CN104293820A

CN104293820A - H9N2 subtype avian influenza and duck enteritis virus bacterial artificial chromosome plasmid

Info

Publication number: CN104293820A
Application number: CN201410030951.3A
Authority: CN
Inventors: 金梅林; 邹忠; 李淑云
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2013-08-26
Filing date: 2014-01-22
Publication date: 2015-01-21
Also published as: CN103497967A; CN103882056A; CN103881981A; CN103881982A; CN103881981B

Abstract

The invention belongs to the technical field of animal genetic engineering, and particularly relates to construction of H9N2 subtype avian influenza virus and duck enteritis virus artificial chromosome plasmid pBAC-C-KCE-HA9. A construction method provided by the invention comprises a step of inserting H9N2 subtype avian influenza virus ha gene fragment in the duck enteritis virus artificial chromosome plasmid pBAC-C-KCE. A genetic structural composition of the plasmid is shown as a figure 15. Escherichia coli DH10B-1S2/BAC-C-KCE-HA9 for expressing the H9N2 subtype avian influenza virus and duck enteritis virus artificial chromosome plasmid pBAC-C-KCE-HA9 is sent to China Center for Type Culture Collection for preservation; and a preservation number is CCTCC NO: M2013740.

Description

H9N2 subtype avian influenza and duck enteritis virus bacterial artificial chromosome plasmid

Technical field

The invention belongs to animal gene engineering technology field, be specifically related to a kind of H9N2 subtype avian influenza virus and duck enteritis virus bacterial artificial chromosome plasmid and structure.

Background technology

Duck viral enteritis (Duck Virus Enteritis, DEV) duck plague (Duck Plague is had another name called, DP), by duck enteritis virus (Duck Enteritis Virus, the one of the Anseriformes birds such as the duck DEV) caused, goose is acute, contagious disease, and the bird at each age all can fall ill.Duck viral enteritis has the report of this disease in a lot of country, is also widely current in China.Because it is propagated rapidly, morbidity and mortality ratio high, reach 50-100%, become duck even more than 90%, become one of main epidemic disease of the foster duck industry of harm.In recent years, have successively about the genomic research report of duck enteritis virus; 2009, duck enteritis virus genome sequence was announced and has been logged in Genbank (Li Y et al., 2009), for the gene and protein function studying DEV provides strong reference data.Its Genome Size is about 150kb, and 78 protein of encoding, wherein have 67 albumen and herpes simplex virus group to have homology, 1 albumen and γ-simplexvirus homology, 5 and avian herpetoviruses homology.By the whole genomic clone of simplexvirus in BAC plasmid, the foreign gene with immunogenicity of other viruses of then recombinating in bacterium, thus build bivalent vaccine.

For the large genomic viral (being greater than 100kb) that simplexvirus is such, the difficulty of manipulation in vitro is very large, and conventional vitro enzyme is cut and is not suitable for the method be connected.The classical way of construction of recombinant virus is by with the transfer vector of goal gene and viral genome cotransfection mammalian cell, and in cell, homologous recombination obtains recombinant virus.Owing to there is the interference of wild-type virus, generally need could screen through too much bye spot purifying to obtain pure recombinant virus (Domi A et al., 2005; Horsburgh B C et al., 1999), this is a very loaded down with trivial details job, sometimes also can run into recombinant virus and to go down to posterity unstable problem.In order to overcome the limitation of this method, researchist attempts directly modifying viral genome in intestinal bacteria.What first attempt is intestinal bacteria Cosmid carrier.Because virogene is very large, and this bearer capabilities limited (about 40kb), viral genome must be divided into several sections, form the carrier of a set of overlap, be assembled into complete viral genome through intracellular repeatedly homologous recombination, produce restructuring poison.Cosmid carrier is unstable in intestinal bacteria, the efficiency of cotransfection is low, in addition, these carriers will through repeatedly homologous recombination in cell, its accuracy is difficult to ensure, deletion mutantion higher occurs, and thus still needing further Analysis and Identification to the recombinant virus be separated to, is not a kind of well method.

Under the needs of genomics research work, researchist develops a series of carrier and the host system that are applicable to large dna fragment cloning, the bacterial artificial chromosome carrier (BAC) derived as yeast artificial chromosome's carrier (YAC), colibacillary F-factor and the carrier based on phage replication (PAC).BAC carrier can be cloned greatly to the fragment of 300kb, and can stable copying (McGeoch D J et al., 1994) in intestinal bacteria.In recent years, a series of large double-stranded viruses genome is successively by BACization (Adler H et al., 2000; Borst E M et al., 1999; Azab W et al., 2002; Smith B N et al., 2000).After the viral genome transfectional cell of these BACization, can produce infectious virus particle in cell, this makes to utilize the genetic tool of bacterium to operate virus becomes possibility.But due to some unknown cause, be arranged in genome BAC carrier part less stable, after the viral genome transfectional cell of BACization, can there is disappearance in various degree in carrier and both sides virus genome sequence thereof.In order to address this problem, BAC carrier both sides respectively introduce a loxP site, this carrier proceeds in the zooblast of expressing Cre recombinase, the recombining reaction of Cre enzyme meeting catalysis between two sites, thus the carrier framework part of prokaryotic origin is removed from viral genome, only leave the sequence of the loxP of 34bp, ensure that genomic fidelity and integrity, avoid the impact of prokaryotic origin on the viral gene expression of on position vicinity as much as possible, the large genomic viral of bacterial genetic tool operation utilizing BAC to clone like this is more perfect, the BAC that the method is successfully used in Pseudorabies virus clones (Smith G A et al., 2000).Homologous recombination and Site-specific recombinase are the methods being extensively used to modify BAC clone.RecA homologous recombination system is intestinal bacteria homologous recombination system that people know the earliest.But homologous region reaches about 1000bp needed for the homologous recombination mediated by RecA, the difficulty of operation is large, relative time and effort consuming, thus makes it apply to be limited significantly.RecE/RecT homologous recombination system can occur between the homologous region of 20-25bp in the reaction of catalysis homology, homologous recombination efficiency higher (Muyrers J P et al., 2000; Muyrers J P et al., 2000a).Red-gam system and RecE/RecT similar, and recombination efficiency higher (Muyrers J P et al., 2000b; Jamsai D et al., 2003).So far, people combine (Red/ET) these two kinds of recombinant technologys and achieve and directly modify the target practice of aim sequence using PCR primer as donor molecule, effectively can carry out the modifications such as point mutation, insertion and disappearance to any gene on BAC clone.Site-specific recombinase mediates generation Site-specific recombinase between specific site by site-specific recombinase.General system has the Cre-loxP system (Smith G A et al., 2000) of P1 phage, enters the Int-att system (Suzuki Y et al., 2005) of phage, and the Flp-FRT system of yeast (Cherepanov P P et al., 1995).Site-specific recombination targeting is strong, recombination efficiency is high, is also the effective tool modifying BAC clone.This whole process is all carried out in bacterial body, can avoid isolated operation to a great extent to macromolecular damage.2005, Li M Z et al. developed an effective means, builds recombinant DNA molecules-mating auxiliary genetic in vivo integrate clone (MAGIC) (Li M Z et al., 2005) for methods of homologous recombination.

Bird flu (Avian influenza, AI) is the viral deadly infectious disease caused by influenza A (Avian influenza virus, AIV), is endanger one of the world and the most important epidemic disease of China's aviculture at present.Bird flu (Avian influenza, AI) is a kind of acute infectious disease caused by orthomyxoviridae family's influenza A, also known as fowl plague or European checken pest.Within 1878, this disease occurs in Italy first and constantly spreads; Popular on a large scale to occurring in Asia again at the beginning of 2004 at the end of 2003: and 1997 and within 2004, occur in the bird flu of Hong Kong and Vietnam respectively, breach obstacle direct infection people between kind and cause death.Bird flu in recent years frequently breaks out, and causes crushing blow to world's aviculture.Only country in Southeast Asia is because destroying the loss of infection poultry just more than 1,000 hundred million dollars, and the tens million of plumage of poultry is destroyed by China, and loss reaches hundreds of hundred million yuan.Within 2005, break out the high pathogenic avian influenza in Qinghai Lake, serious threat to the safety of wild Migrants, and has spread all over rapidly Europe, causes huge harm.H5N1 avian influenza virus causes global 553 people to infect, and 323 people are dead, and mortality ratio reaches 58.4%, and China 40 people infects, and 26 people are dead.High pathogenic avian influenza broken through species barrier can direct contagion to people, human health in serious harm.H9 subtype avian influenza virus is separated in turkey body by Hommee and Easterday (1970) the earliest.1994, Chen Bailun etc. were separated to H9 hypotype AIV in sick laying hen body.After this, H9 hypotype AIV extensively exists in China, many infection in low pathogenicity, and in the gesture spread gradually.To 1997, H9 hypotype AIV was distributed widely in each continent.The report that the states such as Korea S, Ireland, Italy have H9 bird flu to break out, illustrates that it establishes stable germline in poultry.Within 1998, in family's pig body in Hong Kong, be separated to 2 strain H9 subtype influenza virus, this in mammalian body, is separated to H9 subtype influenza virus first.1999 are separated to two strain H9 influenza viruses in girl's body of Hong Kong trouble influenza, its all gene fragment and AIV-A/Quail/Hong Kong/G1/97 (H9) very high homology are shown to the analysis of this two strain virus, be typical fowl source and course Influenza Virus, this strain is that Hong Kong native infects H5N1 and H9 hypotype closely-related branch representative strains.2000-2001, carry out influenza virus monitoring to the aquatic bird (mainly family duck) of southern area of China and find that about 10% aquatic bird is infected by H9, infection rate is 4 times of 20 century 70s.Although H9 subtype influenza virus can in interpersonal propagation also not have ample evidence to show, it has become one of Important Infectious Diseases of current serious harm human health.

Current, vaccine immunization may be the most economical method preventing bird flu epidemic situation and duck viral enteritis popular on a large scale.But adopt the operation of traditional method structure H5 and H9 subtype avian influenza vaccine strain more difficult, utilize the genetic manipulation means such as bacterial artificial chromosome technology, build the restructuring duck enteritis virus live vector vaccine containing influenza virus ha gene, the development for bird vaccine provides new technique means.

Summary of the invention

The object of the invention is to the defect overcoming prior art, the structure of a kind of H9N2 subtype avian influenza virus and duck enteritis virus bacterial artificial chromosome plasmid is provided.First we build the plasmid obtaining duck enteritis virus bacterial artificial chromosome, the i.e. bacterial artificial chromosome plasmid of duck enteritis virus (DEV) vaccine strain (C-KCE), provides a kind of structure of expressing the restructuring duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE-HA9 of H9N2 subtype avian influenza virus ha gene on this basis.The present invention utilizes large intestine bar (such as DH10B) and chick embryo fibroblast (CEF cell) again to save out DEV fast.Further, the present invention utilizes plasmid pRTHGA1, insert H9N2 subtype avian influenza virus ha gene, utilize mating auxiliary genetic to integrate clone's (i.e. MAGIC method) restructuring, the restructuring duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE-HA9 containing H9N2 subtype avian influenza virus ha gene can be obtained.

Realize main technical schemes of the present invention and step as described below:

(1) full-length genome (GenBank ID:KF263690) of duck enteritis virus (C-KCE) is inserted on BAC plasmid by the method for homologous recombination obtains a kind of duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE.Intestinal bacteria DH10B-1S containing this plasmid ₂/ BAC-C-KCE, Escherichia coli DH10B-1S ₂/ BAC-C-KCE, delivers China on August 20th, 2013. Wuhan. and Wuhan University's China typical culture collection center preservation, deposit number is CCTCC NO:M2013377;

(2) transform plasmid pRThGA as pRTHGA1, on pRTHGA1 plasmid, namely insert H5N1 subtype avian influenza virus ha gene (temporary GenBank accession NO:KJ003987) respectively and H9N2 subtype avian influenza virus ha gene (GenBank ID:DQ465400.1) obtains its structure of recombinant plasmid pRTHGA-HA5(as shown in figure 11) and its structure of recombinant plasmid pRTHGA-HA9(is as shown in figure 12);

(3) use the method for MAGIC respectively by the insertion duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE of the avian influenza virus ha gene fast and stable in plasmid pRTHGA-HA5 and pRTHGA-HA9, thus obtain recombinant plasmid pBAC-C-KCE-HA5 and pBAC-C-KCE-HA9(containing avian influenza virus ha gene and duck enteritis virus gene wherein pBAC-C-KCE-HA5 plasmid structure as shown in Figure 16, its nucleotide sequence total length is 169,784bp; The structure of pBAC-C-KCE-HA9 plasmid is shown in Figure 17, and its nucleotide sequence total length is 169,766bp).Intestinal bacteria DH10B-1S containing recombinant plasmid pBAC-C-KCE-HA5 ₂/ BAC-C-KCE-HA, Escherichia coli DH10B-1S ₂/ BAC-C-KCE-HA, delivers China on August 20th, 2013. Wuhan. and Wuhan University's China typical culture collection center preservation, deposit number is CCTCC NO:M2013378.Intestinal bacteria DH10B-1S containing recombinant plasmid pBAC-C-KCE-HA9 ₂/ BAC-C-KCE-HA9, Escherichia coli DH10B-1S ₂/ BAC-C-KCE-HA9, delivers China on December 31st, 2013. Wuhan. and Wuhan University's China typical culture collection center preservation, deposit number is CCTCC NO:M2013740.

(4) after respectively recombinant plasmid pBAC-C-KCE-HA5 and pBAC-C-KCE-HA9 transfection CEF cell being rejected BAC skeleton, the restructuring duck enteritis virus live vector vaccine strain rDEV-HA5(expressing H5N1 subtype avian influenza virus ha gene can be obtained respectively and deliver China on January 2nd, 2014. Wuhan. Wuhan University's China typical culture collection center preservation, preserving number is CCTCC NO:V201404) and the restructuring duck enteritis virus live vector vaccine strain rDEV-HA9(that expresses H9N2 subtype avian influenza virus ha gene deliver China on January 2nd, 2014. Wuhan. Wuhan University's China typical culture collection center preservation, preserving number is CCTCC NO:V201403).

(5) vaccine strain of step (4) gained is utilized to prepare H5N1 subtype avian influenza virus and duck enteritis virus live vector vaccine and H9N2 subtype avian influenza virus and duck enteritis virus live vector vaccine respectively.

The duck enteritis virus live vector vaccine of H5N1 hypotype prepared by the present invention and the restructuring of H9N2 subtype avian influenza virus can be used in and control in duck group, in H5N1 hypotype and H9N2 subtype avian influenza and duck viral enteritis, effectively to control the problem of H5N1 hypotype and H9N2 subtype avian influenza and duck viral enteritis in duck group.

More detailed technical scheme is see " embodiment ".

Beneficial effect of the present invention is:

1, the duck enteritis virus bacterial artificial chromosome in the present invention is utilized to substantially reduce the cycle obtaining recombinant virus.

2, in the present invention duck enteritis virus bacterial artificial chromosome restructuring foreign gene after carrier is rejected, non-functional exogenous array insert, on genome also without impact, do not exist genetic material occur across species transfer possibility.

3, recombinant viral vaccine rDEV-HA5 and rDEV-HA9 in the present invention is utilized can to reach the effect of preventing duck viral enteritis and H5 subtype influenza or H9 subtype influenza simultaneously.By parity of reasoning, utilizes the restructuring of the duck enteritis virus bacterial artificial chromosome in the present invention foreign gene can reach a pin anti-two the diseases even object of various diseases simultaneously.

Accompanying drawing explanation

Sequence table SEQ ID NO:1 is the nucleotide sequence of recombinant plasmid pBlue-UL26-UL27, length 12545bp, and wherein the sequence of underscore mark is respectively the nucleotide sequence of restriction enzyme SalI, PacI, NotI.Wherein, 1-6401 bit base is the partial nucleotide sequence of PBlue-lox carrier, and length is 6401bp; 6394-6401 bit base is the nucleotide sequence of restriction enzyme NotI, and length is 8bp; 6402-6435 bit base is the partial nucleotide sequence of LoxP, and length is 34bp; 6436-7679 bit base is the nucleotide sequence of UL26, the nucleotide sequence of length to be 1244bp, 7680-7687 bit base be restriction enzyme PacI, and length is 8bp; 7688-9519 bit base is the nucleotide sequence of amp replicon, and length is 1832bp; 9520-9527 bit base is the nucleotide sequence of restriction enzyme PacI, and length is 8bp; The nucleotide sequence of 9528-10694 to be base be UL27, length is 1167bp; 10695-12503 bit base is the nucleotide sequence of red fluorescent gene, and length is 1809bp; 12504-12511 bit base is the nucleotide sequence of restriction enzyme SalI, and length is 8bp; 12512-12545 bit base is the partial nucleotide sequence of LoxP, and length is 34bp.

Sequence table SEQ ID NO:2 is the chicken β-actin promotor of plasmid pCAGGS and the expression cassette of rabbit β-globin ployA and the nucleotide sequence of homology arm, and length is 2380bp.

Sequence table SEQ ID NO:3 is Loxp sequence, and length is 644bp, from the sequence only staying next 34bpLoxp site after 485-518bp is excision BAC skeleton.

Sequence table SEQ ID NO:4 is the sequence only staying next Loxp site after excising BAC skeleton in sequence table SEQ ID NO:3, and sequence length is 34bp.

Sequence table SEQ ID NO:5 is the sequence of pRTHGA1, and sequence length is 4263bp, and oblique line portion is respectively restriction endonuclease sites SmalI and XhoI.Wherein, between restriction enzyme site SmalI and XhoI, insert fowl influenza virus strain A/Duck/Hubei/xn/2007(H5N1) HA sequence (length of nucleotides is 1704bp) can to obtain recombinant plasmid pRTHGA-HA5(nucleotide sequence length be 5961bp); It is 5943bp that the HA sequence (length of nucleotides is 1685bp) inserting fowl influenza virus strain A/Duck/HuBei/W1/2004 (H9N2) between restriction enzyme site SmalI and XhoI can obtain recombinant plasmid pRTHGA-HA5(nucleotide sequence length).

Fig. 1: the structure schema being transfer vector pBlue-UL27-UL26 of the present invention.

Fig. 2: be pcDNA3.1+ plasmid schematic diagram in structure transfer vector pBlue-UL27-UL26 process of the present invention.

Fig. 3: the gene structure composition schematic diagram being transfer vector pBlue-UL27-UL26 of the present invention.

Fig. 4: be carrier pBlue-lox schematic diagram in structure transfer vector pBlue-UL27-UL26 process of the present invention.CMV Promoter in figure is CMV promoter.

Fig. 5: be transfer vector pBlue-UL27-UL26 plasmid schematic diagram of the present invention.

Fig. 6: be that transfer vector pBlue-UL27-UL26 of the present invention recombinates the schematic diagram that duck enteritis virus is bred on the inoblast of chicken.Wherein: Fig. 6 A is that transfer vector pBlue-UL27-UL26 recombinates and duck enteritis virus formed separately on the inoblast of chicken the photo of plaque;

Fig. 6 B is that transfer vector pBlue-UL27-UL26 recombinates on duck enteritis virus, and at the schematic diagram of the fibroblast proliferation of chicken after repeatedly Plaque-purified.

Fig. 7: the genomic constitution schematic diagram being duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE of the present invention is the DNA fragmentation (UL26+UL27+amp by replacing with the full length nucleotide sequence D EV of duck enteritis virus C-KCE in transfer vector pBlue-UL27-UL26 ^r) obtain.

Fig. 8: the schematic diagram being duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE of the present invention, wherein CMV.P is CMV promoter, and RFP is red fluorescent protein gene.

Fig. 9: be the schematic diagram that pRThGA vector modification of the present invention becomes recombinant plasmid pRTHGA1.Wherein: the CMVPromoter in Fig. 9 in the picture left above is CMV promoter; Chicken beta-actin promoter in Fig. 9 in top right plot and lower middle figure is Chicken beta-actin promotor, and CMV.IE enhancer is CMV.IE enhanser.

Figure 10: the schema being construction recombination plasmid pRTHGA-HA5 and pRTHGA-HA9 of the present invention.It is that the ha gene inserting H5 subtype avian influenza virus and H9 subtype avian influenza virus between restriction endonuclease sites SmalI and XhoI of plasmid pRTHGA1 respectively obtains.

Figure 11: the schematic diagram being the recombinant plasmid pRTHGA-HA5 that the present invention builds.Wherein, the Chicken beta-actin promoter in figure is the promotor of Chicken beta-actin, and CMV.IE enhancer is CMV.IE enhanser; Plasmid is with Amp(penbritin) resistance.

Figure 12: the schematic diagram being the recombinant plasmid pRTHGA-HA9 that the present invention builds.

Figure 13: the structure schema being rDEV-HA5 vaccine strain of the present invention and rDEV-HA9 vaccine strain.

Figure 14: be the genomic constitution schematic diagram containing the recombinant plasmid pBAC-C-KCE-HA5 of H5 subtype avian influenza virus ha gene and duck enteritis virus gene that the present invention builds.The red fluorescent protein gene (RFP) of plasmid pBAC-C-KCE is replaced with the ha gene of H5 subtype avian influenza virus and obtains.

Figure 15: be the genomic constitution schematic diagram containing the recombinant plasmid pBAC-C-KCE-HA9 of H9 subtype avian influenza virus ha gene and duck enteritis virus gene that the present invention builds.The red fluorescent protein gene (RFP) of plasmid pBAC-C-KCE is replaced with the ha gene of H9 subtype avian influenza virus and obtains.

Figure 16: be the schematic diagram containing the recombinant plasmid pBAC-C-KCE-HA5 of H5 subtype avian influenza virus ha gene and duck enteritis virus gene that the present invention builds, its nucleotide sequence total length is 169,784bp.

Figure 17: be the schematic diagram containing the recombinant plasmid pBAC-C-KCE-HA9 of H9 subtype avian influenza virus ha gene and duck enteritis virus gene that the present invention builds, its nucleotide sequence total length is 169,766bp.

In upper figure in Figure 18, the monoclonal antibody of rDEV-HA5 recombinant strain and anti-HA reacts and produces obvious band and be positive, and DEV strain is then negative, and proves that rDEV-HA5 recombinant strain successfully constructs.In the middle figure of Figure 18, the monoclonal antibody of rDEV-HA9 recombinant strain and anti-HA reacts and produces obvious band and be positive, and DEV strain is then negative, and proves that rDEV-HA9 recombinant strain successfully constructs.In figure below of Figure 18, the monoclonal antibody of rDEV-HA recombinant strain and DEV strain and internal reference GAPDH all reacts and produces obvious band and be positive, and proves that this experiment is effective.

Figure 19: be the monitoring schematic diagram to the HI antibody titer of highly pathogenic bird flu virus H 5 N 1 (XN) before and after duckling immunity rDEV-HA5 vaccine in the present invention.

Figure 20: be before and after duckling immunity rDEV-HA5 vaccine, schematic diagram is monitored to the ELISA of duck enteritis virus serum antibody in the present invention.

Figure 21: be in the present invention rDEV-HA5 vaccine to the protection ratio schematic diagram of H5 subtype highly pathogenic avian influenza virus.

Figure 22: be in the present invention rDEV-HA5 vaccine to the protection ratio schematic diagram of duck enteritis virus.

Figure 23: be in the present invention before and after duckling immunity rDEV-HA9 vaccine to avian influenza virus H9N2(W1) the monitoring schematic diagram of HI antibody titer.

Figure 24: be before and after duckling immunity rDEV-HA9 vaccine, schematic diagram is monitored to the ELISA of duck enteritis virus serum antibody in the present invention.

Figure 25: be in the present invention rDEV-HA9 vaccine to the protection ratio schematic diagram of H9 subtype avian influenza virus.

Figure 26: be in the present invention rDEV-HA9 vaccine to the protection ratio schematic diagram of duck enteritis virus.

Embodiment

The structure of embodiment 1BAC homology arm and the formation of multiple copied

1, duck viral enteritis (DEV) virus genomic extraction

Frozen this biomaterial of duck enteritis virus vaccine strain C-KCE(is delivered, see document 16(Chen et al.Wei Zou et al.Construction of a full-length infectious bacterial artificial chromosome clone of duck enteritis virus vaccine strain.Virology Journal2013,10:328) its genomic dna sequence is submitted to, sees GenBank ID:KF263690.This strain is that state Key Laboratory of Agricultural Microbiology gathered pathological material of disease in 2010 in duck field, Hubei China province Xianning.

Separation, the preparation method of this strain are as follows: carry out homogenate after pathological material of disease duck field, the duck field pathological material of disease collected from duck field, Xianning, Hubei Province is added the physiological saline of 0.9% and by the supernatant inoculated into chick embryo after centrifugal, collect chick embryo allantoic liquid after blind passage three generations and obtain duck enteritis virus vaccine strain C-KCE) the continuous freeze thawing of sick cell 3 times, 4 DEG C of centrifugal 20min precipitate cell debris of 8000rpm.Collect supernatant, 30% (w/w) sucrose solution is rebasing, 4 DEG C of 16000rpm centrifugal 60min precipitate virus particles.Discard supernatant, add distilled water and virus particle is suspended.Add Proteinase K to final concentration 500 μ g/rnL, sodium lauryl sulphate (SDS) is to final concentration l%.Put 56 DEG C of water-bath l h.The isopyknic V of after product (phenol) will be digested: V (chloroform)=volume ratio be l:l and each extracting of chloroform once, the centrifugal 15min of 16000rpm.Get supernatant liquor to add wherein to have and add isopyknic Virahol and mix gently ,-20 DEG C of precipitate nucleic acids 2h.4 DEG C of centrifugal 20min of 16000rpm precipitate DNA, and 70% cold washing with alcohol once, reclaims nucleic acid precipitation, is resuspended in TER (TE containing RNA enzyme) room temperature effect 10min, fully digests RNA, is used as template and uses after digestion.

2. be the partial genome sequence of duck enteritis virus at UL26 and UL27(UL26 and UL27, GenBank:EU082088.2) BAC carrier is inserted between: (upstream and downstream primer is respectively UL26-F and UL26-R to the restriction enzyme site of UL26 two ends introducing NotI and PacI, the concrete sequence of primer is in table 1), the restriction enzyme site (upstream and downstream primer is respectively UL27-F and UL27-R, and the concrete sequence of primer is in table 1) of Pac I is introduced in UL27 upstream.With the genome of C-KCE for homology arm pcr amplification gets off by template.With pcDNA3.1(as shown in Figure 2, this plasmid is given by Life Science College, Hubei Univ. professor Ma Lixin) be template amplification amp replicon, and the restriction enzyme site (upstream and downstream primer is respectively Amp-F and Amp-R, and the concrete sequence of primer is in table 1) of Pac I is introduced at two ends.With pRTRA plasmid (being given by Life Science College, Hubei Univ. professor Ma Lixin) for template amplification RFP gene, and introduce the restriction enzyme site (upstream and downstream primer is respectively RFP-F and RFP-R, and the concrete sequence of primer is in table 1) of Sal I in downstream.PCR amplification system: Easy-Taq0.25 μ L; 10xbuffer2.5 μ L, dNTP2 μ L, template 2 μ L, upstream and downstream primer (UL26-F and UL26-R, or UL27-F and UL27-R, or Amp-F and Amp-R, or RFP-F and RFP-R) each 1 μ L, ddH ₂o polishing 25 μ L, reacts by following program after mixing: 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, and by each primer annealing temperature, 40s, extends 1min, 30 circulations, and last 72 DEG C extend 10min.

Adopt overlapping PCR method (PCR amplification system: Easy-Taq0.25 μ L; 10xbuffer2.5 μ L, dNTP2 μ L, template 2 μ L, three couples of upstream and downstream primers (UL26-F and UL26-R, UL27-F and UL27-R, RFP-F and RFP-R) each 1 μ L, ddH ₂o polishing 25 μ L, react by following program after mixing: 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 52 DEG C of annealing, 40s, 72 DEG C extend 5min, 30 circulations, and last 72 DEG C extend 10min) three is linked together, then Sal I is cloned into, on the pBlue-lox carrier (as shown in Figure 4, being given by Life Science College, Hubei Univ. professor Ma Lixin) that Not I enzyme is cut, obtain restructuring pBlue plasmid.Amp replicon being cloned into the transfer vector pBlue-UL27-UL26(length obtained with amp replicon in the restructuring pBlue plasmid that PacI enzyme cuts is 12,545bp, builds flow process and sees Fig. 1, and its gene structure composition is shown in Fig. 3, and plasmid figure is shown in Fig. 5).

Table 1PCR and overlapping PCR primers

Be with underscore part to be expressed as Loxp partial sequence in primer, band point type underscore part is the restriction enzyme enzyme sequence in each primer.

The screening of embodiment 2 recombinant virus and purifying

The preparation of 1.CEF cell

Get the SPF chicken embryo (purchased from Beijing Cimmeria Wei Tong laboratory animal Technology Co., Ltd.) of 9-10 age in days, after cotton ball soaked in alcohol sterilization, after taking off iodine with tincture of iodine wiping air chamber portion, aseptic taking-up chicken embryo, is placed in aseptic vial ware, and removes head, four limbs and internal organ eye scissors and shred.(PBS is called for short, formula: Na with the phosphate buffered saline buffer of sterilizing ₂cO ₃1.59g, NaHCO ₃2.93g, uses ddH ₂o is settled to 1000ml, pH is adjusted to be 7.4) wash twice in bacterium bottle, after adding pancreatin 37 DEG C of water-bath digestion 30min of appropriate 0.25%, pancreatin is abandoned in suction, contain foetal calf serum (10%) and the DMEM substratum (purchased from GIBCO company) of twin antibiotic (penicillin 100u/mL, Streptomycin sulphate 100u/mL) by appropriate, blow and beat and make cell dispersal, after six layers of filtered through gauze, with appropriate density (10 ⁷) access cell bottle is for subsequent use.

2. the screening of recombinant virus and purifying

In six orifice plates, DEV virus (duck enteritis virus vaccine strain C-KCE is accessed with 10MOI, source and sequence are with embodiment 1), after two hours, (length is 10705bp for the rBAC homology arm carrier of transfection Pac1 linearization for enzyme restriction, linearizing DNA homology recombination efficiency is higher), within after transfection 6 hours, change opti-MEN(to buy from GIBCO company), collect virus particle after 24 hours.

By the virus particle 10 collected ^-4, 10 ^-5, 10 ^-6receive and cover with on the CEF cell (preparation see CEF cell in case study on implementation 2) of about 90%, 37 DEG C, CO ₂leave standstill after two hours in incubator, the agarose of the low melting point of isopyknic 2% and containing phenol red 2X DMEM(purchased from GIBCO company) mixing, add containing above-mentioned 1% dual anti-serum by the final concentration of 1% respectively, drop to suitable temperature (such as 37 DEG C) and add 2mL agarose in every hole afterwards, after 4 DEG C of standing 10min, place the formation that cell culture incubator waits for plaque for 3 days.

Under the plaque formed is placed fluorescent microscope, find the plaque with red fluorescence.Plaque with red fluorescence is done the purifying of next round, until be the plaque (as shown in Figure 6) of red fluorescence completely.

Recombinant virus electricity is proceeded to intestinal bacteria DH10B-IS by embodiment 3

The competent preparation of 1.DH10B-IS :-80 DEG C of intestinal bacteria (DH10B-IS, Academy for Life Science, Hubei University professor Ma Lixin give) preserved are rule on LB flat board, 37 DEG C of overnight incubation.Single for the intestinal bacteria of activation bacterium colony is accessed LB or adds corresponding microbiotic (paraxin (Cam), 34pg/mL, Streptomycin sulphate (Str) 50pg/mL) LB liquid nutrient medium in, 37 DEG C of 200 ~ 250r/min shake overnight incubation transferase 10 .2 ~ 1mL overnight culture in the triangular flask that 200mL LB is housed.At 37 DEG C, thermal agitation is cultivated 2 ~ 6 hours, and timing detects OD ₆₀₀value.Work as OD ₆₀₀when value reaches 0.7 ~ 1.0, from shaking table, take out Erlenmeyer flask, be placed in mixture of ice and water, ice bath 15min.Collect thalline with the sterile centrifugation tube of precooling, 4 DEG C of centrifugal 10min of 6000r/min, abandon supernatant liquor.With the sterile glycerol solution Eddy diffusion cell of 10% of precooling, centrifugal, careful abandoning supernatant.Repeating step above-mentioned steps once.Be 1mL with 10% glycerine resuspension cell to final volume.Cell is loaded Eppendorf tube by 100 μ L equal portions, for subsequent use in-80 DEG C of refrigerators.

2. intestinal bacteria electricity transforms: its gene of DEV recombinant virus genomes DNA5 μ g(adding cyclisation to be transformed in aseptic 1.5mL centrifuge tube is formed as shown in Figure 7), the electricity adding 20 μ L turns competent cell, softly mixes, ice bath 1 ~ 2min.DNA and competent cell mixture are drawn in the electric revolving cup of the ice-cold sterilizing of 0.1 μm, knock electric revolving cup gently and make mixture evenly enter the bottom of electric revolving cup, ice bath 3-5min.Electricity turns condition and is set as 1500V, 200 Ω, 25 μ F.Blot with the globule of thieving paper by electric revolving cup surrounding, put into electroporation chamber immediately, click pulse key, hear buzzer and see the shock parameters shocked by electricity on rear display screen, SOC substratum (the LB substratum of the lmL of 37 DEG C is added immediately in electric revolving cup, containing 0.2mmol/L glucose, 0.1mmol/L MgSO ₄, 0.1mmol/L MgCl ₂), after re-suspended cell, sucking-off is transferred in the aseptic Eppendorf pipe of 1.5mL, 37 DEG C, 225 revs/min are shaken bacterium recovery 1h, get 20 μ L converted products and add 200 μ LSOC coated plates, every 100 μ L coat on 1 Double LB culture medium flat plate containing paraxin (Cam, 34pg/mL) and Streptomycin sulphate (Str50pg/mL), cultivate 24h for 37 DEG C and check conversion results.

The qualification of the BAC plasmid of embodiment 4 containing DEV virus full-length genome

1. the extraction of the BAC plasmid (pBAC-C-KCE) containing DEV virus full-length genome

To clone with ordinary gel electrophoretic method preliminary evaluation BAC molecular cloning virus, with Qiagen plasmid Midi kit test kit, (in QIAGEN, amount extracts test kit, purchased from Qiagen company) purifying: by the positive colony of preliminary evaluation BAC molecular cloning virus, line on the resistance LB culture medium flat plate containing paraxin (Cam34pg/mL), cultivate 24h for 37 DEG C, picking positive colony, bottle after shaking bacterium 16h again with in bottle shake bacterium 200mL, shake bacterium 16h to 18h, the plasmid of BAC molecular cloning virus is extracted by the method for test kit specification sheets and improvement, with 500mL sterilizing centrifugal bottle, 4 DEG C, 6000 leave heart 15min, abandon supernatant as far as possible, add P1 solution (containing LyseBlue and RNaseA enzyme, purchased from Qiagen company) 10mL, thoroughly mix.Add P2 solution (purchased from Qiagen company) 15mL, mix gently immediately, until evenly blue.Add P3(purchased from Qiagen company) solution 15mL, mix gently immediately, to blue thoroughly disappearance.4 DEG C, 20000 leave heart 30min, and supernatant is crossed pillar, with Wash Buffer(purchased from Qiagen company) wash twice, add 200 μ L TE and elute for subsequent use.

2. the rescue of virus

The plasmid pBAC-C-KCE extracted is used method (specifically see reference document 13) the transfection CEF cell of calcium phosphate, pathology is observed after 3 to 4 days, the plasmid pBAC-C-KCE that can produce pathology is delivered to the order-checking of south, Shanghai genome company, prove that it has complete DEV genome, by BAC-C-KCE plasmid called after duck enteritis virus artificial chromosome plasmid pBAC-C-KCE(correct for checking as shown in Figure 8,), the preservation name of biological material specimens is called intestinal bacteria DH10B-1S ₂/ BAC-C-KCE, Escherichia coli DH10B-1S ₂/ BAC-C-KCE, delivers China on August 20th, 2013. Wuhan. and Wuhan University's China typical culture collection center preservation, deposit number is CCTCC NO:M2013377.

The transformation of embodiment 5pRThGA carrier

Given by Life Science College, Hubei Univ. professor Ma Lixin with plasmid pCAGGS() be template, with pCAGGS-ISce1-H1F(nucleotides sequence row be: AAATAGGGATAACAGGGTAATGTTGAGCCTTTTTGTGGAGTGGGTTAAATTGTACT AGCGCGTTTCGCTTTGCAGTACATCTACGTATTAGTCATCGCTATTA) and pCAGGS-ISce1-H1R(nucleotides sequence be classified as: AAATAGGGATAACAGGGTAATTAGCATGCATAACTTCGTATAATGTATGCTATACG AAGTTATGCGGCCGCCACACAGGAAACAGCTATGACCATGATTAC) for the region of primer amplification CMV.IE enhancer to rabbit beta-globin polyA, homology arm H1 (sequence is GTTGAGCCTTTTTGTGGAGTGGGTTAAATTGTACTAGCGCGTTTCGCTTT) is introduced respectively at two ends, H2(sequence is GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATGCATGCTA) and the restriction enzyme site of I-SceI, obtain product 1.

With pRThGA plasmid, (Life Science College, Hubei Univ. professor Ma Lixin gives, see the picture left above of Fig. 9) be template, with the region that Amp t (ISceI) F and oriT R6K (ISceI) R is primer amplification oriI to I-SceI, the restriction enzyme site of I-SceI is introduced at two ends respectively, obtains product 2.Primer used is as table 2(pCAGGS-ISceI-H1F and pCAGGS-ISceI-H1R).PCR amplification system: Easy-Taq0.25 μ L; 10xbuffer2.5 μ L, dNTP2 μ L, template 2 μ L, upstream and downstream primer (pCAGGS-ISceI-H1F and pCAGGS-ISceI-H1R) each 1 μ L, ddH ₂o polishing 25 μ L, reacts by following program after mixing: 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 52 DEG C of annealing, 40s, and 72 DEG C extend 1min, 30 circulations, and last 72 DEG C extend 10min.

Above product 1 cut with product 2 I-SceI enzyme, reclaims, be connected, transform in (see document 14).Correct its nucleotide sequence of plasmid called after pRTHGA1(of order-checking qualification is shown in SEQ ID NO:5, sees figure below of Fig. 9).

The design of primers of table 2PCR reaction

HA is building up to pRTHGA1(and sees Figure 11 by embodiment 6)

Fowl influenza virus strain A/Duck/Hubei/xn/2007 is extracted in the present embodiment, deliver referred to as this biomaterial of xn/07(, see document 17(document: Wei Zou et al.The antigenic property of the H5N1avian influenza viruses isolated in central China.Virology Joumal2012,9:148, its genomic dna sequence is submitted to, temporary GenBank accession NO:KJ003984 ~ KJ003991.Belong to H5N1 hypotype, to be state Key Laboratory of Agricultural Microbiology in 2007 gather in pathological material of disease to be separated in duck field, Hubei China province Xianning this strain obtains, method is in the duck field pathological material of disease collected, carry out homogenate after adding the physiological saline of 0.9% and by the supernatant inoculated into chick embryo after centrifugal, collect chick embryo allantoic liquid after blind passage three generations and obtain fowl influenza virus strain A/duck/Hubei/xn/2007 (H5N1).

Fowl influenza virus strain A/Duck/HuBei/W1/2004 (H9N2) is extracted in the present embodiment, deliver referred to as this biomaterial of W1/04(, see document 18:(document: Xiao-Juan Xu et al.Evolutionary characterization of influenza virus A/duck/Hubei/W1/2004 (H9N2) isolated from central China.Virus Genes (2008) 36:79 – 83)) its genomic dna sequence submits to, sees GenBank ID:DQ465400.Belong to H9N2 type, this strain is that state Key Laboratory of Agricultural Microbiology gathered pathological material of disease in 2004 in duck field, Hubei China province Xianning, carry out homogenate after adding the physiological saline of 0.9% and by the supernatant inoculated into chick embryo after centrifugal, collect chick embryo allantoic liquid after blind passage three generations and obtain fowl influenza virus strain A/Duck/HuBei/W1/2004 (H9N2).

Conventionally, identified by RT-PCR after extracting the RNA of fowl influenza virus strain xn/07 and W1/04, after qualification is correct, by frozen in-80 DEG C for above-mentioned seed culture of viruses xn/07 and W1/04, the target gene fragment HA of acquisition two strain virus is reacted by RT-PCR, react primer used in table 3, amplification obtains the HA sequence (sequence is see temporary GenBank accession NO:KJ003987 and GenBank ID:DQ465400.1) of two strain virus.Concrete building process is as follows:

The primer of table 3RT-PCR reaction

The synthesis of 1.RNA extraction and cDNA

Fowl influenza virus strain xn/07 and W1/04 allantoic fluid sample being placed in the centrifugal 10min of 12000rpm/min, getting supernatant 200 μ L, add 1mL TRIZOL(reagent) solution (purchased from precious biotechnology Dalian company limited) fully mixes, for subsequent use.Concrete grammar is with reference to the specification sheets of TRIZOL reagent, and concrete steps are as follows:

(1) get processed good sample and be about 1.2mL, add 200 μ L chloroforms, concuss, about 20s under mixing state; Ice bath 10min immediately, the centrifugal 10min of 12000g under 4 DEG C of conditions;

(2) get supernatant, add equal-volume Virahol, mixing, ambient temperatare puts 10min, the centrifugal 10min of 12000g;

(3) thoroughly abandon clean supernatant, add 1mL75% ethanol, mixing, the centrifugal 10min of 7500g under 4 DEG C of conditions;

(4) repeated washing once;

(5) abandon supernatant, dry 5 ~ 10min, not overdrying under room temperature, with 30 μ L without RNase H ₂o dissolves, and puts about 10min; Get above-mentioned RNA product 25 μ L, add following reagent: AMV (50U/ μ L) 1 μ L, RRI (40U/ μ L) 0.5 μ L, 5 × buffer8 μ L, dNTP4 μ L, U12 (10pmol) 1 μ L, ddH ₂o polishing 40 μ L.Reaction conditions is 42 DEG C of 1h, 94 DEG C, 5min.Reaction product is directly used in PCR or-20 DEG C of preservation.

2.PCR amplification and product reclaim

Get above-mentioned RT-PCR product (cDNA) 3 μ L, add following reagent: Easy-Taq0.25 μ L, 10xbuffer2.5 μ L, dNTP2 μ L, upstream and downstream primer (H5SmalI F and H5XhoI R or H9SmalI F and H9XhoI R) each 1 μ L, ddH ₂o polishing 25 μ L, reacts by following program after mixing: 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 52 DEG C of annealing, 40s, extends 1min, 30 circulations, and last 72 DEG C extend 10min.After pcr amplification product and pRTHGA1 carrier use SmaI and XhoI double digestion respectively, by 0.8%-1.5% agarose gel electrophoresis, target fragment is reclaimed through test kit (GenClean pillar sepharose DNA reclaims test kit, purchased from Shanghai Jierui Biology Engineering Co., Ltd).

3. the connection of target fragment HA and carrier pRTHGA1, conversion

Ligation system is 10 μ L, and wherein add 3 μ L and reclaim product HA5 or HA9,1 μ L recovery product pRTHGA1,1 μ L T4DNAligase, 5 μ L 2xRapid ligation Buffer(connection test kits are purchased from Promega company).16 DEG C of water-baths connect spends the night.Product (pRTHGA-HA) will be connected to be transformed in donor bacterium E.coli strainDH10 β and to be seeded to and with the addition of in the LB liquid nutrient medium of 100pg/mL Amp, screening positive clone sequence verification, by plasmid correct for checking, called after pRTHGA-HA5(is as shown in figure 11 respectively) and pRTHGA-HA9(is as shown in figure 12).

Embodiment 7MAGIC mediates HA and to recombinate the upper alternative red fluorescent protein of DEV

Being seeded to by donor bacterium E.coli strainDH10B containing recombinant plasmid pRTHGA-HA5 and pRTHGA-HA9 respectively with the addition of in the LB liquid nutrient medium of 100pg/mL Amp, recipient bacterium E.coli DH10B-IS (containing plasmid pML300+pBAC-C-KCE) is seeded in the LB liquid nutrient medium that with the addition of spectinomycin (50pg/mL) and kantlex (kan) (50pg/mL) and 0.2% (w/v) glucose, 30 DEG C of overnight incubation; Next day collected by centrifugation recipient bacterium, this thalline is washed twice with 2 times of volume LB liquid nutrient mediums, by donor bacterium (containing recombinant plasmid pRTHGA-HA5 or pRTHGA-HA9) and recipient bacterium all by the volume ratio of 1:25, l:50, l:100 or l:200, dilute with the LB liquid nutrient medium that with the addition of 0.2% (w/v) rhamnosyl, then at 30 DEG C, 2h is cultivated, until OD ₆₀₀reach 0.15-0.25; According to OD ₆₀₀value, by the volume ratio mixing of donor bacterium and recipient bacterium 1:1 by volume, 37 DEG C of quiescent culture 2h, then shaking culture 2h; LB solid medium mixture diluted 100 times of coatings having been added Cam (34pg/mL) and 0.2% (W/V) Amp is dull and stereotyped, 42 DEG C of overnight incubation (techniqueflow as shown in figure 13).PCR is identified the plasmid called after pBAC-C-KCE-HA5(of gained restructuring HA is as shown in Figure 14 and Figure 16), PCR is identified the plasmid called after pBAC-C-KCE-HA9(of gained restructuring HA9 is as shown in Figure 15 and Figure 17).

The rescue of embodiment 8 recombinant virus

Respectively the BAC-C-KCE-HA5 plasmid extracted and BAC-C-KCE-HA9 plasmid are used method (specifically see reference document 13) the transfection CEF cell of calcium phosphate, pathology is observed after 3 to 4 days, the BAC-C-KCE-HA5 plasmid and BAC-C-KCE-HA9 plasmid that can produce pathology are delivered to the order-checking of south, Shanghai genome company, prove that it has complete DEV and HA genome, the correct BAC-C-KCE-HA5 plasmid called after of checking is contained the duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE-HA5 of expression of influenza virus H5 hypotype hemagglutinin, we deliver the called after intestinal bacteria DH10B-1S of the biological material specimens of preservation ₂/ BAC-C-KCE-HA, Escherichia coli DH10B-1S ₂/ BAC-C-KCE-HA, delivers to China on August 20th, 2013. Wuhan. and Wuhan University's China typical culture collection center preservation, deposit number is CCTCC NO:M2013378.The correct BAC-C-KCE-HA9 plasmid called after of checking is contained the duck enteritis virus artificial chromosome pBAC-C-KCE-HA9 plasmid of expression of influenza virus H5 hypotype hemagglutinin, we will deliver the biomaterial called after intestinal bacteria DH10B-1S of preservation ₂/ BAC-C-KCE-HA9, Escherichia coli DH10B-1S ₂/ BAC-C-KCE-HA9, delivers to China on December 31st, 2013. Wuhan. and Wuhan University's China typical culture collection center preservation, deposit number is CCTCC NO:M2013740.

The deletion of the BAC skeleton of embodiment 9Cre-Loxp restructuring mediation

See document: JichunWang et al., the method of 2011 reports, by the eukaryotic expression plasmids CEF cell of pCAGGS-NLS/cre, with 1 MOI(multiplicity of infection after 12 hours, multiplicity of infection dosage) inoculate the virus containing pBAC-C-KCE-HA5 or pBAC-C-KCE-HA9 respectively, Plaque-purified after 24 hours, (primers F: TTTATTCAACAGTGGCGAGTTC is identified by the method for PCR, R:TATGCCGGCGTACACCGAGA, 95 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 54 DEG C of annealing 40s, 72 DEG C extend 1min, 30 circulations, last 72 DEG C extend 10min) whether BAC skeleton cut, 3 to 4 take turns after obtain not containing BAC skeleton, only stay the rDEV-HA5 in next 34bpLoxp site (its nucleotide sequence see sequence table SEQ ID NO:3 and 4 shown in) virus or rDEV-HA9 viral.

Embodiment 10 utilizes Western Blot method to detect the expression of HA

The recombinant virus of above-mentioned rDEV-HA5 and rDEV-HA9 purifying and DEV virus are connect collecting cell albumen when CEF cell reaches 50% pathology and carry out SDS-PAGE electrophoresis (working method is see document 14).At the end of SDS-PAGE electrophoresis is incited somebody to action, with distilled water drip washing graphite cake, dry with non-absorbent paper handkerchief.Put on one's gloves, cut 6 3MM filter paper and 1 nitrocellulose filter.The size of filter paper and film is completely equal with the size of gel or be slightly less than gel (otherwise contacting of two filter paper edges can cause short circuit current), nitrocellulose filter is floated on above a dish deionized water, after first borrowing wicking action that film is soaked from the bottom up, film is immersed in water completely, soak 5min and remove bubble residual on filter membrane, make marks filter membrane one jiao with soft pencil.In a pallet, add a small amount of electricity turn damping fluid (take 2.9g glycine, 5.8g Tris alkali, 0.37g SDS, adds 200mL methyl alcohol, and adding water to total amount is 1000mL), 6 filter paper are soaked in wherein.Put on one's gloves installation transfer device, keeps flat bottom electrode (anode), and upward, this electrode places 3 filter paper soaked, and Accurate align, drives bubble out of with glass stick to graphite, and nitrocellulose filter is placed on filter paper, ensures alignment, does not have bubble.Take off gel from electrophoresis chamber, to transfer in deionized water rinsing slightly and once, then accurately lie against on nitrocellulose filter, the gel lower left corner and filter membrane label alignment, wear gloves and get rid of bubble.Last 3 filter paper are placed on above gel, and same guarantee Accurate align does not stay bubble.Be placed in sandwich by the electrode (negative electrode) of top, graphite down, connects power supply, presses 0.65mA ~ 1.0mA/cm according to gel area ²making current, electrotransfer 1.5 ~ 2h.

Western-blot method: transfer printing or after naturally drying end, above-mentioned gained NC film is placed in TBST (Tris-base2.42g, NaCl8.77g, adjust pH to 7.2-7.4, be settled to 1000mL, then add Tween-202Ml) in, rinsing once, put into confining liquid (TBST+1%(w/v) bovine serum albumin again, i.e. BSA) in, 37 DEG C are shaken 1-2h or 4 DEG C gently and spend the night.Then NC film is taken out, primary antibodie (the monoclonal antibody of mouse source HA diluted with TBST, rabbit source gB resists more, the monoclonal antibody of internal reference GAPDH is all purchased from the biological limited liability company in bright Asia, Wuhan) 37 DEG C of reaction 1h, TBST washing 4-6 time, each 5min, add that two anti-(anti-and rabbit two resists mouse two, purchased from the biological limited liability company in bright Asia, Wuhan) 37 DEG C of reaction 1h, TBST washes 4-6 time, each 5min, is placed in the moisture clean filter paper blotting surface and is used for chemoluminescence (ECL, enhanced chemiluminescen) colour developing by film.

ECL develops the color: add ECL by 2mL/ film, and on Kodak2000MM, obtain Western Blot result (see Figure 18).

Embodiment 11 couples of recombiant vaccine rDEV-HA5 are to the Efficacy evaluation of duckling

The preparation of 1.rDEV-HA5 vaccine

RDEV-HA virus of recombinating and DEV virus inoculation CEF cell (the CEF cell preparation see in embodiment 2), when cytopathy reaches more than 80%, aseptic results virus, carries out plaque counting (PFU), reaches 3x10 ⁷namely about PFU can be used as vaccine seed liquid.

The safety testing of 2.rDEV-HA5 vaccine

Buy healthy semi-muscovy ducklings (the Hubei Hong Xiang agricultural development company limited) 45 of 7 ages in days from Pest-or disease-free area, be divided into 3 groups at random when raising 14 age in days, often organize 15 ducklings, be respectively PBS(phosphoric acid salt buffer formula: NaCl:8g, KCl:0.2g, Na ₂hPO ₄12H ₂o:2.9g, KH ₂pO ₄: 0.2g, uses ddH ₂o is settled to 1000mL (pH=7.4)) control group, rDEV-HA5 high dose group, rDEV – HA5 low dose group.A 500 μ L/ PBS, 500 μ L/ high dosage vaccine liquid (100x10 are penetrated respectively through leg intramuscular injection ⁵pFU), a 500 μ L/ Low dose vaccine liquid (10 ⁵pFU); Continuous Observation 14 days, duckling mental status is good, has no adverse reaction, and all healthy survival, proves that it is safe for the present invention relates to vaccine to immune animal.

The immune protective effect of 3.rDEV-HA5 vaccine

Buy the healthy semi-muscovy ducklings 45 of 7 ages in days from Pest-or disease-free area, be divided into 3 groups at random when raising 14 age in days, often organize 15 ducklings, be respectively PBS control group, rDEV-HA5 group, DEV group.Respectively through leg intramuscular injection penetrate PBS500 μ L/ only, rDEV-HA5 vaccine liquid 500 μ L/ only (10 ⁵pFU), DEV vaccine liquid 500 μ L/ only (10 ⁵pFU) carry out immunity, Continuous Observation a couple of days, duckling mental status is good, has no adverse reaction, all healthy survival.Take a blood sample weekly before immunity and after immunity and once collect serum and detect for the antibody horizontal of avian influenza virus H 5 N 1 (XN) and duck enteritis virus.The antibody HI of 3.1 pairs of avian influenza virus H 5 N 1s (XN) detects

Method is with reference to the HI experiment of International Animal Health tissue (OIE), concrete steps are as follows: in 96 hole blood-coagulation-boards, add PBS liquid 30 μ L/ hole, viral allantoic fluid 30 μ L is added again in the first hole, doubling dilution, add 1% chicken red blood cell 30 μ L/ hole, concussion mixing, room temperature places 30min, records HA and tire after non-aggegation blood cell precipitates completely.When HI tests, by viral dilution to 4 HAU, then in 96 hole blood-coagulation-boards, add PBS liquid 30 μ L/ hole, serum 30 μ L to be checked is added again in the first hole, doubling dilution, adds 4 HA unit viral dilution liquid 30 μ L/ holes, concussion mixing, room temperature leaves standstill 30min, add people 1% chicken red blood cell 30 μ L/ hole, concussion mixing, room temperature leaves standstill 30min, after non-aggegation blood cell precipitates completely, record HI tire, the results are shown in Figure 19.Antibody surveillance shows, and immunity two weeks rear highly pathogenic bird flu virus H 5 N 1 (XN) antibody horizontals raise gradually and stablize, and after 9 weeks, antibody horizontal declines.

The antibody horizontal of 3.2 duck enteritis viruses detects (indirect ELISA method)

3.2.1 the preparation of reagent:

Coating buffer (25mmol/L carbonate buffer solution): Na ₂cO ₃: 1.59g, NaHCO ₃: 2.93g, uses ddH ₂o is settled to 1000mL (pH9.6).

10 times of washingss: NaCl:80g, KCl:2g, Na ₂hPO ₄12H ₂o:29g, KH ₂pO ₄: 2g, Tween-20:5mL, use ddH ₂o is settled to 1000mL (pH=7.4).

Confining liquid: 5g skimming milk is dissolved in 100mL washings.

Substrate solution: be divided into substrate A liquid and substrate B liquid.Specifically composed as follows:

Substrate A liquid: the H of 0.006% concentration ₂o ₂damping fluid.

Substrate B liquid: get Na ₂hPO ₄12H ₂o:14.2g, citric acid: 10.5g, uses ddH ₂o is settled to 500mL and is made into 0.1mL phosphate citrate buffer (pH=5.0), then by final concentration be 20mg/L add benzidine (TMB) (during use by A liquid and B liquid equal-volume mixing, mix in latter 5 minutes and use, now with the current).

Stop buffer (final concentration 0.025% hydrofluoric acid solution): getting concentration is 40% hydrofluoric acid solution 625 μ L, is settled to 100mL with ddH2O.3.2.2 indirect ELISA operation steps

(1) preparation of envelope antigen: by DEV virus inoculation CEF cell, when cytopathy reaches more than 80%, aseptic results virus, after multigelation 3 times, gets vial supernatant in 4 DEG C of centrifugal 60min of 10000r/min, collects supernatant liquor; The sucrose solution of 300g/L is rebasing, 4 DEG C of centrifugal 60min of 30000r/min, precipitates and suspends with appropriate PBS damping fluid.

(2) bag quilt: wrapping by concentration (50 μ g/mL) coated elisa plate with purifying envelope antigen the best is 100 μ L/ holes, hatches rearmounted 4 DEG C of 1h for 37 DEG C and spends the night.

(3) wash plate: abandon coating buffer, PBST washings, 200 μ L/ holes, wash 3 times, each 3min.(4) close: pat dry enzyme plate, add confining liquid, 200 μ L/ holes, hatch 2h for 37 DEG C, close nonspecific binding site.

(5) plate is washed: abandon confining liquid, same to step (4).

(6) add serum to be checked: pat dry enzyme plate, add serum to be checked, 100 μ L/ holes, if negative control, hatch 30min for 37 DEG C.

(7) plate is washed: abandon measuring samples liquid, same to step (4).

(8) add enzyme labelled antibody: the ELIAS secondary antibody (purchased from American KPL company) adding HRP mark after patting dry enzyme plate, volume ratio is 1: 1000 times of dilution, 100 μ L/ holes, places 30min for 37 DEG C.

(9) plate is washed: abandon enzyme labelled antibody, same to step (3).

(10) develop the color: every hole adds the substrate A liquid, each 50 μ L of substrate B liquid that newly join, room temperature lucifuge colour developing 10min.

(11) termination reaction: every hole adds 50 μ L stop buffer termination reactions;

(12) OD630 value is measured: OD value when microplate reader mensuration wavelength is 630nm.If OD630 value >=0.3, is judged to be the positive, OD630 value < 0.3, is judged to be feminine gender.

3.2.3 duck enteritis virus Serum Antibody Detection result

The duckling that 14 age in days head exempt from, immunity two weeks rear antibody raises gradually and keeps stable, still has antibody to there is (as shown in figure 20) after monitoring 12 weeks.4 vaccine immunity protections are evaluated

The evaluation of vaccine immunity protection is carried out to the duckling of immunity after 3 days.Often organize random picking 5 ducklings leg flesh inoculation 100LD respectively ₅₀the protest test carrying out Highly Pathogenic Avian Influenza Virus (HPAIV) (A/duck/Hubei/XN/2007 (H5N1)) and duck enteritis virus of dosage.Often organize duckling respectively leg intramuscular injection penetrate 100LD ₅₀the XN poison of dosage and duck enteritis virus DEV.Result shows, and the duckling of immune rDEV-HA5r has the protection ratio of 80% to XN poison, and the duckling of immune DEV has the protection ratio of 50% to XN poison, and PBS control group is after one week whole dead (as shown in figure 21); The duckling of immunity rDEV-HA5 and DEV has the protection ratio of 100% to DEV poison, and PBS control group attacks poison after one week whole dead (as shown in figure 22).Result shows, rDEV-HA5 vaccine can produce available protecting to Highly Pathogenic Avian Influenza Virus (HPAIV) H5 hypotype and duck enteritis virus.

Embodiment 12 recombiant vaccine rDEV-HA9 is to the Efficacy evaluation of duckling

The preparation of 1.rDEV-HA9 vaccine

To recombinate rDEV-HA9 virus and DEV virus inoculation CEF cell, when cytopathy reaches more than 80%, aseptic results virus, carries out plaque counting (PFU), reaches 3x10 ⁷namely about PFU can be used as vaccine seed liquid.

The safety testing of 2.rDEV-HA9 vaccine

Buy the healthy semi-muscovy ducklings 45 of 7 ages in days from Pest-or disease-free area, be divided into 3 groups at random when raising 14 age in days, often organize 15 ducklings, be respectively PBS control group, rDEV-HA9 high dose group, rDEV – HA9 low dose group.A 500 μ L/ PBS, 500 μ L/ high dosage vaccine liquid (100x10 are penetrated respectively through leg intramuscular injection ⁵pFU), a 500 μ L/ Low dose vaccine liquid (10 ⁵pFU); Continuous Observation 14 days, duckling mental status is good, has no adverse reaction, and all healthy survival, proves that it is safe for the present invention relates to vaccine to immune animal.

The immune protective effect of 3.rDEV-HA9 vaccine

Buy the healthy semi-muscovy ducklings 45 of 7 ages in days from Pest-or disease-free area, be divided into 3 groups at random when raising 14 age in days, often organize 15 ducklings, be respectively PBS control group, rDEV-HA9 group, DEV group.Respectively through leg intramuscular injection penetrate PBS500 μ L/ only, rDEV-HA9 vaccine liquid 500 μ L/ only (10 ⁵pFU), DEV vaccine liquid 500 μ L/ only (10 ⁵pFU) carry out immunity, Continuous Observation a couple of days, duckling mental status is good, has no adverse reaction, all healthy survival.Immunity before and immunity after take a blood sample weekly once collect serum for avian influenza virus H9N2(W1) and duck enteritis virus antibody horizontal detect.3.1 to avian influenza virus H9N2(W1) antibody HI detect

Method detailed and step are shown in embodiment 11 3.1, the results are shown in Figure 23.Antibody surveillance shows, and immunity is avian influenza virus H9N2(W1 after one week) antibody horizontal raises gradually and stablizes, monitor 12 weeks afterwards antibody still exist.

3.2 duck enteritis virus antibody level of serums detect (indirect ELISA method).

Method detailed and step are shown in embodiment 11 3.2, the results are shown in Figure 24.The duckling of 14 age in days immunity, immunity one week rear antibody raises gradually and keeps stable, still has antibody to exist after monitoring 12 weeks.

4 vaccine immunity protections are evaluated

The evaluation of vaccine immunity protection is carried out to the duckling of immunity after 3 days.Often organize random picking 5 ducklings leg flesh inoculation 100LD respectively ₅₀the protest test carrying out avian influenza virus (A/duck/Hubei/W1/2004 (H9N2)) and duck enteritis virus of dosage.Often organize duckling respectively leg intramuscular injection penetrate 100LD ₅₀the W1 poison of dosage and duck enteritis virus DEV.Result shows, and the duckling of immune rDEV-HA9 has the protection ratio of 100% to W1 poison, and the duckling of immune DEV has the protection ratio of 60% to W1 poison, and PBS control group, whole morbidity or dead (as shown in figure 25) after one week; The duckling of immunity rDEV-HA9 and DEV has the protection ratio of 100% to DEV virus, and PBS control group attacks poison after one week whole dead (as shown in figure 26).Result shows, rDEV-HA9 vaccine can produce available protecting to H9 subtype avian influenza virus and duck enteritis virus.

Other unspecified part is prior art in this manual, and those skilled in the art can understand the present invention in detail by this specification sheets, sequence table and Figure of description and by the prior art that the present invention points out, and can implement the present invention.

Although above-described embodiment is to invention has been detailed description; but it is only the present invention's part embodiment; instead of whole embodiment, people can also obtain other embodiments according to the present embodiment under without creative prerequisite, and these embodiments all belong to scope.

Reference:

1.Li?Y,Huang?B,Ma?X,Wu?J,Li?F,Ai?W,Song?M,Yang?H.Molecular?characterization?of?the?genome?of?duck?enteritis?virus[J].Virology,2009,391(2):151-161.

2.Domi?A,Moss?B.Engineering?of?a?vaccinia?virus?bacterial?artificial?chromosome?in?Escherichia?coli?by?bacteriophage?lambda-based?recombination[J].Nat?Methods,2005,2(2):95-97.

3.Adler?H,Messerle?M,Wagner?M,Koszinowski?U?H.Cloning?and?mutagenesis?of?the?murine?gammaherpesvirus?68?genome?as?an?infectious?bacterial?artificial?chromosome[J].J?Virol,2000,74(15):6964-6974.

4.Smith?B?N,Banfield?B?W,Smeraski?C?A,Wilcox?C?L,Dudek?F?E,Enquist?L?W,Pickard?G?E.Pseudorabies?virus?expressing?enhanced?green?fluorescent?protein:A?tool?for?in?vitro?electrophysiological?analysis?of?transsynaptically?labeled?neurons?in?identified?central?nervous?system?circuits[J].Proc?Natl?Acad?Sci?U?S?A,2000,97(16):9264-9269.

5.Smith?G?A,Enquist?L?W.A?self-recombining?bacterial?artificial?chromosome?and?its?application?for?analysis?of?herpesvirus?pathogenesis[J].Proc?Natl?Acad?Sci?U?S?A,2000,97(9):4873-4878.

6.Muyrers?J?P,Zhang?Y,Benes?V,Testa?G,Ansorge?W,Stewart?A?F.Point?mutation?of?bacterial?artificial?chromosomes?by?ET?recombination[J].EMBO?Rep,2000a,1(3):239-243.

7.Muyrers?J?P,Zhang?Y,Buchholz?F,Stewart?A?F.RecE/RecT?and?Redalpha/Redbeta?initiate?double-stranded?break?repair?by?specifically?interacting?with?their?respective?partners[J].Genes?Dev,2000b,14(15):1971-1982.

8.Jamsai?D,Orford?M,Nefedov?M,Fucharoen?S,Williamson?R,Ioannou?P?A.Targeted?modification?of?a?human?beta-globin?locus?BAC?clone?using?GET?Recombination?and?an?I-Scei?counterselection?cassette[J].Genomics,2003,82(1):68-77.

9.Suzuki?Y,Kagawa?N,Fujino?T,Sumiya?T,Andoh?T,Ishikawa?K,Kimura?R,Kemmochi?K,Ohta?T,Tanaka?S.A?novel?high-throughput(HTP)cloning?strategy?for?site-directed?designed?chimeragenesis?and?mutation?using?the?Gateway?cloning?system[J].Nucleic?Acids?Res,2005,33(12):e109.

10.Cherepanov?P?P,Wackernagel?W.Gene?disruption?in?Escherichia?coli:TcR?and?KmR?cassettes?with?the?option?of?Flp-catalyzed?excision?of?the?antibiotic-resistance?determinant[J].Gene,1995,158(1):9-14.

11.Li?M?Z,Elledge?S?J.MAGIC,an?in?vivo?genetic?method?for?the?rapid?construction?of?recombinant?DNA?molecules[J].Nat?Genet,2005,37(3):311-319.

12.Chowdhury,S.I.,and?W.Batterson.1994.Transinhibition?of?herpes?simplex?virus?replication?by?an?inducible?cell-resident?gene?encoding?a?dysfunctional?VP19c?capsid?protein.Virus?Res.33:67–87.

13.JichunWang,Nikolaus?Osterrieder.2011.Generation?of?an?infectious?clone?of?duck?enteritis?virus(DEV)and?of?a?vectored?DEV?expressing?hemagglutinin?of?H5N1?avian?in□uenza?virus.Virus?Res.159(1):23-31.

14. Pehanorm Brooker J, not Ritchie EF, Manny A Disi T. molecular cloning texts guide. Jin Dongyan, Li Mengfeng, Hou Yunde etc. the second edition. Beijing: Science Press, 2002

15. high gorgeous profits wait .SDS-PAGE electrophoretic technique analyzing proteins Quality Research [J]. Liaoning chemical industry .2007 (07)

16.Chen?et?al.Wei?Zou?et?al.Construction?of?a?full-length?infectious?bacterial?artificial?chromosome?clone?of?duck?enteritis?virus?vaccine?strain.Virology?Journal2013,10:328

17.Wei?Zou?et?al.The?antigenic?property?of?the?H5N1avian?influenza?viruses?isolated?in?central?China.Virology?Joumal2012,9:148

18.Xiao-Juan?Xu?et?al.Evolutionary?characterization?of?influenza?virus?A/duck/Hubei/W1/2004(H9N2)isolated?from?central?China.Virus?Genes(2008)36:79–83

Claims

1. the recombinant plasmid DH10B-1S of a duck enteritis virus artificial chromosome ₂/ BAC-C-KCE-HA9, is characterized in that: the fragment inserting H9N2 subtype avian influenza virus ha gene in duck enteritis virus artificial chromosome plasmid pBAC-C-KCE, obtains the plasmid DH10B-1S recombinated ₂/ BAC-C-KCE-HA9; The gene structure composition of described plasmid pBAC-C-KCE as shown in Figure 7; The gene structure composition of described plasmid pBAC-C-KCE-HA9 as shown in figure 15.

2. one kind comprises the intestinal bacteria DH10B-1S of the recombinant plasmid pBAC-C-KCE-HA9 of H9N2 subtype avian influenza virus and duck enteritis virus artificial chromosome ₂/ BAC-C-KCE-HA9, is deposited in China typical culture collection center, and deposit number is CCTCC NO:M2013740.

3. the preparation method of recombinant plasmid DH10B-1S2/BAC-C-KCE-HA9 according to claim 1, is characterized in that this plasmid prepares as follows:

(1) by accession number be the full-length genome of duck enteritis virus C-KCE of GenBank ID:KF263690, be inserted on BAC plasmid by the method for homologous recombination and obtain a kind of duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE, the intestinal bacteria DH10B-1S containing this plasmid ₂/ BAC-C-KCE is deposited in China typical culture collection center, and its deposit number is CCTCC NO:M2013377;

(2) transform plasmid pRThGA as pRTHGA1, on pRTHGA1 plasmid, namely insert H9N2 subtype avian influenza virus ha gene, its accession number is GenBank ID:DQ465400.1, obtains recombinant plasmid pRTHGA-HA9, and its gene structure composition as shown in figure 15;

(3) method of MAGIC is used to be inserted by the avian influenza virus ha gene in plasmid pRTHGA-HA9 respectively in duck enteritis virus bacterial artificial chromosome plasmid pBAC-C-KCE, obtain the recombinant plasmid pBAC-C-KCE-HA9 containing avian influenza virus ha gene and duck enteritis virus gene, its structure as shown in figure 17; Intestinal bacteria DH10B-1S2/BAC-C-KCE-HA9 containing this recombinant plasmid pBAC-C-KCE-HA9 is deposited in China typical culture collection center, and its deposit number is CCTCCNO:M2013740.

4. the application of plasmid according to claim 1 in preparation H9N2 subtype avian influenza virus and duck enteritis virus live vector vaccine.