CN105755164B - Identify bivalent anti-herbicide gene cotton GGK2 molecular labeling and application - Google Patents
Identify bivalent anti-herbicide gene cotton GGK2 molecular labeling and application Download PDFInfo
- Publication number
- CN105755164B CN105755164B CN201610329846.9A CN201610329846A CN105755164B CN 105755164 B CN105755164 B CN 105755164B CN 201610329846 A CN201610329846 A CN 201610329846A CN 105755164 B CN105755164 B CN 105755164B
- Authority
- CN
- China
- Prior art keywords
- seq
- cotton
- ggk2
- molecular labeling
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention belongs to transgenic plant detection fields, 2 special molecular labelings for identifying bivalent anti-herbicide gene cotton line GGK2 and its Derivative line are specifically disclosed, the nucleotide sequence shown in SEQ ID NO:1 and SEQ ID NO:2 forms the molecular labeling respectively.The invention also discloses the specific primers marked for amplifier molecule, and the purposes of molecular labeling of the present invention and specific primer.The present invention provides accurate, reliable molecular labeling and specific primer for the Testing and appraisal of bivalent anti-herbicide gene cotton line GGK2 or its derived material, provides guarantee for Transgene-safty；Secondly, detection method is simple, detection speed is fast, it is suitable for that the homozygosis of bivalent anti-herbicide gene/heterozygote breeding material is identified and screened on a large scale in filial generation in genetically modified crops genetic breeding, helps to shorten breeding process, reduce breeding cost.
Description
Technical field
The invention belongs to genetically modified plants to identify field, and in particular to point of identification bivalent anti-herbicide gene cotton GGK2
The purposes of son label and the molecular labeling.
Background technique
Weeds seriously threaten the yield and quality of cotton on the one hand it and cotton contention light, water and nutrient, on the other hand
As host is asked in diseases and pests of agronomic crop, pest and disease damage is propagated.Artificial weeding cost is 3000 yuan/public affairs in Cotton in China cultivation
Hectare, by making cotton variety obtain herbicide resistance anti-herbicide gene importing cotton, recycling herbicide carries out weeding,
So that China cotton grower is reduced investment hundred million yuan or more every year, and to improve output of cotton and quality, reduce Cotton Production at
Originally, increase cotton grower's income to be of great significance.
Glyphosate (English name: Glyphosate；Chemical formula: C3H8NO5P；Chemical name: N- (phosphonomethyl) glycine；
Trade name: agriculture reaches (Roundup) glyphosate, the dry phosphine of grass, phosphine sweet acid etc.) it is the one of Monsanto Chemicals (Monsanto) exploitation
Kind of wide spectrum goes out natural disposition, inner-adsorption conduction-type herbicide, and toxic mechanism is mainly that the EPSPS in Reverse transcriptase shikimic acid pathway is closed
Enzyme causes shikimic acid pathway to interrupt, aromatic amino acid biosynthesis block, to upset the normal nitrogen metabolism of organism, finally leads
Cause organisms die.Glyphosate has many advantages, such as that structure is simple, production cost is low, herbicidal effect is good, less toxic noresidue, is current
The most wide herbicide kind of usable floor area in the world.But as a kind of nonselective herbicide, it, which equally has crops, goes out
Natural disposition effect, which greatly limits the application range of glyphosate in agricultural production.To use glyphosate, palpus in agricultural production
Cultivate the crops with glyphosate resistance or property of degrading.
Antiglyphosate gene is the gene for the antagonism herbicide glyphosate being naturally present in certain particular species, the gene
Resistance glyphosate enzyme 5- enolpyrul-shikimate acid -3- phosphate synthase is encoded, so that glyphosate be made to lose to mushroom or plant
Toxic action.Using means such as genetic engineerings, make resistance glyphosate is cultivated in the Epsps gene transferred plant body of resistance glyphosate
Object has very important production meaning for crop control weeds.Since the glyphosate class of Monsanto Chemicals in 1976
Since herbicide --- agriculture is succeeded in developing and is used widely up to (Roundup), crop resistance glyphosate transgenic research becomes
The hot spot of Advances of Genetic Engineering for Herbicide Resistance in Plant research.Enter environment currently, China has multiple antiweed transgene cotton strains and release
It puts and the pilot production stage.
Identification detection to genetically modified crops is the basis effectively supervised to genetically modified crops.To genetically modified crops at
The detection method divided mainly has the gene specific detection method for external source target gene and controlling element detection, for something lost
Pass the carrier specificity detection method that the feature of conversion carrier is established, the transgenosis established for exogenous DNA insetion sequence feature
The three classes such as crop lines method for detecting specificity.Wherein the flanking sequence of exogenous DNA Insert Fragment is to turn base in genetically modified crops
Because (.Plant such as De Buck S are J.2009 for the most important molecular marker of crop；60.Doi:10.1111/j.1365-
313X.2009.03942.x).Due to each genetically modified crops strain, integration site tool of the foreign gene in acceptor gene group
There is randomness, i.e., identical carrier repeatedly converts, and the position of integration has the specificity and nonrepeatability of height, therefore, benefit
The flanking sequence for the chromosomal foci being inserted into exogenous DNA specifically identifies that transformed variety (strain) is current identification transgenosis
Crop is most reliable, most special detection method, and the method can the accurate same transformant of Testing and appraisal and its derivative strain (Hensel
The .BMC Plant Biology.12 such as G (1): 1-11.doi:10.1186/1471-2229-12-171).Patent " is based on external source
Lucky raw round-grained rice 2 methods of gene flanking sequences identification transgenic paddy rice " (application No. is: 201510381819.1) disclose utilization
The method that foreign gene flanking sequence identifies the transgenic line.
Currently, the transgene cotton mainly with monovalent Antiglyphosate gene applied in Cotton Production, to grass
Sweet phosphine resistance is relatively poor, and patent application " a kind of the expression vector containing Glyphosate resistance gene and its application " (application number
Are as follows: 2014102047036) a kind of transgene cotton of bivalent Antiglyphosate gene containing GR79 and GAT is disclosed, is obtained
Stronger glyphosate resistance has huge application value.
Summary of the invention
The present inventor using agrobacterium-mediated transformation by patent application " a kind of expression vector containing Glyphosate resistance gene and
It is applied " (application No. is: bivalent anti-herbicide gene GR79 and GAT described in 2014102047036) import cotton line
R18 screens a single insertion D10 chromosome 20274741~20274752 from numerous bivalent antiweed transgenic events
The transgenic event in site, it is final cultivate to obtain resist glyphosate herbicidal concentration highest to can achieve 8 times of production applications dense
The strain of degree, with important application value, which is named as GGK2 by inventor.Piece is inserted into external source in GGK2 strain
Specific primer and specific probe are designed based on section and its flanking sequence, for identifying GGK2 strain or its Derivative line, from
And form the present invention.
It is an object of that present invention to provide the molecular labelings of identification bivalent anti-herbicide gene cotton.
Another object of the present invention is to provide the PCR primer for expanding above-mentioned molecular labeling.
Third of the present invention is designed to provide purposes of the above-mentioned molecular labeling on identification bivalent anti-herbicide gene cotton.
The present invention the 4th is designed to provide purposes of the above-mentioned primer on identification bivalent anti-herbicide gene cotton.
The present invention the 5th is designed to provide the method using above-mentioned molecular markers for identification bivalent anti-herbicide gene cotton.
The present invention the 6th is designed to provide the method for cultivating bivalent anti-herbicide gene cotton using above-mentioned molecular labeling.
To achieve the above object, the present invention adopts the following technical scheme:
The present invention identifies the molecular labeling of bivalent anti-herbicide gene cotton, and the molecular labeling is by 1 He of molecular labeling
Molecular labeling 2 forms；Wherein the nucleotide sequence shown in SEQ ID NO:1 of molecular labeling 1 forms；The molecule
The nucleotide sequence shown in SEQ ID NO:2 of label 2 forms.
Above-mentioned molecular labeling, wherein 1 size of molecular labeling is 955bp.
Above-mentioned molecular labeling, wherein 2 size of molecular labeling is 1143bp.
Above-mentioned molecular labeling, wherein the PCR primer for amplifier molecule label 1 is to by SEQ ID No:3 and SEQ ID
The composition of nucleotide sequence shown in No:4；PCR primer for amplifier molecule label 2 is to by SEQ ID No:5 and SEQ ID
The composition of nucleotide sequence shown in No:6；Specific primer sequence is as follows:
Forward primer GR_F:5'CTACATTAAGGGTATATAGAAGTG3'(SEQ ID No:3),
Reverse primer NPT_R:5'GTTGTGCCCAGTCATAGCCGAATAG3'(SEQ ID No:4)；
Forward primer GAT_F:5'TTCACTCATTAAACACGCCGAAGAGATC3'(SEQ ID No:5),
Reverse primer GL_R:5'TTAGAGTCGAATACGGGGTTTTAC 3'(SEQ ID No:6).
Above-mentioned molecular labeling, wherein the bivalent anti-herbicide gene cotton refers to GGK2 or anti-containing identical bivalent
The derived material of the GGK2 of herbicide resistance gene, or the cenospecies assembled by them as parent.
The bivalent anti-herbicide gene refers to GR79 and GAT.
The herbicide refers to glyphosate.
For expanding the PCR primer of above-mentioned molecular labeling, the PCR primer is made of 2 primer pairs；Wherein 1 is drawn
Object forms the nucleotide sequence shown in SEQ ID No:3 and SEQ ID No:4；Another primer pair is by SEQ ID No:5
It is formed with nucleotide sequence shown in SEQ ID No:6.
Application of the above-mentioned molecular labeling on identification bivalent anti-herbicide gene cotton.
Bivalent anti-herbicide gene cotton described in above-mentioned application refers to GGK2 or contains identical bivalent antiweed base
The derived material of the GGK2 of cause, or the cenospecies assembled by them as parent.
Molecular labeling described in above-mentioned application is made of molecular labeling 1 and molecular labeling 2.
Molecular labeling described in above-mentioned application, wherein the PCR primer for amplifier molecule label is by 2 primer pair groups
At；Wherein for amplifier molecule label 1 primer pair as PCR primer to the core as shown in SEQ ID No:3 and SEQ ID No:4
Nucleotide sequence composition；Primer pair for amplifier molecule label 2 is by PCR primer to by SEQ ID No:5 and SEQ ID No:6 institute
The nucleotide sequence composition shown.
Application of the above-mentioned primer on identification bivalent anti-herbicide gene cotton.
The primer is made of 2 primer pairs, wherein 1 primer pair is as shown in SEQ ID No:3 and SEQ ID No:4
Nucleotide sequence composition；Another primer pair is as PCR primer to the nucleosides as shown in SEQ ID No:5 and SEQ ID No:6
Acid sequence composition.
Bivalent anti-herbicide gene cotton described in above-mentioned application refers to GGK2 or contains identical bivalent antiweed base
The derived material of the GGK2 of cause, or the cenospecies assembled by them as parent.
The present invention also provides the methods using above-mentioned molecular markers for identification bivalent anti-herbicide gene cotton, including extract
Cotton genomic dna to be measured, then using cotton genomic dna to be measured as template, respectively with SEQ ID No:3 and SEQ ID No:
Nucleotides sequence shown in 4 is classified as primer and carries out PCR amplification；Simultaneously using cotton genomic dna to be measured as template, with SEQ ID No:
Nucleotides sequence shown in 5 and SEQ ID No:6 is classified as primer and carries out PCR amplification；Electrophoresis, selection have molecular labeling 1 and molecule
The cotton of label 2, as bivalent anti-herbicide gene cotton.
The nucleotide sequence shown in SEQ ID NO:1 of molecular labeling 1 described in the above method forms, the molecule
The nucleotide sequence shown in SEQ ID NO:2 of label 2 forms.
The reaction condition of PCR described in the above method are as follows: 94 DEG C of 5min；94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min, 35
A circulation；72℃10min.
The reaction system of PCR described in the above method are as follows: (DNA concentration is 100ng/ μ to 1 μ L of genomic DNA (template)
L),1 μ L, PCR buffer of Taq archaeal dna polymerase 2 μ L, dNTP mix (2.5mM) 2 μ L, forward primer (10 μM)
1 μ L, 1 μ L of reverse primer (10 μM) supplement overall reaction system to 20 μ L using ddH2O.
Bivalent anti-herbicide gene cotton described in the above method refers to GGK2 or contains identical bivalent antiweed base
The derived material of the GGK2 of cause, or the cenospecies assembled by them as parent.
The method for cultivating bivalent anti-herbicide gene cotton using above-mentioned molecular labeling resists with GGK2 or containing identical bivalent
The derived material of the GGK2 of herbicide resistance gene is one of parent hybridization；Filial generation is planted, extracts blade genome in seedling stage
DNA is to draw with the column of nucleotides sequence shown in SEQ ID No:3 and SEQ ID No:4 then using leaves genomic DNA as template
Object carries out PCR amplification；Simultaneously using leaves genomic DNA as template, with nucleosides shown in SEQ ID No:5 and SEQ ID No:6
Acid sequence is that primer carries out PCR amplification；Electrophoresis, selects the cotton with molecular labeling 1 and molecular labeling 2, and entrance is follow-on
Option program eliminates the cotton without molecular labeling 1 and molecular labeling 2；It is selected by 4-6 generation, selects that new bivalent is anti-to be removed
The cotton variety of careless agent gene.
The bivalent anti-herbicide gene cotton refers to the GGK2's or GGK2 containing identical bivalent anti-herbicide gene
Derived material, or the cenospecies assembled by them as parent.
The herbicide refers to glyphosate.
The bivalent anti-herbicide gene refers to GR79 and GAT.
Bivalent anti-herbicide gene cotton line GGK2 of the present invention is Biological Technology institute, Chinese Academy of Agricultural Sciences, is utilized
By bivalent anti-herbicide gene GR79 and GAT importing cotton line R18, (R18 is from 312 (Coker of Ke's word to agrobacterium-mediated transformation
312) cotton variety breeding obtains), the single insertion point of one obtained is screened from numerous bivalent antiweed transgenic events
Transgenic event, final cultivate obtain high antiweed New cotton line, be named as GGK2.It resists glyphosate herbicidal
Concentration highest can achieve 8 times of production application concentration, have important application value.
The building process of GGK2 is according to patent application " a kind of the expression vector containing Glyphosate resistance gene and its application "
(application No. is: the method building 2014102047036) announced.It is composed in series in the strain by GR79 and GAT expression casette
T-DNA (see Fig. 1), be integrated on cotton chromosome in the form of single insertion point.T-DNA Insert Fragment is marked by NPT II
Gene, GR79 and GAT anti-herbicide gene expression cassette are composed in series, and there is single insertion position on GGK2 cotton chromosome
Point, site are 20274741~20274752 position of D10 chromosome, and insertion point flanking sequence is SEQ ID NO:7 and SEQ
ID NO:8。
The end T-DNA 5' (RB) flanking sequence obtained using Tail-PCR method analyzes upland cotton gene by Blast
Group database, as a result, it has been found that the T-DNA insertion upland cotton D10 chromosome that NPT II, GR79 and GAT expression cassette are composed in series
20274741~20274752 positions, while the end T-DNA 3' (LB) flank is obtained with reference to DNA sequence dna.According to the end 3' obtained
Reference sequences design PCR primer, and carry out cloning and sequencing to the PCR product of GGK2, are finally obtained the complete end side 3' wing sequence
Column.The present invention according to the end T-DNA 5' (RB) end and the end 3' (LB) end side wing DNA sequence dna design special primer, by with T-
The special primer of the end DNA5' end and the end 3' NPT II, GAT foreign gene are combined, and are established a set of for Testing and appraisal bivalent
The method of anti-herbicide gene New cotton line GGK2.
The present invention is according to foreign gene NPT II, GR79, GAT expressing in series frame in bivalent anti-herbicide gene cotton GGK2
Insert Fragment and its flanking sequence SEQ ID NO:7 and SEQ ID NO:8 establish identification GGK2 cotton on upland cotton D10 chromosome
The specific primer and molecular labeling of flower strain and its derived material and kind, and PCR amplification is carried out using specific primer
Identification method.
The flanking sequence is the end side T-DNA RB wing cotton gene group sequence, and sequence is as shown in SEQ ID NO:7.
The RB rectifies to special primer according to 1-710bp sequence design in flanking sequence SEQ ID NO:7, and primer is located at the end RB and inserts
At the 515bp of angle of striking upstream, forward primer GR_F:5'CTACATTAAGGGTATATAGAAGTG3'(SEQ ID No:3)；It is described
The reversed special primer in the end RB designed according to II gene order of NPT, primer is located at the 440bp of the end RB insertion point downstream, reversely
Primer NPT_R:5'GTTGTGCCCAGTCATAGCCGAATAG3'(SEQ ID No:4).
The flanking sequence is the end side T-DNA LB wing cotton gene group sequence, and sequence is as shown in SEQ ID NO:8.
The LB rectifies to special primer to be designed according to GAT gene order, and primer is located at the 788bp of the end LB insertion point upstream, just
To primer GAT_F:5'TTCACTCATTAAACACGCCGAAGAGATC3'(SEQ ID No:5), the end LB is reversely special
Primer is located at the 356bp of the end LB insertion point downstream according to 1-585bp sequence design in SEQ ID NO:8, primer, reverse primer
GL_R:5'TTAGAGTCGAATACGGGGTTTTAC 3'(SEQ ID No:6)。
The present invention has the advantage that and the utility model has the advantages that the present invention is bivalent anti-herbicide gene cotton line GGK2 or contains
The Testing and appraisal of the derived material of the GGK2 of identical bivalent anti-herbicide gene provides accurate, reliable molecular labeling and special
Property primer, can be used for GGK2 or the identification of its derived material, provides guarantee for Transgene-safty.Detection method letter
It is single, detection speed is fast, be suitable for homozygosis in genetically modified crops genetic breeding to bivalent anti-herbicide gene in filial generation/
Heterozygote breeding material is identified and is screened on a large scale, is helped to shorten breeding process, is reduced breeding cost, for training
Bivalent antiweed transgene cotton is educated to lay a good foundation.
Detailed description of the invention
Fig. 1: conversion carrier pGBIGR79-GAT T-DNA regional structure schematic diagram.
Fig. 2: antiweed transgene cotton GGK2 strain detects electrophorogram；Wherein I is non-transgenic acceptor material
The end R18RB primer extension product (negative control)；II is the end GGK2T-DNA insertion point RB primer extension product；III is non-turn
Genetic recipient material R18LB end primer extension product (negative control)；IV produces for GGK2T-DNA insertion point LB end primer amplification
Object；M is Marker.
Specific embodiment
The following examples are intended to illustrate the invention, but is not limited to protection scope of the present invention.
Test method without specific conditions in following embodiment, usually according to conventional laboratory conditions, such as
Condition described in Sambrook etc. " Molecular Cloning:A Laboratory guide " (third edition, Science Press), or according to instrument and equipment and
Condition proposed by the experimental method that reagent manufacturer provides.Reagent and consumptive material involved in experiment are commercially available conventional quotient
Product.
Embodiment 1 contains the PCR of bivalent anti-herbicide gene cotton GGK2 and non-transgenic acceptor material R18 identification pair
Than test
(1) test material
(1) vegetable material: bivalent anti-herbicide gene cotton line GGK2 (Chinese Academy of Agricultural Sciences's biology is cultivated) is non-
Transgenic acceptor R18 (is obtained, Biological Technology institute, Chinese Academy of Agricultural Sciences mentions by (Coker 312) breeding of Ke's word 312
For).
(2) primer: primer is synthesized by Shanghai biotechnology Co., Ltd.
(2) test method
(1), the leaves genomic DNA of GGK2 and R18 extracting genome DNA: are extracted respectively using CTAB method.
(2) PCR amplification of molecular labeling 1: respectively using GGK2 or R18 genomic DNA as template, it is with GR_F and NPT_R
Primer carries out PCR amplification, obtains pcr amplification product；The wherein primer are as follows:
Forward primer GR_F:5'ctacattaagggtatatagaagtg3'(SEQ ID No:3),
Reverse primer NPT_R:5'gttgtgcccagtcatagccgaatag3'(SEQ ID No:4)；
Wherein PCR amplification system (total system 20uL) are as follows: 1 μ L of genomic DNA (concentration is 100ng/ μ L),1 μ L, PCR buffer of Taq archaeal dna polymerase (Beijing Quanshijin Biotechnology Co., Ltd), 2 μ L, dNTP mix
(2.5mM) 2 μ L, 1 μ L of forward primer (10 μM), 1 μ L of reverse primer (10 μM) utilize ddH2O supplements overall reaction system to 20 μ L.
PCR reaction condition are as follows: 94 DEG C of 5min；94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min, 35 circulations；72℃10min.
(3) PCR amplification of molecular labeling 2: respectively using GGK2 or R18 genomic DNA as template, it is with GAT_F and GL_R
Primer carries out PCR amplification, obtains pcr amplification product；The wherein primer are as follows:
Forward primer GAT_F:5'ttcactcattaaacacgccgaagagatc 3'(SEQ ID No:5)
Reverse primer GL_R:5'ttagagtcgaatacggggttttac3'(SEQ ID No:6).
Wherein PCR reaction system and reaction condition is shown in step (2).
It (4) is 1% progress electrophoresis in Ago-Gel concentration by step (2) and (3) resulting pcr amplification product, as a result
(see Fig. 2) GGK2 genomic DNA utilizes two pairs of primers difference amplifier molecule label 1 (955bp) and molecular labeling 2 (1143bp)
2 bands, and band cannot be amplified by compareing non-transgenic acceptor material R18；2 bands that GGK2 is amplified deliver Beijing
Qing Kexin industry Bioisystech Co., Ltd is sequenced, and as a result the sequence of the nucleotide of molecular labeling 1 is SEQ ID No:1, point
The nucleotides sequence of sub- label 2 is classified as SEQ ID No:2.
The above results illustrate using molecular labeling of the present invention can special Testing and appraisal contain foreign gene NPT II,
The bivalent herbicide resistant gene cotton material GGK2 of GR79 and GAT, it can also be used to which identification contains identical bivalent antiweed base
Because of the derived material of the GGK2 of cotton.In addition, also illustrating that the flanking sequence of T-DNA insertion chromosomal foci and its PCR amplification produce
Molecular labeling 1 and the molecule marked price 2 of object, can be used as mark GGK2 and its spin-off containing identical bivalent anti-herbicide gene
The molecular marker of system.
Claims (10)
1. identifying the molecular labeling of bivalent anti-herbicide gene cotton, it is characterised in that the molecular labeling is by molecular labeling 1
It is formed with molecular labeling 2；Wherein the nucleotide sequence shown in SEQ ID NO:1 of molecular labeling 1 forms；Point
Sub- label 2 nucleotide sequence shown in SEQ ID NO:2 forms.
2. molecular labeling according to claim 1, it is characterised in that the PCR primer for amplifier molecule label 1 is to by SEQ
The composition of nucleotide sequence shown in ID No:3 and SEQ ID No:4；PCR primer for amplifier molecule label 2 is to by SEQ ID
The composition of nucleotide sequence shown in No:5 and SEQ ID No:6；Specific primer sequence is as follows:
Forward primer GR_F:5'CTACATTAAGGGTATATAGAAGTG3'(SEQ ID No:3),
Reverse primer NPT_R:5'GTTGTGCCCAGTCATAGCCGAATAG3'(SEQ ID No:4)；
Forward primer GAT_F:5'TTCACTCATTAAACACGCCGAAGAGATC3'(SEQ ID No:5),
Reverse primer GL_R:5'TTAGAGTCGAATACGGGGTTTTAC 3'(SEQ ID No:6).
3. molecular labeling according to claim 1 or 2, it is characterised in that the bivalent anti-herbicide gene cotton refers to
The derived material of GGK2 or the GGK2 containing identical bivalent anti-herbicide gene, or the hybridization assembled by them as parent
Kind；Wherein the GGK2 is the T-DNA that will be composed in series by GR79 and GAT expression casette, in the form of single insertion point
It is integrated in the transgene cotton strain obtained on cotton chromosome；The insertion point be D10 chromosome 20274741~
20274752 positions, insertion point flanking sequence are SEQ ID NO:7 and SEQ ID NO:8；The T-DNA Insert Fragment by
II marker gene of NPT, GR79 and GAT anti-herbicide gene expression cassette are composed in series.
4. the PCR primer for expanding molecular labeling described in claim 1, it is characterised in that the PCR primer is drawn by 2
Object is to composition；Wherein 1 primer pair nucleotide sequence shown in SEQ ID No:3 and SEQ ID No:4 forms；Another draws
Object forms the nucleotide sequence shown in SEQ ID No:5 and SEQ ID No:6.
5. application of the molecular labeling described in claim 1 on identification bivalent anti-herbicide gene cotton.
6. application according to claim 5, it is characterised in that the bivalent anti-herbicide gene cotton refer to GGK2 or
The derived material of GGK2 containing identical bivalent anti-herbicide gene, or the cenospecies assembled by them as parent；Wherein
The GGK2 is the T-DNA that will be composed in series by GR79 and GAT expression casette, is integrated in cotton in the form of single insertion point
The transgene cotton strain obtained on flower chromosome；The insertion point is D10 chromosome 20274741~20274752
It sets, insertion point flanking sequence is SEQ ID NO:7 and SEQ ID NO:8；The T-DNA Insert Fragment is marked by NPT II
Gene, GR79 and GAT anti-herbicide gene expression cassette are composed in series.
7. application of the primer as claimed in claim 4 on identification bivalent anti-herbicide gene cotton.
8. application according to claim 7, it is characterised in that the bivalent anti-herbicide gene cotton refer to GGK2 or
The derived material of GGK2 containing identical bivalent anti-herbicide gene, or the cenospecies assembled by them as parent；Wherein
The GGK2 is the T-DNA that will be composed in series by GR79 and GAT expression casette, is integrated in cotton in the form of single insertion point
The transgene cotton strain obtained on flower chromosome；The insertion point is D10 chromosome 20274741~20274752
It sets, insertion point flanking sequence is SEQ ID NO:7 and SEQ ID NO:8；The T-DNA Insert Fragment is marked by NPT II
Gene, GR79 and GAT anti-herbicide gene expression cassette are composed in series.
9. utilizing the method for molecular markers for identification bivalent anti-herbicide gene cotton described in claim 1, it is characterised in that mention
Cotton genomic dna to be measured is taken, then using cotton genomic dna to be measured as template, respectively with SEQ ID No:3 and SEQ ID
Nucleotides sequence shown in No:4 is classified as primer and carries out PCR amplification；Simultaneously using cotton genomic dna to be measured as template, with SEQ ID
Nucleotides sequence shown in No:5 and SEQ ID No:6 is classified as primer and carries out PCR amplification；Electrophoresis, selection have molecular labeling 1 and divide
The cotton of sub- label 2, as bivalent anti-herbicide gene cotton；Wherein the molecular labeling 1 is as shown in SEQ ID NO:1
Nucleotide sequence composition, the molecular labeling 2 nucleotide sequence shown in SEQ ID NO:2 form；The bivalent is anti-
Herbicide resistance gene cotton refers to the derived material of GGK2 or the GGK2 containing identical bivalent anti-herbicide gene, or by them
The cenospecies assembled as parent；Wherein the GGK2 is the T-DNA that will be composed in series by GR79 and GAT expression casette,
The transgene cotton strain obtained on cotton chromosome is integrated in the form of single insertion point；The insertion point is D10
20274741~20274752 position of chromosome, insertion point flanking sequence are SEQ ID NO:7 and SEQ ID NO:8；It is described
T-DNA Insert Fragment be composed in series by II marker gene of NPT, GR79 and GAT anti-herbicide gene expression cassette.
10. the method for cultivating bivalent anti-herbicide gene cotton using molecular labeling described in claim 1, it is characterised in that with
The derived material of GGK2 or the GGK2 containing identical bivalent anti-herbicide gene are one of parent hybridization；Filial generation is planted,
Seedling stage extracts leaves genomic DNA, then using leaves genomic DNA as template, with SEQ ID No:3 and SEQ ID No:4 institute
The nucleotides sequence shown is classified as primer and carries out PCR amplification；Simultaneously using leaves genomic DNA as template, with SEQ ID No:5 and SEQ
Nucleotides sequence shown in ID No:6 is classified as primer and carries out PCR amplification；Electrophoresis selects have molecular labeling 1 and molecular labeling 2
Cotton eliminates the cotton without molecular labeling 1 and molecular labeling 2 into follow-on option program；It is selected by 4-6 generation,
Select the cotton variety of new bivalent anti-herbicide gene；GGK2 described in wherein is will be by GR79 and GAT expression casette string
The T-DNA for joining composition, is integrated in the transgene cotton strain obtained on cotton chromosome in the form of single insertion point；Described
Insertion point is 20274741~20274752 position of D10 chromosome, and insertion point flanking sequence is SEQ ID NO:7 and SEQ
ID NO:8；The T-DNA Insert Fragment is by II marker gene of NPT, GR79 and GAT anti-herbicide gene expression cassette series connection group
At.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610329846.9A CN105755164B (en) | 2016-05-18 | 2016-05-18 | Identify bivalent anti-herbicide gene cotton GGK2 molecular labeling and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610329846.9A CN105755164B (en) | 2016-05-18 | 2016-05-18 | Identify bivalent anti-herbicide gene cotton GGK2 molecular labeling and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105755164A CN105755164A (en) | 2016-07-13 |
| CN105755164B true CN105755164B (en) | 2019-01-29 |
Family
ID=56323095
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610329846.9A Active CN105755164B (en) | 2016-05-18 | 2016-05-18 | Identify bivalent anti-herbicide gene cotton GGK2 molecular labeling and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105755164B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107177691A (en) * | 2017-07-14 | 2017-09-19 | 中国农业科学院棉花研究所 | SNP marker and its detection method for assisted Selection cotton excellent parent genetic background |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107964537B (en) * | 2017-11-30 | 2020-09-18 | 中国农业科学院生物技术研究所 | Monoclonal antibody for detecting GR79 transgenic plant and application |
| WO2022213520A1 (en) * | 2021-04-08 | 2022-10-13 | 中国农业科学院生物技术研究所 | Expression vector of glyphosate-resistant genes gr79 and gat, high glyphosate-resistant corn, and detection method therefor |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981199B (en) * | 2014-05-15 | 2017-01-18 | 中国农业科学院生物技术研究所 | Glyphosate resistance gene-containing expression vector and application thereof |
| CN105039526B (en) * | 2015-07-02 | 2018-04-10 | 吉林省农业科学院 | Method based on the lucky raw round-grained rice 2 of foreign gene flanking sequence identification transgenic paddy rice |
-
2016
- 2016-05-18 CN CN201610329846.9A patent/CN105755164B/en active Active
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107177691A (en) * | 2017-07-14 | 2017-09-19 | 中国农业科学院棉花研究所 | SNP marker and its detection method for assisted Selection cotton excellent parent genetic background |
| CN107177691B (en) * | 2017-07-14 | 2019-11-22 | 中国农业科学院棉花研究所 | SNP marker and its detection method for assisted Selection cotton excellent parent genetic background |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105755164A (en) | 2016-07-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106086010B (en) | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9008 | |
| CN107828794A (en) | A kind of method for creating of Rice Salt gene OsRR22 mutant, its amino acid sequence encoded, plant and the mutant | |
| CN106086011B (en) | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9004 | |
| CN104830845B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9878 | |
| CN104878094B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9888 | |
| CN104830846B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9898 | |
| CN105830912B (en) | A kind of breeding method of high yield, lasting neck blast resistance rice | |
| CN107129993A (en) | A kind of Antiglyphosate gene of modification and the breeding method of glyphosate-resistant rice | |
| CN107201404A (en) | A kind of molecular biology identification method and its application for Asparagus dioecian plant sex | |
| CN104878096B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 | |
| CN105755164B (en) | Identify bivalent anti-herbicide gene cotton GGK2 molecular labeling and application | |
| CN107475254A (en) | A kind of eary maturity of rice allele, its molecular labeling and application | |
| CN104878095B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9858 | |
| CN109825638A (en) | A kind of Rice Salt gene OsRR22 guidance primer, application and target spot carrier and target spot support preparation method | |
| CN107988409A (en) | Differentiate Rice Salt gene OsRR22 wild types or specific C APS marks, primer and the primer purposes of mutant | |
| CN110607388A (en) | Wheat stripe rust resistant gene related SNP molecular marker in adult stage, primer and application thereof | |
| CN104120126A (en) | SRAP molecular marker closely linked with male sterility genes of tomatoes and preparation method thereof | |
| CN109295245A (en) | One kind being associated with SNP marker and related gene and application with ramie plant division number | |
| CN106119245B (en) | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001 | |
| CN106062192A (en) | Maize cytoplasmic male sterility (CMS) s-type restorer gene RF3 | |
| CN107586874A (en) | For identifying primer pair and its application of capsicum yellow flower pesticide character | |
| CN111944842A (en) | Method for constructing upland cotton insect-resistant related gene editing mutant library | |
| CN109006456B (en) | Breeding method of pimento nuclear male sterile dual-purpose line | |
| CN104928299B (en) | Leaf Spot Caused by Corynespora cassiicola on Cucumber disease-resistant gene Cca and its encoding proteins and application | |
| CN113652423B (en) | Method for auxiliary identification of drought resistance of wheat to be detected and special molecular marker thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |