, and nitrocellulose filter is placed on filter paper, and guarantee is alignd, and there is no bubble.Take off gel from electrophoresis chamber, transfer in deionized water rinsing slightly and once, then accurately lie against on nitrocellulose filter, the gel lower left corner and filter membrane label alignment, wear gloves and get rid of bubble.Last 3 filter paper are placed on to gel top, ensure that equally Accurate align does not stay bubble.The electrode of top (negative electrode) is placed on interlayer thing, and graphite, connects power supply on one side down, presses 0.65mA～1.0mA/cm according to gel area ²making current, electrotransfer 1.5～2h.

Western-blot method: transfer printing or naturally dry after end, above-mentioned gained NC film is placed in to TBST (Tris-base2.42g, NaCl8.77g, adjust pH to 7.2-7.4, be settled to 1000mL, then add Tween-202Ml) in, rinsing once, put into again confining liquid (TBST+1%(w/v) bovine serum albumin, i.e. BSA) in, 37 DEG C of mild shake 1-2h or 4 DEG C spend the night.Then NC film is taken out, primary antibodie (the monoclonal antibody of mouse source HA with TBST dilution, rabbit source gB's is how anti-, the monoclonal antibody of internal reference GAPDH is all purchased from the biological limited liability company in bright Asia, Wuhan) 37 DEG C of reaction 1h, TBST washing 4-6 time, each 5min, adding two, anti-(mouse two is anti-and rabbit two is anti-, purchased from the biological limited liability company in bright Asia, Wuhan) 37 DEG C of reaction 1h, TBST washes 4-6 time, each 5min, is placed in film on clean filter paper, to blot surperficial moisture and develop the color for chemoluminescence (ECL, enhanced chemiluminescen).

ECL colour developing: add ECL by 2mL/ film, and obtain Western Blot result (seeing Figure 18) on Kodak2000MM.

Embodiment 11 is the Efficacy evaluation to duckling to recombiant vaccine rDEV-HA5

The preparation of 1.rDEV-HA5 vaccine

The rDEV-HA virus of recombinating and DEV virus inoculation CEF cell (see CEF cell preparation) in embodiment 2, when cytopathy reaches 80% when above, aseptic results virus, carries out plaque counting (PFU), reaches 3x10 ⁷pFU left and right can be used as vaccine seed liquid.

The safety testing of 2.rDEV-HA5 vaccine

Buy half kind of duck of the healthy young bird of 7 ages in days (Hubei Hong Xiang agricultural development company limited) 45 from Pest-or disease-free area, while raising to 14 age in days, be divided at random 3 groups, every group of 15 ducklings, are respectively PBS(phosphoric acid salt buffer formula: NaCl:8g, KCl:0.2g, Na ₂hPO ₄12H ₂o:2.9g, KH ₂pO ₄: 0.2g, uses ddH ₂o is settled to 1000mL (pH=7.4)) control group, rDEV-HA5 high dose group, rDEV – HA5 low dose group.Penetrate a 500 μ L/ PBS, 500 μ L/ high dosage vaccine liquid (100x10 through leg intramuscular injection respectively ⁵pFU), a 500 μ L/ Low dose vaccine liquid (10 ⁵pFU); Continuous Observation 14 days, duckling mental status is good, has no adverse reaction, all healthy survivals, proving the present invention relates to vaccine is safe to immune animal.

The immune protective effect of 3.rDEV-HA5 vaccine

Buy 45 of the healthy young half kind of ducks of 7 ages in days from Pest-or disease-free area, while raising to 14 age in days, be divided at random 3 groups, every group of 15 ducklings, are respectively PBS control group, rDEV-HA5 group, DEV group.Respectively through leg intramuscular injection penetrate PBS500 μ L/ only, rDEV-HA5 vaccine liquid 500 μ L/ only (10 ⁵pFU), DEV vaccine liquid 500 μ L/ only (10 ⁵pFU) carry out immunity, Continuous Observation a couple of days, duckling mental status is good, has no adverse reaction, all healthy survival.Before immunity and after immunity, take a blood sample weekly and once collect the antibody horizontal detection of serum for avian influenza virus H 5 N 1 (XN) and duck enteritis virus.

The antibody HI of 3.1 pairs of avian influenza virus H 5 N 1s (XN) detects

Method is with reference to the HI experiment of International Animal Health tissue (OIE), concrete steps are as follows: in 96 hole blood-coagulation-boards, add PBS liquid 30 μ L/ holes, in the first hole, add again viral allantoic fluid 30 μ L, doubling dilution, add 1% chicken red blood cell 30 μ L/ holes, concussion mixes, and room temperature is placed 30min, records HA tire until aggegation blood cell not after precipitating completely.In the time that HI tests, by viral dilution to 4 HAU, then in 96 hole blood-coagulation-boards, add PBS liquid 30 μ L/ holes, in the first hole, add again serum 30 μ L to be checked, doubling dilution, adds 4 HA unit's viral dilution liquid, 30 μ L/ holes, and concussion mixes, room temperature leaves standstill 30min, add people 1% chicken red blood cell 30 μ L/ holes, concussion mixes, and room temperature leaves standstill 30min, after precipitating completely, record HI until aggegation blood cell not and tire, the results are shown in Figure 19.Antibody surveillance demonstration, two weeks rear highly pathogenic bird flu virus H 5 N 1 (XN) antibody horizontals of immunity raise gradually and stablize, and after 9 weeks, antibody horizontal declines.

The antibody horizontal of 3.2 duck enteritis viruses detects (indirect ELISA method)

3.2.1 the preparation of reagent:

Coating buffer (25mmol/L carbonate buffer solution): Na ₂cO ₃: 1.59g, NaHCO ₃: 2.93g, uses ddH ₂o is settled to 1000mL (pH9.6).

10 times of washings: NaCl:80g, KCl:2g, Na ₂hPO ₄12H ₂o:29g, KH ₂pO ₄: 2g, Tween-20:5mL, uses ddH ₂o is settled to 1000mL (pH=7.4).

Confining liquid: 5g skimming milk is dissolved in 100mL washings.

Substrate solution: be divided into substrate A liquid and substrate B liquid.Specifically composed as follows:

Substrate A liquid: the H of 0.006% concentration ₂o ₂damping fluid.

Substrate B liquid: get Na ₂hPO ₄12H ₂o:14.2g, citric acid: 10.5g, uses ddH ₂o is settled to 500mL and is made into 0.1mL phosphoric acid salt citrate buffer solution (pH=5.0), then be that 20mg/L interpolation benzidine (TMB) (when use mixes A liquid and B liquid equal-volume by final concentration, mix in latter 5 minutes and use, now with the current).

Stop buffer (final concentration 0.025% hydrofluoric acid solution): getting concentration is 40% hydrofluoric acid solution 625 μ L, is settled to 100mL with ddH2O.

3.2.2 indirect ELISA operation steps

(1) preparation of envelope antigen: by DEV virus inoculation CEF cell, when cytopathy reaches 80% when above, aseptic results virus, after multigelation 3 times, gets viral supernatant liquor in 4 DEG C of centrifugal 60min of 10000r/min, collects supernatant liquor; The sucrose solution of 300g/L is rebasing, 4 DEG C of centrifugal 60min of 30000r/min, and precipitation suspends with appropriate PBS damping fluid.

(2) coated: taking best coated concentration (the 50 μ g/mL) coated elisa plate of purifying envelope antigen as 100 μ L/ holes, to hatch rearmounted 4 DEG C of 1h for 37 DEG C and spend the night.

(3) wash plate: abandon coating buffer, PBST washings, 200 μ L/ holes, wash 3 times, each 3min.(4) sealing: pat dry enzyme plate, add confining liquid, 200 μ L/ holes, hatch 2h for 37 DEG C, sealing nonspecific binding site.

(5) wash plate: abandon confining liquid, same to step (4).

(6) add serum to be checked: pat dry enzyme plate, add serum to be checked, 100 μ L/ holes, establish negative control, hatch 30min for 37 DEG C.

(7) wash plate: abandon sample liquid to be checked, same to step (4).

(8) add enzyme labelled antibody: pat dry the ELIAS secondary antibody (purchased from KPL company of the U.S.) that adds HRP mark after enzyme plate, volume ratio is 1: 1000 times of dilution, 100 μ L/ holes, place 30min for 37 DEG C.

(9) wash plate: abandon enzyme labelled antibody, same to step (3).

(10) colour developing: every hole adds the each 50 μ L of substrate A liquid, the substrate B liquid of newly joining, room temperature lucifuge colour developing 10min.

(11) termination reaction: every hole adds 50 μ L stop buffer termination reactions;

(12) measure OD630 value: OD value when microplate reader mensuration wavelength is 630nm.If OD630 value >=0.3, is judged to be the positive, OD630 value < 0.3, is judged to be feminine gender.

3.2.3 duck enteritis virus Serum Antibody Detection result

The duckling that 14 age in days head exempt from, two weeks rear antibody of immunity raises gradually and keeps stable, monitors and still has antibody to have (as shown in figure 20) after 12 weeks.4 vaccine immunity protections are evaluated

Duckling to immunity after 3 days carries out the evaluation of vaccine immunity protection.5 ducklings of every group of random picking leg flesh inoculation 100LD respectively ₅₀the protest test that carries out Highly Pathogenic Avian Influenza Virus (HPAIV) (A/duck/Hubei/XN/2007 (H5N1)) and duck enteritis virus of dosage.Every group of duckling respectively leg intramuscular injection penetrated 100LD ₅₀xN poison and the duck enteritis virus DEV of dosage.Result demonstration, the duckling of immune rDEV-HA5r has 80% protection ratio to XN poison, and the duckling of immune DEV has 50% protection ratio to XN poison, and PBS control group is after one week all dead (as shown in figure 21); The duckling of immunity rDEV-HA5 and DEV has 100% protection ratio to DEV poison, and PBS control group is attacked poison after one week all dead (as shown in figure 22).Result shows, rDEV-HA5 vaccine can produce effectively protection to Highly Pathogenic Avian Influenza Virus (HPAIV) H5 hypotype and duck enteritis virus.

The Efficacy evaluation of embodiment 12 recombiant vaccine rDEV-HA9 to duckling

The preparation of 1.rDEV-HA9 vaccine

The rDEV-HA9 virus of recombinating and DEV virus inoculation CEF cell, when cytopathy reaches 80% when above, aseptic results virus, carries out plaque counting (PFU), reaches 3x10 ⁷pFU left and right can be used as vaccine seed liquid.

The safety testing of 2.rDEV-HA9 vaccine

Buy 45 of the healthy young half kind of ducks of 7 ages in days from Pest-or disease-free area, while raising to 14 age in days, be divided at random 3 groups, every group of 15 ducklings, are respectively PBS control group, rDEV-HA9 high dose group, rDEV – HA9 low dose group.Penetrate a 500 μ L/ PBS, 500 μ L/ high dosage vaccine liquid (100x10 through leg intramuscular injection respectively ⁵pFU), a 500 μ L/ Low dose vaccine liquid (10 ⁵pFU); Continuous Observation 14 days, duckling mental status is good, has no adverse reaction, all healthy survivals, proving the present invention relates to vaccine is safe to immune animal.

The immune protective effect of 3.rDEV-HA9 vaccine

Buy 45 of the healthy young half kind of ducks of 7 ages in days from Pest-or disease-free area, while raising to 14 age in days, be divided at random 3 groups, every group of 15 ducklings, are respectively PBS control group, rDEV-HA9 group, DEV group.Respectively through leg intramuscular injection penetrate PBS500 μ L/ only, rDEV-HA9 vaccine liquid 500 μ L/ only (10 ⁵pFU), DEV vaccine liquid 500 μ L/ only (10 ⁵pFU) carry out immunity, Continuous Observation a couple of days, duckling mental status is good, has no adverse reaction, all healthy survival.Blood sampling is once collected serum for avian influenza virus H9N2(W1 weekly before immunity and after immunity) and the antibody horizontal of duck enteritis virus detect.

3.1 to avian influenza virus H9N2(W1) antibody HI detect

Method detailed and step are shown in 3.1 in embodiment 11, the results are shown in Figure 23.Antibody surveillance shows, immunity is avian influenza virus H9N2(W1 after one week) antibody horizontal raises gradually and stablizes, monitor 12 weeks afterwards antibody still exist.

3.2 duck enteritis virus antibody level of serums detect (indirect ELISA method).

Method detailed and step are shown in 3.2 in embodiment 11, the results are shown in Figure 24.The duckling of 14 age in days immunity, one week rear antibody of immunity raises gradually and keeps stable, monitors after 12 weeks and still has antibody to exist.

4 vaccine immunity protections are evaluated

Duckling to immunity after 3 days carries out the evaluation of vaccine immunity protection.5 ducklings of every group of random picking leg flesh inoculation 100LD respectively ₅₀the protest test that carries out avian influenza virus (A/duck/Hubei/W1/2004 (H9N2)) and duck enteritis virus of dosage.Every group of duckling respectively leg intramuscular injection penetrated 100LD ₅₀w1 poison and the duck enteritis virus DEV of dosage.Result demonstration, the duckling of immune rDEV-HA9 has 100% protection ratio to W1 poison, and the duckling of immune DEV has 60% protection ratio to W1 poison, and PBS control group, all morbidity or death (as shown in figure 25) after one week; The duckling of immunity rDEV-HA9 and DEV has 100% protection ratio to DEV virus, and PBS control group is attacked poison after one week all dead (as shown in figure 26).Result shows, rDEV-HA9 vaccine can produce effectively protection to H9 subtype avian influenza virus and duck enteritis virus.

Other unspecified part is prior art in this manual, and those skilled in the art can understand the present invention in detail by this specification sheets, sequence table and Figure of description and the prior art pointed out by the present invention, and can implement the present invention.

Although above-described embodiment has been made detailed description to the present invention; but it is only the present invention's part embodiment; instead of whole embodiment, people can also obtain other embodiment according to the present embodiment under without creative prerequisite, and these embodiment belong to protection domain of the present invention.

Reference:

1.Li?Y,Huang?B,Ma?X,Wu?J,Li?F,Ai?W,Song?M,Yang?H.Molecular?characterization?of?the?genome?of?duck?enteritis?virus[J].Virology,2009,391(2):151-161.

2.Domi?A,Moss?B.Engineering?of?a?vaccinia?virus?bacterial?artificial?chromosome?in?Escherichia?coli?by?bacteriophage?lambda-based?recombination[J].Nat?Methods,2005,2(2):95-97.

3.Adler?H,Messerle?M,Wagner?M,Koszinowski?U?H.Cloning?and?mutagenesis?of?the?murine?gammaherpesvirus?68?genome?as?an?infectious?bacterial?artificial?chromosome[J].J?Virol,2000,74(15):6964-6974.

4.Smith?B?N,Banfield?B?W,Smeraski?C?A,Wilcox?C?L,Dudek?F?E,Enquist?L?W,Pickard?G?E.Pseudorabies?virus?expressing?enhanced?green?fluorescent?protein:A?tool?for?in?vitro?electrophysiological?analysis?of?transsynaptically?labeled?neurons?in?identified?central?nervous?system?circuits[J].Proc?Natl?Acad?Sci?U?S?A,2000,97(16):9264-9269.

5.Smith?G?A,Enquist?L?W.A?self-recombining?bacterial?artificial?chromosome?and?its?application?for?analysis?of?herpesvirus?pathogenesis[J].Proc?Natl?Acad?Sci?U?S?A,2000,97(9):4873-4878.

6.Muyrers?J?P,Zhang?Y,Benes?V,Testa?G,Ansorge?W,Stewart?A?F.Point?mutation?of?bacterial?artificial?chromosomes?by?ET?recombination[J].EMBO?Rep,2000a,1(3):239-243.

7.Muyrers?J?P,Zhang?Y,Buchholz?F,Stewart?A?F.RecE/RecT?and?Redalpha/Redbeta?initiate?double-stranded?break?repair?by?specifically?interacting?with?their?respective?partners[J].Genes?Dev,2000b,14(15):1971-1982.

8.Jamsai?D,Orford?M,Nefedov?M,Fucharoen?S,Williamson?R,Ioannou?P?A.Targeted?modification?of?a?human?beta-globin?locus?BAC?clone?using?GET?Recombination?and?an?I-Scei?counterselection?cassette[J].Genomics,2003,82(1):68-77.

9.Suzuki?Y,Kagawa?N,Fujino?T,Sumiya?T,Andoh?T,Ishikawa?K,Kimura?R,Kemmochi?K,Ohta?T,Tanaka?S.A?novel?high-throughput(HTP)cloning?strategy?for?site-directed?designed?chimeragenesis?and?mutation?using?the?Gateway?cloning?system[J].Nucleic?Acids?Res,2005,33(12):e109.

10.Cherepanov?P?P,Wackernagel?W.Gene?disruption?in?Escherichia?coli:TcR?and?KmR?cassettes?with?the?option?of?Flp-catalyzed?excision?of?the?antibiotic-resistance?determinant[J].Gene,1995,158(1):9-14.

11.Li?M?Z,Elledge?S?J.MAGIC,an?in?vivo?genetic?method?for?the?rapid?construction?of?recombinant?DNA?molecules[J].Nat?Genet,2005,37(3):311-319.

12.Chowdhury,S.I.,and?W.Batterson.1994.Transinhibition?of?herpes?simplex?virus?replication?by?an?inducible?cell-resident?gene?encoding?a?dysfunctional?VP19c?capsid?protein.Virus?Res.33:67–87.

13.JichunWang,Nikolaus?Osterrieder.2011.Generation?of?an?infectious?clone?of?duck?enteritis?virus(DEV)and?of?a?vectored?DEV?expressing?hemagglutinin?of?H5N1avian?in□uenza?virus.Virus?Res.159(1):23-31.

14. Pehanorm Brooker J, not Ritchie EF, Manny A Disi T. molecular cloning test guide. Jin Dongyan, Li Mengfeng, Hou Yunde etc. the second edition. Beijing: Science Press, 2002

15. high gorgeous profits wait the research [J] of .SDS-PAGE electrophoretic technique analysing protein. Liaoning chemical industry .2007 (07)

16.Chen?et?al.Wei?Zou?et?al.Construction?of?a?full-length?infectious?bacterial?artificial?chromosome?clone?of?duck?enteritis?virus?vaccine?strain.Virology?Journal2013,10:328

17.Wei?Zou?et?al.The?antigenic?property?of?the?H5N1avian?influenza?viruses?isolated?in?central?China.Virology?Joumal2012,9:148

18.Xiao-Juan?Xu?et?al.Evolutionary?characterization?of?influenza?virus?A/duck/Hubei/W1/2004?(H9N2)?isolated?from?central?China.Virus?Genes(2008)36:79–83

Claims

1. a strain H5N1 subtype avian influenza virus and duck enteritis virus live vector vaccine strain rDEV-HA5, it is characterized in that, this vaccine strain is deposited in Chinese Typical Representative culture collection center, preserving number is CCTCC NO:V201404, it is the fragment of having inserted H5N1 subtype avian influenza virus ha gene in duck enteritis virus artificial chromosome plasmid pBAC-C-KCE, obtains recombinant plasmid pBAC-C-KCE-HA5 structure and forms; The composition of described plasmid pBAC-C-KCE as shown in Figure 8; The composition of described plasmid pBAC-C-KCE-HA5 as shown in figure 16.

2. one kind by the expressed H5N1 subtype avian influenza virus of claim 1 vaccine strain and duck enteritis virus live vector vaccine.

3. the application of vaccine strain claimed in claim 1 in preparation H5N1 subtype avian influenza and duck enteritis virus live vector vaccine.

4. the intestinal bacteria DH10B-1S of H5N1 subtype avian influenza virus ha gene and duck enteritis virus gene is expressed in a strain ₂/ BAC-C-KCE-HA, is deposited in Chinese Typical Representative culture collection center, and preserving number is CCTCC NO:M2013378.