CN105755164A - Molecular marker for identifying bivalent herbicide resistance gene cotton GGK2 and application of molecular marker - Google Patents
Molecular marker for identifying bivalent herbicide resistance gene cotton GGK2 and application of molecular marker Download PDFInfo
- Publication number
- CN105755164A CN105755164A CN201610329846.9A CN201610329846A CN105755164A CN 105755164 A CN105755164 A CN 105755164A CN 201610329846 A CN201610329846 A CN 201610329846A CN 105755164 A CN105755164 A CN 105755164A
- Authority
- CN
- China
- Prior art keywords
- seqidno
- molecular marker
- primer
- ggk2
- bivalent anti
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention belongs to the field of detection of genetically modified plants, and particularly discloses 2 molecular markers for identifying the specificity of bivalent herbicide resistance gene cotton strains GGK2 and derived lines. Each molecular marker consists of nucleotide sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2. The invention further discloses specific primers for amplifying the molecular markers, and purposes of the molecular markers and the specific primers. Accurate and reliable molecular markers and specific primers are provided for detection and identification of the bivalent herbicide resistance gene cotton strains GGK2 or derived materials thereof, and transgenic safety is guaranteed; then the detection method is simple, the detection speed is high, large-scale identification and screening are appropriately performed on homozygosis/heterozygote breeding materials in bivalent herbicide resistance genes in filial generations in heredity and breeding of genetically modified crops, shortening of a breeding process is facilitated, and the breeding cost is reduced.
Description
Technical field
The invention belongs to transgenic plant and identify field, be specifically related to identify the molecular marker of bivalent anti-herbicide gene Cotton Gossypii GGK2 and the purposes of this molecular marker.
Background technology
The yield and quality of Cotton Gossypii in weeds serious threat. and it and Cotton Gossypii fight for light, water and nutrient on the one hand, and on the other hand as asking host in diseases and pests of agronomic crop, spread disease insect pest.In Cotton in China cultivation, artificial weeding cost is 3000 yuan/hectare, cotton variety is made to obtain herbicide resistance by anti-herbicide gene imports Cotton Gossypii, recycling herbicide carries out weeding, China cotton grower not only can be made every year to reduce input more than hundred million yuan, and raising output of cotton and quality, reduction Cotton Production cost, increase cotton grower are taken in significant.
Glyphosate (English name: Glyphosate；Chemical formula: C3H8NO5P；Chemical name: N-(phosphonomethyl) glycine；Trade name: agriculture reaches (Roundup) glyphosate, careless dry phosphine, the sweet acid of phosphine etc.) it is that a kind of wide spectrum that About Monsanto Chemicals (Monsanto) develops goes out natural disposition, inner-adsorption conduction-type herbicide, its toxic mechanism is mainly the EPSPS synthase in competitive inhibition shikimic acid pathway, cause that shikimic acid pathway interrupts, aromatic amino acid biosynthesis block, thus upsetting the normal nitrogen metabolism of organism, ultimately result in organisms die.The advantages such as glyphosate has simple in construction, production cost is low, herbicidal effect good, low toxicity noresidue, are the herbicide kinds that usable floor area is the widest in the world at present.But as a kind of nonselective herbicide, crops are had natural disposition effect of going out by equally, which greatly limits glyphosate range of application in agricultural production.For using glyphosate in agricultural production, the crops with glyphosate resistance or degraded character must be cultivated.
Antiglyphosate gene is the gene of the antagonism herbicide glyphosate being naturally occurring in some specific species, and this gene code resistance glyphosate enzyme 5-enolpyrul-shikimate acid-3-phosphate synthase, so that glyphosate loses the toxic action to mushroom or plant.Utilizing the means such as genetic engineering, will cultivate glyphosate resistant crops in the Epsps gene transferred plant body of resistance glyphosate, controlling weeds for crop has very important production meaning.Since the glyphosate-class herbicides agriculture of About Monsanto Chemicals in 1976 has reached since (Roundup) succeed in developing and be used widely, crop resistance glyphosate transgenic research becomes the focus of Advances of Genetic Engineering for Herbicide Resistance in Plant research.At present, China has the release of multiple antiweed transgene cotton strain entered environment and pilot production stage.
Identification and detection to genetically modified crops is that genetically modified crops carry out the basis of effectively supervision.Detection method to genetically modified crops composition, mainly there is the gene specific detection method detected for external source genes of interest and controlling element, for the carrier specificity detection method that the feature of genetic transformation carrier is set up, for three classes such as the genetically modified crops event-specific detection methods that foreign DNA insertion sequence feature is set up.Wherein in genetically modified crops, the flanking sequence of foreign DNA Insert Fragment is the most important molecular marker of the genetically modified crops (.PlantJ.2009 such as DeBuckS；60.Doi:10.1111/j.1365-313X.2009.03942.x).Due to each genetically modified crops strain, exogenous gene integration site in acceptor gene group has randomness, namely identical carrier repeatedly converts, the position integrated has specificity and the nonrepeatability of height, therefore, the flanking sequence utilizing the chromosomal foci that foreign DNA inserts identifies that transformed variety (strain) is to identify that genetically modified crops are the most reliable at present specifically, the most special detection method, the method can the accurate same transformant of Testing and appraisal and derivative strain (HenselG etc.BMCPlantBiology.12 (1): 1-11.doi:10.1186/1471-2229-12-171) thereof.(application number is patent " based on the method that exogenous gene flanking sequence identifies the lucky raw round-grained rice 2 of transgenic paddy rice ": 201510381819.1) disclose the method utilizing exogenous gene flanking sequence to identify this transgenic line.
At present, the transgene cotton mainly with unit price Antiglyphosate gene of application in Cotton Production, it is relatively poor to glyphosate resistance, and patent application " a kind of expression vector containing Glyphosate resistance gene and application thereof " (application number is: 2014102047036) disclose the transgene cotton of a kind of bivalent Antiglyphosate gene containing GR79 and GAT, obtain higher glyphosate resistance, there is huge using value.
Summary of the invention
The present inventor utilizes agrobacterium-mediated transformation, and by patent application " a kind of expression vector containing Glyphosate resistance gene and application thereof ", (application number is: bivalent anti-herbicide gene GR79 and the GAT described in 2014102047036) imports Cotton Gossypii strain R18, a single transgenic event inserting D10 chromosome 20274741～20274752 site is screened from numerous bivalent antiweed transgenic events, final cultivation obtains the opposing the highest strain that can reach 8 times of production application concentration of Gyphosate herbicice agent concentration, it has important using value, inventor is by this strain called after GGK2.In GGK2 strain, designing specific primer and specific probe based on external source Insert Fragment and flanking sequence thereof, being used for identifying GGK2 strain or its Derivative line, thus forming the present invention.
Present invention aim at providing the molecular marker identifying bivalent anti-herbicide gene Cotton Gossypii.
Another object of the present invention is in that to provide the PCR primer for expanding above-mentioned molecular marker.
The present invention the 3rd purpose is in that the purposes providing above-mentioned molecular marker identifying on bivalent anti-herbicide gene Cotton Gossypii.
The present invention the 4th purpose is in that the purposes providing above-mentioned primer identifying on bivalent anti-herbicide gene Cotton Gossypii.
The present invention the 5th purpose is in that to provide the method utilizing above-mentioned molecular markers for identification bivalent anti-herbicide gene Cotton Gossypii.
The present invention the 6th purpose is in that to provide the method utilizing above-mentioned molecular marker to cultivate bivalent anti-herbicide gene Cotton Gossypii.
For achieving the above object, the present invention adopts the following technical scheme that
The present invention identifies the molecular marker of bivalent anti-herbicide gene Cotton Gossypii, and described molecular marker is made up of molecular marker 1 and molecular marker 2；The wherein said molecular marker 1 nucleotide sequence shown in SEQIDNO:1 forms；The described molecular marker 2 nucleotide sequence shown in SEQIDNO:2 forms.
Above-mentioned molecular marker, wherein said molecular marker 1 is sized to 955bp.
Above-mentioned molecular marker, wherein said molecular marker 2 is sized to 1143bp.
Above-mentioned molecular marker, wherein forms for nucleotide sequence shown in SEQIDNo:3 and SEQIDNo:4 of the PCR primer pair of amplifier molecule labelling 1；Form for nucleotide sequence shown in SEQIDNo:5 and SEQIDNo:6 of the PCR primer pair of amplifier molecule labelling 2；Concrete primer sequence is as follows:
Forward primer GR_F:5'CTACATTAAGGGTATATAGAAGTG3'(SEQIDNo:3),
Reverse primer NPT_R:5'GTTGTGCCCAGTCATAGCCGAATAG3'(SEQIDNo:4)；
Forward primer GAT_F:5'TTCACTCATTAAACACGCCGAAGAGATC3'(SEQIDNo:5),
Reverse primer GL_R:5'TTAGAGTCGAATACGGGGTTTTAC3'(SEQIDNo:6).
Above-mentioned molecular marker, wherein said bivalent anti-herbicide gene Cotton Gossypii refers to GGK2 or the derived material of the GGK2 containing identical bivalent anti-herbicide gene or the cenospecies joined by them as parent's group.
Described bivalent anti-herbicide gene refers to GR79 and GAT.
Described herbicide refers to glyphosate.
For expanding the PCR primer of above-mentioned molecular marker, described PCR primer is made up of 2 primer pairs；Wherein 1 primer pair nucleotide sequence shown in SEQIDNo:3 and SEQIDNo:4 forms；Another primer pair nucleotide sequence shown in SEQIDNo:5 and SEQIDNo:6 forms.
Above-mentioned molecular marker is in the application identified on bivalent anti-herbicide gene Cotton Gossypii.
Bivalent anti-herbicide gene Cotton Gossypii described in above-mentioned application refers to GGK2 or the derived material of the GGK2 containing identical bivalent anti-herbicide gene or the cenospecies joined by them as parent's group.
Molecular marker described in above-mentioned application is made up of molecular marker 1 and molecular marker 2.
Molecular marker described in above-mentioned application, wherein the PCR primer for amplifier molecule labelling is made up of 2 primer pairs；Wherein it is made up of PCR primer pair nucleotide sequence shown in SEQIDNo:3 and SEQIDNo:4 for the primer pair of amplifier molecule labelling 1；Primer pair for amplifier molecule labelling 2 is made up of PCR primer pair nucleotide sequence shown in SEQIDNo:5 and SEQIDNo:6.
Above-mentioned primer is in the application identified on bivalent anti-herbicide gene Cotton Gossypii.
Described primer is made up of 2 primer pairs, and wherein 1 primer pair nucleotide sequence shown in SEQIDNo:3 and SEQIDNo:4 forms；Another primer pair is made up of PCR primer pair nucleotide sequence shown in SEQIDNo:5 and SEQIDNo:6.
Bivalent anti-herbicide gene Cotton Gossypii described in above-mentioned application refers to GGK2 or the derived material of the GGK2 containing identical bivalent anti-herbicide gene or the cenospecies joined by them as parent's group.
Present invention also offers the method utilizing above-mentioned molecular markers for identification bivalent anti-herbicide gene Cotton Gossypii, including extracting cotton genomic dna to be measured, then with cotton genomic dna to be measured for template, arrange with the nucleotides sequence shown in SEQIDNo:3 and SEQIDNo:4 respectively and carry out pcr amplification for primer；Simultaneously with cotton genomic dna to be measured for template, arrange with the nucleotides sequence shown in SEQIDNo:5 and SEQIDNo:6 and carry out pcr amplification for primer；Electrophoresis, selects have molecular marker 1 and the Cotton Gossypii of molecular marker 2, is bivalent anti-herbicide gene Cotton Gossypii.
The molecular marker 1 described in said method nucleotide sequence shown in SEQIDNO:1 forms, and the described molecular marker 2 nucleotide sequence shown in SEQIDNO:2 forms.
The reaction condition of the PCR described in said method is: 94 DEG C of 5min；94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min, 35 circulations；72℃10min.
The reaction system of the PCR described in said method is: genomic DNA (template) 1 μ L (DNA concentration is 100ng/ μ L),Taq DNA polymerase 1 μ L, PCR buffer 2 μ L, dNTPmix (2.5mM) 2 μ L, forward primer (10 μMs) 1 μ L, reverse primer (10 μMs) 1 μ L, utilize ddH2O to supplement overall reaction system to 20 μ L.
Bivalent anti-herbicide gene Cotton Gossypii described in said method refers to GGK2 or the derived material of the GGK2 containing identical bivalent anti-herbicide gene or the cenospecies joined by them as parent's group.
Utilize the method that above-mentioned molecular marker cultivates bivalent anti-herbicide gene Cotton Gossypii, hybridize for one of parent with the derived material of GGK2 or the GGK2 containing identical bivalent anti-herbicide gene；Plantation filial generation, extracts leaves genomic DNA in seedling stage, then with leaves genomic DNA for template, arranges with the nucleotides sequence shown in SEQIDNo:3 and SEQIDNo:4 and carry out pcr amplification for primer；Simultaneously with leaves genomic DNA for template, arrange with the nucleotides sequence shown in SEQIDNo:5 and SEQIDNo:6 and carry out pcr amplification for primer；Electrophoresis, selects have molecular marker 1 and the Cotton Gossypii of molecular marker 2, enters follow-on option program, eliminate and do not have molecular marker 1 and the Cotton Gossypii of molecular marker 2；Select through 4-6 generation, select the cotton variety of new bivalent anti-herbicide gene.
Described bivalent anti-herbicide gene Cotton Gossypii refers to GGK2 or the derived material of the GGK2 containing identical bivalent anti-herbicide gene or the cenospecies joined by them as parent's group.
Described herbicide refers to glyphosate.
Described bivalent anti-herbicide gene refers to GR79 and GAT.
Bivalent anti-herbicide gene Cotton Gossypii strain GGK2 of the present invention is Biological Technology institute, Chinese Academy of Agricultural Sciences, utilize agrobacterium-mediated transformation that bivalent anti-herbicide gene GR79 and GAT imports Cotton Gossypii strain R18 (R18 obtains from Ke's word 312 (Coker312) cotton variety selection-breeding), the transgenic event of the single insertion point obtained is screened from numerous bivalent antiweed transgenic events, final cultivation obtains high antiweed New cotton line, called after GGK2.It is resisted, and Gyphosate herbicice agent concentration is the highest can reach 8 times of production application concentration, has important using value.
According to patent application " a kind of expression vector containing Glyphosate resistance gene and application thereof ", (application number is the building process of GGK2: the method 2014102047036) announced builds.The T-DNA (see Fig. 1) being composed in series by GR79 and GAT expression casette in this strain, is integrated on cotton chromosome with the form of single insertion point.T-DNA Insert Fragment is composed in series by NPT II marker gene, GR79 and GAT anti-herbicide gene expression cassette, single insertion point is there is in it on GGK2 cotton chromosome, site is D10 chromosome 20274741～20274752 position, and insertion point flanking sequence is SEQIDNO:7 and SEQIDNO:8.
Utilize T-DNA5' end (RB) flanking sequence that Tail-PCR method obtains, Gossypium hirsutum L. genome database is analyzed by Blast, found that the T-DNA that NPT II, GR79 and GAT expression cassette are composed in series inserts Gossypium hirsutum L. D10 chromosome 20274741～20274752 position, obtain T-DNA3' end (LB) flank reference dna sequence simultaneously.According to the 3' end reference sequences design PCR primer obtained, and the PCR primer of GGK2 is carried out cloning and sequencing, be finally obtained complete 3' end flanking sequence.The present invention is according to T-DNA5' end (RB) end and 3' end (LB) side wing DNA sequence design special primer, by being combined with the special primer of T-DNA5' end end and 3' end NPT II, GAT exogenous gene, establish a set of method for Testing and appraisal bivalent anti-herbicide gene New cotton line GGK2.
The present invention sets up, according to exogenous gene NPT II, GR79, GAT expressing in series frame in bivalent anti-herbicide gene Cotton Gossypii GGK2 Insert Fragment and flanking sequence SEQIDNO:7 and SEQIDNO:8 thereof on Gossypium hirsutum L. D10 chromosome, the specific primer and molecular marker of identifying GGK2 Cotton Gossypii strain and derived material and kind, and utilizes specific primer to carry out pcr amplification authentication method.
Described flanking sequence is T-DNARB side wing cotton gene group sequence, and its sequence is such as shown in SEQIDNO:7.Described RB rectifies to special primer according to 1-710bp sequential design in flanking sequence SEQIDNO:7, and primer is positioned at 515bp place, RB end insertion point upstream, forward primer GR_F:5'CTACATTAAGGGTATATAGAAGTG3'(SEQIDNo:3)；The reverse special primer of described RB end is according to the design of NPT II gene order, and primer is positioned at 440bp place, RB end insertion point downstream, reverse primer NPT_R:5'GTTGTGCCCAGTCATAGCCGAATAG3'(SEQIDNo:4).
Described flanking sequence is T-DNALB side wing cotton gene group sequence, and its sequence is such as shown in SEQIDNO:8.Described LB rectifies to special primer according to the design of GAT gene order, primer is positioned at 788bp place, LB end insertion point upstream, forward primer GAT_F:5'TTCACTCATTAAACACGCCGAAGAGATC3'(SEQIDNo:5), the reverse special primer of described LB end is according to 1-585bp sequential design in SEQIDNO:8, primer is positioned at 356bp place, LB end insertion point downstream, reverse primer GL_R:5'TTAGAGTCGAATACGGGGTTTTAC3'(SEQIDNo:6).
The present invention has the advantage that and beneficial effect: the Testing and appraisal that the present invention is the derived material of bivalent anti-herbicide gene Cotton Gossypii strain GGK2 or the GGK2 containing identical bivalent anti-herbicide gene provides molecular marker accurate, reliable and specific primer, can be used for the qualification of GGK2 or its derived material, provide guarantee for Transgene-safty.Detection method is simple, detection speed is fast, in being suitable in genetically modified crops genetic breeding to filial generation, the isozygotying of bivalent anti-herbicide gene/heterozygote breeding material is identified on a large scale and screens, contribute to shortening breeding process, reduce breeding cost, lay a good foundation for cultivating bivalent antiweed transgene cotton.
Accompanying drawing explanation
The T-DNA regional structure schematic diagram of Fig. 1: conversion carrier pGBIGR79-GAT.
Fig. 2: antiweed transgene cotton GGK2 strain detection electrophoresis pattern；Wherein I is non-transgenic acceptor material R18RB end primer extension product (negative control)；II is GGK2T-DNA insertion point RB end primer extension product；III is non-transgenic acceptor material R18LB end primer extension product (negative control)；IV is GGK2T-DNA insertion point LB end primer extension product；M is Marker.
Detailed description of the invention
Following example are used for illustrating the present invention, but are not limited to protection scope of the present invention.
The experimental technique of unreceipted actual conditions in following example, generally conventionally experiment condition, such as Sambrook etc. " Molecular Cloning: A Laboratory the guide " (third edition, Science Press) described in condition, or the experimental technique provided according to instrument and equipment and reagent manufacturer it is proposed that condition.Reagent involved in experiment and consumptive material are commercially available customary commercial.
The embodiment 1 PCR containing bivalent anti-herbicide gene Cotton Gossypii GGK2 and not genetically modified acceptor material R18 identifies contrast test
(1) test material
(1) vegetable material: bivalent anti-herbicide gene Cotton Gossypii strain GGK2 (Chinese Academy of Agricultural Sciences's biology is cultivated), non-transgenic acceptor material R18 (is obtained by Ke's word 312 (Coker312) selection-breeding, Biological Technology institute, Chinese Academy of Agricultural Sciences provides).
(2) primer: primer is synthesized by Shanghai biotechnology company limited.
(2) test method
(1), extracting genome DNA: utilize CTAB method to extract the leaves genomic DNA of GGK2 and R18 respectively.
(2) pcr amplification of molecular marker 1: respectively with GGK2 or R18 genomic DNA for template, carries out pcr amplification with GR_F and NPT_R for primer, obtains pcr amplification product；Wherein said primer is:
Forward primer GR_F:5'ctacattaagggtatatagaagtg3'(SEQIDNo:3),
Reverse primer NPT_R:5'gttgtgcccagtcatagccgaatag3'(SEQIDNo:4)；
Wherein PCR amplification system (total system 20uL) is: genomic DNA 1 μ L (concentration is 100ng/ μ L),Taq DNA polymerase (Beijing Quanshijin Biotechnology Co., Ltd) 1 μ L, PCR buffer 2 μ L, dNTPmix (2.5mM) 2 μ L, forward primer (10 μMs) 1 μ L, reverse primer (10 μMs) 1 μ L, utilizes ddH2O supplements overall reaction system to 20 μ L.PCR reaction condition is: 94 DEG C of 5min；94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min, 35 circulations；72℃10min.
(3) pcr amplification of molecular marker 2: respectively with GGK2 or R18 genomic DNA for template, carries out pcr amplification with GAT_F and GL_R for primer, obtains pcr amplification product；Wherein said primer is:
Forward primer GAT_F:5'ttcactcattaaacacgccgaagagatc3'(SEQIDNo:5)
Reverse primer GL_R:5'ttagagtcgaatacggggttttac3'(SEQIDNo:6).
Wherein PCR reaction system and reaction condition are shown in step (2).
(4) it is 1% carry out electrophoresis by the pcr amplification product of step (2) and (3) gained in agarose gel concentration, result (see Fig. 2) GGK2 genomic DNA utilizes two 2 bands to primer amplifier molecule labelling 1 (955bp) and molecular marker 2 (1143bp) respectively, and compares non-transgenic acceptor material R18 and can not amplify band；2 bands amplified by GGK2 are delivered Beijing Qing Kexin industry Bioisystech Co., Ltd and are checked order, and the sequence of the nucleotide of result molecular marker 1 is SEQIDNo:1, and the nucleotides sequence of molecular marker 2 is classified as SEQIDNo:2.
The above results illustrates to utilize the molecular marker of the present invention can the special Testing and appraisal bivalent herbicide resistant gene cotton material GGK2 that contains exogenous gene NPT II, GR79 and GAT, it is also possible in the derived material identifying the GGK2 containing identical bivalent anti-herbicide gene Cotton Gossypii.Additionally, also illustrate that T-DNA inserts the flanking sequence of chromosomal foci and the molecular marker 1 of pcr amplification product thereof and molecule marked price 2, it is possible to as the molecular marker of mark GGK2 and the derivative strain containing identical bivalent anti-herbicide gene thereof.
Claims (10)
1. identify the molecular marker of bivalent anti-herbicide gene Cotton Gossypii, it is characterised in that described molecular marker is made up of molecular marker 1 and molecular marker 2；The wherein said molecular marker 1 nucleotide sequence shown in SEQIDNO:1 forms；The described molecular marker 2 nucleotide sequence shown in SEQIDNO:2 forms.
2. molecular marker according to claim 1, it is characterised in that form for nucleotide sequence shown in SEQIDNo:3 and SEQIDNo:4 of the PCR primer pair of amplifier molecule labelling 1；Form for nucleotide sequence shown in SEQIDNo:5 and SEQIDNo:6 of the PCR primer pair of amplifier molecule labelling 2；Concrete primer sequence is as follows:
Forward primer GR_F:5'CTACATTAAGGGTATATAGAAGTG3'(SEQIDNo:3),
Reverse primer NPT_R:5'GTTGTGCCCAGTCATAGCCGAATAG3'(SEQIDNo:4)；
Forward primer GAT_F:5'TTCACTCATTAAACACGCCGAAGAGATC3'(SEQIDNo:5),
Reverse primer GL_R:5'TTAGAGTCGAATACGGGGTTTTAC3'(SEQIDNo:6).
3. molecular marker according to claim 1 and 2, it is characterised in that described bivalent anti-herbicide gene Cotton Gossypii refers to GGK2 or the derived material of the GGK2 containing identical bivalent anti-herbicide gene or the cenospecies joined by them as parent's group.
4. for expanding the PCR primer of the molecular marker described in claim 1, it is characterised in that described PCR primer is made up of 2 primer pairs；Wherein 1 primer pair nucleotide sequence shown in SEQIDNo:3 and SEQIDNo:4 forms；Another primer pair nucleotide sequence shown in SEQIDNo:5 and SEQIDNo:6 forms.
5. the molecular marker described in claim 1 is in the application identified on bivalent anti-herbicide gene Cotton Gossypii.
6. application according to claim 5, it is characterised in that described bivalent anti-herbicide gene Cotton Gossypii refers to GGK2 or the derived material of the GGK2 containing identical bivalent anti-herbicide gene or the cenospecies joined by them as parent's group.
7. the primer described in claim 4 is in the application identified on bivalent anti-herbicide gene Cotton Gossypii.
8. application according to claim 7, it is characterised in that described bivalent anti-herbicide gene Cotton Gossypii refers to GGK2 or the derived material of the GGK2 containing identical bivalent anti-herbicide gene or the cenospecies joined by them as parent's group.
9. the method utilizing molecular markers for identification bivalent anti-herbicide gene Cotton Gossypii described in claim 1, it is characterized in that extracting cotton genomic dna to be measured, then with cotton genomic dna to be measured for template, arrange with the nucleotides sequence shown in SEQIDNo:3 and SEQIDNo:4 respectively and carry out pcr amplification for primer；Simultaneously with cotton genomic dna to be measured for template, arrange with the nucleotides sequence shown in SEQIDNo:5 and SEQIDNo:6 and carry out pcr amplification for primer；Electrophoresis, selects have molecular marker 1 and the Cotton Gossypii of molecular marker 2, is bivalent anti-herbicide gene Cotton Gossypii；The wherein said molecular marker 1 nucleotide sequence shown in SEQIDNO:1 forms, and the described molecular marker 2 nucleotide sequence shown in SEQIDNO:2 forms；Described bivalent anti-herbicide gene Cotton Gossypii refers to GGK2 or the derived material of the GGK2 containing identical bivalent anti-herbicide gene or the cenospecies joined by them as parent's group.
10. utilize the method that the molecular marker described in claim 1 cultivates bivalent anti-herbicide gene Cotton Gossypii, it is characterised in that hybridize with the derived material of GGK2 or the GGK2 containing identical bivalent anti-herbicide gene for one of parent；Plantation filial generation, extracts leaves genomic DNA in seedling stage, then with leaves genomic DNA for template, arranges with the nucleotides sequence shown in SEQIDNo:3 and SEQIDNo:4 and carry out pcr amplification for primer；Simultaneously with leaves genomic DNA for template, arrange with the nucleotides sequence shown in SEQIDNo:5 and SEQIDNo:6 and carry out pcr amplification for primer；Electrophoresis, selects have molecular marker 1 and the Cotton Gossypii of molecular marker 2, enters follow-on option program, eliminate and do not have molecular marker 1 and the Cotton Gossypii of molecular marker 2；Select through 4-6 generation, select the cotton variety of new bivalent anti-herbicide gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610329846.9A CN105755164B (en) | 2016-05-18 | 2016-05-18 | Identify bivalent anti-herbicide gene cotton GGK2 molecular labeling and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610329846.9A CN105755164B (en) | 2016-05-18 | 2016-05-18 | Identify bivalent anti-herbicide gene cotton GGK2 molecular labeling and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105755164A true CN105755164A (en) | 2016-07-13 |
| CN105755164B CN105755164B (en) | 2019-01-29 |
Family
ID=56323095
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610329846.9A Active CN105755164B (en) | 2016-05-18 | 2016-05-18 | Identify bivalent anti-herbicide gene cotton GGK2 molecular labeling and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105755164B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107177691A (en) * | 2017-07-14 | 2017-09-19 | 中国农业科学院棉花研究所 | SNP marker and its detection method for assisted Selection cotton excellent parent genetic background |
| CN107964537A (en) * | 2017-11-30 | 2018-04-27 | 中国农业科学院生物技术研究所 | For detecting monoclonal antibody and its application of GR79 genetically modified plants |
| WO2022213520A1 (en) * | 2021-04-08 | 2022-10-13 | 中国农业科学院生物技术研究所 | Expression vector of glyphosate-resistant genes gr79 and gat, high glyphosate-resistant corn, and detection method therefor |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981199A (en) * | 2014-05-15 | 2014-08-13 | 中国农业科学院生物技术研究所 | Glyphosate resistance gene-containing expression vector and application thereof |
| CN105039526A (en) * | 2015-07-02 | 2015-11-11 | 吉林省农业科学院 | Method for identifying transgene paddy rice Jishengjing No.2 based on exogenous gene flanking sequences |
-
2016
- 2016-05-18 CN CN201610329846.9A patent/CN105755164B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103981199A (en) * | 2014-05-15 | 2014-08-13 | 中国农业科学院生物技术研究所 | Glyphosate resistance gene-containing expression vector and application thereof |
| CN105039526A (en) * | 2015-07-02 | 2015-11-11 | 吉林省农业科学院 | Method for identifying transgene paddy rice Jishengjing No.2 based on exogenous gene flanking sequences |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107177691A (en) * | 2017-07-14 | 2017-09-19 | 中国农业科学院棉花研究所 | SNP marker and its detection method for assisted Selection cotton excellent parent genetic background |
| CN107177691B (en) * | 2017-07-14 | 2019-11-22 | 中国农业科学院棉花研究所 | SNP marker and its detection method for assisted Selection cotton excellent parent genetic background |
| CN107964537A (en) * | 2017-11-30 | 2018-04-27 | 中国农业科学院生物技术研究所 | For detecting monoclonal antibody and its application of GR79 genetically modified plants |
| CN107964537B (en) * | 2017-11-30 | 2020-09-18 | 中国农业科学院生物技术研究所 | Monoclonal antibody for detecting GR79 transgenic plant and application |
| WO2022213520A1 (en) * | 2021-04-08 | 2022-10-13 | 中国农业科学院生物技术研究所 | Expression vector of glyphosate-resistant genes gr79 and gat, high glyphosate-resistant corn, and detection method therefor |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105755164B (en) | 2019-01-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106086010B (en) | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9008 | |
| CN104830845B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9878 | |
| CN103597079A (en) | Cotton transgenic event MON 88701 and methods of use thereof | |
| CN105764330B (en) | Locus associated with the response to abiotic stress | |
| CN106086011B (en) | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9004 | |
| CN104878094B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9888 | |
| CN104830846B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9898 | |
| CN104830847A (en) | Nucleic acid sequence for detecting corn plant DBN9936, and detection method thereof | |
| CN109868273A (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9501 | |
| CN104878096B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 | |
| CN107201404A (en) | A kind of molecular biology identification method and its application for Asparagus dioecian plant sex | |
| CN109825638A (en) | A kind of Rice Salt gene OsRR22 guidance primer, application and target spot carrier and target spot support preparation method | |
| CN104878095B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9858 | |
| CN110607388B (en) | Wheat stripe rust resistant gene related SNP molecular marker in adult stage, primer and application thereof | |
| CN104120126B (en) | SRAP molecular marker closely linked with Fructus Lycopersici esculenti male sterility gene and preparation method thereof | |
| CN105755164A (en) | Molecular marker for identifying bivalent herbicide resistance gene cotton GGK2 and application of molecular marker | |
| CN107988409A (en) | Differentiate Rice Salt gene OsRR22 wild types or specific C APS marks, primer and the primer purposes of mutant | |
| CN106119245B (en) | For detecting the nucleic acid sequence and its detection method of herbicide-tolerant soybean plant DBN9001 | |
| CN106062192A (en) | Maize cytoplasmic male sterility (CMS) s-type restorer gene RF3 | |
| CN104928299B (en) | Leaf Spot Caused by Corynespora cassiicola on Cucumber disease-resistant gene Cca and its encoding proteins and application | |
| CN109006456B (en) | Breeding method of pimento nuclear male sterile dual-purpose line | |
| CN104946630B (en) | Disease-resistant linkage molecular marker for cucumber target spot disease and special primer and application thereof | |
| Abaza et al. | The efficiency of SCoT, ISSR, and SRAP markers for detecting genetic polymorphism among Egyptian barley genotypes | |
| CN113179884B (en) | Method for cultivating high-yield wheat with gibberellic disease resistance in Huanghuai wheat area based on polygene polymerization | |
| CN113122653B (en) | Main effect QTL for regulating and controlling brown rice rate of rice, molecular marker and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |