CN105039526B - Method based on the lucky raw round-grained rice 2 of foreign gene flanking sequence identification transgenic paddy rice - Google Patents
Method based on the lucky raw round-grained rice 2 of foreign gene flanking sequence identification transgenic paddy rice Download PDFInfo
- Publication number
- CN105039526B CN105039526B CN201510381819.1A CN201510381819A CN105039526B CN 105039526 B CN105039526 B CN 105039526B CN 201510381819 A CN201510381819 A CN 201510381819A CN 105039526 B CN105039526 B CN 105039526B
- Authority
- CN
- China
- Prior art keywords
- rice
- grained
- round
- transgenic
- lucky
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of method based on the lucky raw round-grained rice 2 of foreign gene flanking sequence identification transgenic paddy rice, belong to biological technical field.Specifically provide the specific primer based on the lucky raw round-grained rice 2 of external source Insert Fragment flanking sequence identification transgenic rice lines；Using rice total dna to be measured as template, enter performing PCR with the specific primer and detect, determine whether rice to be measured is the lucky raw round-grained rice 2 of transgenic rice lines, while determine whether for the lucky raw round-grained rice 2 of homozygous or heterozygous.The present invention can rapidly and accurately identify whether testing sample is the lucky raw round-grained rice 2 of transgenic paddy rice, it can interpolate that homozygous or heterozygous simultaneously, establish the strain specificity PCR detection method of the lucky raw round-grained rice 2 of High sensitivity, specific transgenic rice lines, it is suitable for the qualitative detection of the raw round-grained rice of transgenic paddy rice Ji 2 and its derived varieties product, guarantee is provided for Transgene-safty.
Description
Technical field
The invention belongs to biological technical field, is related to a kind of lucky raw based on foreign gene flanking sequence identification transgenic paddy rice
The method that round-grained rice 2, and the nucleotides of corresponding primer and the lucky raw No. 2 specific PCR amplified fragments of round-grained rice of homozygous transgenic rice
Sequence.
Background technology
At present, the genetically modified crops component detection method reported, it is main to include for external source target gene and regulation and control member
The gene specific detection method of part detection, the carrier specificity detection method established for the feature of genetic transformation carrier, pin
Three classes such as the genetically modified crops event-specific detection method established to exogenous DNA insertion characteristic sequence.With first two method phase
Than genetically modified crops event-specific detection method has highest specific, is best suitable for the qualitative of transgenic product and quantifies
Detection.Due to each genetically modified crops strain, integration site of the foreign gene in acceptor gene group has randomness, i.e., identical
Carrier repeatedly convert, the position of integration has the specificity and nonrepeatability of height, therefore utilizes foreign gene side sequence
Row carry out event-specific detection method have specificity and accuracy, and can differentiate exogenous DNA insertion homozygosis or
Heterozygous state.
Rice is one of most important cereal crops in China or even the whole world, is that edible most populous, history is most in the world
Long crops.With widely studied and application of the transgenic technology in rice, there are multiple transgenic rice lines
Environment release has been carried out, has applied for commercial growth.It is that genetically modified plants are entered to carry out event-specific detection to genetically modified plants
Row supervision and management, ensure its important technical basis to develop in a healthy way.There are partial monopoly and document report to utilize product at present
It is the method for PCR method for detecting specificity identification genetically modified plants.Zhang Yan et al. is in 2010 according to transgenic rice lines section
The border sequence of the external source Insert Fragment of rich No. 6 devises rich No. 6 specific primers of section and specific probe, there is provided can be fast
The method of rich No. 6 of speed detection transgenic paddy rice section, guarantee is provided for Transgene-safty；Jin Wu armies et al. were based on turning in 2013
Gene pest-resistant rice strain TT51-1 flanking sequence establishes identification homozygous transgenic insect-proof rice strain TT51-1 side
Method.However, being found in the analysis to existing patent and document, there is presently no identification transgenic pest-resistant rice product both at home and abroad
The relevant report of lucky raw No. 2 detection methods of round-grained rice of system.
The content of the invention
The present invention provides a kind of method based on the lucky raw round-grained rice 2 of foreign gene flanking sequence identification transgenic paddy rice, and phase
The primer answered, and the nucleotide sequence of the lucky raw No. 2 specific PCR amplified fragments of round-grained rice of homozygous transgenic rice is provided.
In order to realize the purpose of the present invention, 3 of a kind of lucky raw round-grained rice 2 of detection transgenic pest-resistant rice strain of the invention
Specific primer, it includes：
Forward primer SEQIDNO.1:ACGAGACATGGCAAAGTTTGATT,
Reverse primer SEQIDNO.2:CGCGCTTAAAGATATACAAACCA,
T-DNA specific primers SEQIDNO.3:TAATGTGTGAGTAGTTCCCAGATAAG.
3 primers are the flanking sequences based on lucky raw No. 2 foreign genes of round-grained rice of transgenic pest-resistant rice strain and designed
Primer, its forward primer and reverse primer are designed according to Rice Genome Sequence, and positioned at No. 1 chromosome of rice, (GenBank is registered
Number：NC_008394.4 41607255-41607277bp and 41608280-41608258bp positions), T-DNA specific primers
Designed according to T-DNA left margins regional sequence, positioned at T-DNA left margin 338-313bp sections.Specifically expanded using the primer
Polymerase chain amplification (PCR) is carried out under the conditions of increasing, with the genome of the lucky raw round-grained rice 2 of homozygous transgenic insect-proof rice strain
DNA is that template can amplify a short-movie section SEQIDNO.4 (446bp), lucky raw with heterozygous transgenic insect-proof rice strain
The genomic DNA that round-grained rice 2 is that template amplification goes out two bar segments (1026bp and 446bp), with the genomic DNA of non-transgenic rice
Go out a PCR band (1026bp) for template amplification.
The present invention provides the lucky raw round-grained rice 2 of identification transgenic pest-resistant rice strain based on the foundation of foreign gene flanking sequence
Method, including step：1) Plant Genome is extracted；2) using the genome of step 1) as template, entered using above-mentioned specific primer
Performing PCR detects.
PCR reaction conditions are preferably：94℃2min；94 DEG C of 20s, 55 DEG C of 40s, 35 circulations；72℃10min.
PCR reaction systems are preferably：：2 μ l 200ng/ μ l templates, health are (to contain 2 × Es of century Taq MasterMix
Es Taq DNA Polymerase,PCR buffer,3mM MgCl2, 400uM dNTP mix), 1 10 μM of μ l forward primers, 1
10 μM of reverse primers of μ l, 1 μ l T-DNA specific primers, mend ddH2O to 20 μ l.
The present invention establishes the identification side of the lucky raw round-grained rice 2 of transgenic pest-resistant rice strain based on foreign gene flanking sequence first
Method, and the homozygous or heterozygous of foreign gene can be identified, the sieve available for detection GMOs with standard substance candidate
Choosing identification, guarantee is provided for Transgene-safty.During genetically modified crops genetic breeding, it is necessary to by transgenic line and its
Its material is hybridized, transformation to obtain suitable cultivar, using molecular biology method is quick, easy identification is homozygous
Body/heterozygote breeding material, be advantageous to shorten breeding process, laid a good foundation for follow-up genetically modified crops genetic breeding.
Brief description of the drawings
Fig. 1 is amplification of the present invention by PCR in rice；Wherein, M：100bp DNA ladder；1：Blank pair
According to；2：Non-transgenic rice Ji round-grained rice 88；3：The lucky raw round-grained rice 2 of the japonica rice strain of foreign gene heterozygosis；4：The homozygous round-grained rice of foreign gene
The lucky raw round-grained rice 2 of rice strain.
Embodiment
Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.
The experimental method of unreceipted actual conditions in following examples, generally according to normal condition, such as Sambrook etc.
's《Molecular cloning：Laboratory manual》(New York：Cold Spring Harbor Laboratory Press, 2001) in
Described condition, or the condition proposed by according to instrument or reagent manufacturer.Agents useful for same and material are commercial goods.
Embodiment
Using primer, wherein forward primer is SEQIDNO.1:ACGAGACATGGCAAAGTTTGATT, reverse primer are
SEQIDNO.2:CGCGCTTAAAGATATACAAACCA, T-DNA specific primer are SEQIDNO.3:
TAATGTGTGAGTAGTTCCCAGATAAG, enter performing PCR amplification and identify whether testing sample is transgenic pest-resistant rice japonica rice product
The lucky raw round-grained rice 2 of system, and the homozygosis or heterozygous state of foreign gene can be identified.
1. experiment material
1.1 vegetable material
The lucky raw round-grained rice 2 of transgenic pest-resistant rice strain, non-transgenic rice Ji round-grained rice 88.
1.2 enzyme and reagent
Molecular biology reagents, health be 2 × Es of century Taq MasterMix (containing Es Taq DNA Polymerase,
PCR buffer,3mM MgCl2, 400uM dNTP mix), 100bp DNA Ladder Marker are purchased from Takara.
Other biochemical reagents are that import packing or domestic analysis are pure.Primer is closed by Shanghai Sheng Gong Bioisystech Co., Ltd
Into.
1.3 laboratory apparatus
DNA process instrumentations：Low-temperature mixed ball milling instrument MM400 (Retsch)；
PCR amplification instrument：BioRAD(AB Applied Biosystems veriti 96well Thermal Cycler
(AB))；
Nucleic acid electrophoresis apparatus：DYY-11 types nucleic acid electrophoresis apparatus (Liuyi Instruments Plant, Beijing)；
DNA electrophoretic analysis systems：GeneSnap Labworks image acquisition and analysis softwares；
Other Instruments includes：Thermostat water bath, electronic balance, centrifuge, vortex instrument, pure water meter, constant incubator etc..
2. experimental method
The extraction of 2.1 oryza sativa genomic dnas
Rice single-strain planting, young leaflet tablet is taken to extract material as DNA, with DNA sample extract solution [200mM Tris-HCl
(pH7.6), 25mM EDTA, 250mM NaCl, 0.5%SDS] carry out oryza sativa genomic dna extraction.
A. the fresh blade 100mg of rice is weighed, scissors, which shreds, to be fitted into 2ml centrifuge tubes, is put into precooling in liquid nitrogen, is used low temperature
Mixing and ball milling instrument is fully broken.500 μ l DNA sample extract solutions, jog 20s are added, 60 DEG C of water-baths place 30min fully to take out
DNA is carried, interval is shaken.
B. 500 μ l chloroforms are added, jog 10min, 12,000rpm centrifugation 5min, supernatant are moved in new centrifuge tube.
C. the isopropanol of 1/2 volume is added, is gently mixed, -20 DEG C of placement 1h, now it is possible that flocculent deposit.
D. by the solution of gained or flocculent deposit, 10,000rpm centrifugation 5min, waste liquid is abandoned, is placed in room temperature placement
20min, thoroughly to dry precipitation.
E. plus 50-100 μ l TE buffer solutions, 37 DEG C of placement 2-5min, with thorough dissolving DNA, are saved backup under the conditions of 4 DEG C.
2.2DNA concentration and purity testing
Using NanoDrop2000 spectrophotometers (Thermo Scientific) measure DNA purity and concentration, it is used in combination
Deionization distilled water adjusts DNA concentration to 100ng/ μ l.
2.3 polymerase chain amplifications (PCR)
According to 5 ' the end flanking sequences for utilizing chromosome walking method to obtain in previous work, sequence ratio is carried out with NCBI
To analysis, it is determined that insertion points of the T-DNA comprising foreign gene in rice genome, i.e. No. 1 dyeing of rice genome
Body (GenBank registration numbers：NC_008394.4 at 41607441bp), and detect that T-DNA left margin sequences lost
1-77bp regions.From insertion point both sides, design forward and reverse primer is used to expand the specific fragment of non-transgenic reference,
T-DNA specific reverse primers are designed in T-DNA left margins section and are amplified with the forward primer on the left of insertion point and turned base
Because of rice specific fragment.Wherein forward primer is located on the left of the insertion point in rice genome and apart from insertion point
186bp, reverse primer is located on the right side of insertion point and apart from insertion point 839bp, therefore can amplify non-transgenic reference
Specific 1026bp fragments, T-DNA specific primers are in the left margin section close to T-DNA from being with a distance from left margin
338bp, due to lost T-DNA left margin 1-77bp regions, therefore T-DNA specific primers amplify length with forward primer
For 446bp transgenic paddy rice specific amplification fragment SEQIDNO.4.
Forward primer is:ACGAGACATGGCAAAGTTTGATT, reverse primer are:
CGCGCTTAAAGATATACAAACCA, T-DNA specific primer is:TAATGTGTGAGTAGTTCCCAGATAAG.
PCR amplification system is：Total system 20l, health are (to contain Es Taq in the μ l of 2 × Es of century Taq MasterMix 10
DNA Polymerase,PCR buffer,3mM MgCl2, 400uM dNTP mix), each 1 μ l of primer (10 μM), paddy DNA 2
μ l (100ng/ μ l), residue ddH2O is supplied.
PCR amplification programs：94℃1min；94 DEG C of 10s, 55 DEG C of 1min, 35 circulations；72℃10min.
3. experimental result
According to lucky raw No. 25 ' the end flanking sequences of round-grained rice of transgenic pest-resistant rice strain, with the BLAST instruments in ncbi database
The insertion point that T-DNA is determined in lucky raw No. 2 genomes of round-grained rice is compared.It is raw in Ji according to fixed insertion point
Forward primer and reverse primer are devised in the genome of No. 2 insertion point both sides of round-grained rice, specificity is devised at T-DNA 5 ' ends
Primer.By 3 primer PCR methods, in non-transgenic rice Ji round-grained rice 88, the lucky raw round-grained rice 2 of homozygous transgenic rice strain, miscellaneous
Expanded in lucky raw No. 2 genomic DNAs of round-grained rice of mould assembly transgenic rice lines, can rapidly and accurately amplify lucky raw round-grained rice 2
Specific fragment and non-transgenic reference specific fragment, therefore can identify whether testing sample is lucky raw round-grained rice 2, and
Also the homozygosis or heterozygous state of lucky raw round-grained rice 2 can be identified.Extension of time is defined to 40S by we in PCR amplification programs, because
The of length no more than 2Kb of this amplified production.PCR results can only amplify one in the lucky raw round-grained rice 2 of homozygous transgenic rice
446bp fragment；Two bar segments are amplified in the lucky raw round-grained rice 2 of heterozygous transgenic rice, a silver segment length is that 1026bp is (non-
Transgenic paddy rice specific fragment), another silver segment length is 446bp (lucky raw No. 2 specific fragments of round-grained rice)；And non-transgenic water
A 1026bp fragment is only amplified in rice.Amplification is as shown in figure 1, wherein Ago-Gel concentration is 1%.
Forward and reverse sequencing has been carried out to the Specific PCR fragments (446bp) of the lucky raw round-grained rice 2 of homozygous transgenic rice, led to
Analysis is crossed, the PCR fragment includes the partial sequence (190-446bp in SEQ ID NO.4) of conversion carrier, and rice genome sequence
Arrange (1-189bp in SEQ ID NO.4).This section of sequence and original lucky raw No. 2 sides of round-grained rice using chromosome walking method measure
Sequence is completely the same, and insertion point of the foreign gene in rice genome is also with utilizing the determination of chromosome walking method
As a result it is completely the same, illustrate that it is homozygous transgenic to design 3 primers to enter the DNA fragmentation that performing PCR amplifies based on flanking sequence
The specific fragment of the lucky raw round-grained rice 2 of rice, rather than non-specific amplification fragment.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Claims (1)
1. a kind of method based on the lucky raw round-grained rice 2 of foreign gene flanking sequence identification transgenic paddy rice, special using lucky raw round-grained rice 2
Property primer combination and specific PCR reaction condition enter performing PCR detection, it is characterised in that：
Primer：Forward primer SEQ ID NO.1, reverse primer SEQ ID NO.2 and T-DNA specific primer SEQ ID NO.3；
PCR reaction conditions are：94℃ 2min ；94 DEG C of 20s, 55 DEG C of 40s, 35 circulations；72℃ 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510381819.1A CN105039526B (en) | 2015-07-02 | 2015-07-02 | Method based on the lucky raw round-grained rice 2 of foreign gene flanking sequence identification transgenic paddy rice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510381819.1A CN105039526B (en) | 2015-07-02 | 2015-07-02 | Method based on the lucky raw round-grained rice 2 of foreign gene flanking sequence identification transgenic paddy rice |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105039526A CN105039526A (en) | 2015-11-11 |
| CN105039526B true CN105039526B (en) | 2018-04-10 |
Family
ID=54446491
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510381819.1A Expired - Fee Related CN105039526B (en) | 2015-07-02 | 2015-07-02 | Method based on the lucky raw round-grained rice 2 of foreign gene flanking sequence identification transgenic paddy rice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039526B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105755164B (en) * | 2016-05-18 | 2019-01-29 | 中国农业科学院生物技术研究所 | Identify bivalent anti-herbicide gene cotton GGK2 molecular labeling and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102162012A (en) * | 2010-04-29 | 2011-08-24 | 中国水稻研究所 | Qualitative PCR detection method for transgenic rice kefeng No. 6 |
| CN103834736A (en) * | 2014-03-06 | 2014-06-04 | 中国农业科学院生物技术研究所 | PCR (Polymerase Chain Reaction) detection primer in homozygous/heterozygous state of exogenous gene of transgenic rice Kefeng No.2, detection method and kit |
-
2015
- 2015-07-02 CN CN201510381819.1A patent/CN105039526B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102162012A (en) * | 2010-04-29 | 2011-08-24 | 中国水稻研究所 | Qualitative PCR detection method for transgenic rice kefeng No. 6 |
| CN103834736A (en) * | 2014-03-06 | 2014-06-04 | 中国农业科学院生物技术研究所 | PCR (Polymerase Chain Reaction) detection primer in homozygous/heterozygous state of exogenous gene of transgenic rice Kefeng No.2, detection method and kit |
Non-Patent Citations (2)
| Title |
|---|
| oryza sativa japonica group genomic dna, cheomosome 1, pac clone: p0004d12，genbank：AP003433，138136bp dna linear;sasaki t等;《ncbi genbank》;20080216;1-35 * |
| the genome sequence and structure of rice chromosome 1;sasaki t等;《nature》;20021231;第420卷(第6913期);312-316 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105039526A (en) | 2015-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106282394B (en) | Method for high-throughput detection of southern rust resistance genotyping of corn and kit thereof | |
| Ribaut et al. | Use of STSs and SSRs as rapid and reliable preselection tools in a marker-assisted selection-backcross scheme | |
| CN109468315B (en) | Rice flooding-resistant gene Sub1 codominant molecular marker and application thereof | |
| KR101680570B1 (en) | Single nucleotide polymorphism marker for discerning purple cabbage cultivar and uses thereof | |
| CN107447026B (en) | Specific molecular marker primer for identifying brown planthopper resistant gene BPH3 genotype of rice and application thereof | |
| CN106521021A (en) | Gene marker for identifying haplotype of rice grain width and grain weight GS5 gene and application | |
| CN107988414B (en) | dCAPS marker for auxiliary detection of soybean hundred-grain weight and application thereof | |
| CN103131758B (en) | Method of identifying homozygotic type transgenosis insect resistant rice strain TT51-1 | |
| CN117106967A (en) | Functional KASP molecular marker of rice blast resistance gene and application thereof | |
| CN112442547A (en) | Development and application of SNP molecular marker of rice blast resistance gene Pita | |
| CN105039526B (en) | Method based on the lucky raw round-grained rice 2 of foreign gene flanking sequence identification transgenic paddy rice | |
| CA2879860C (en) | Endpoint zygosity assay to detect rf4 gene in maize | |
| CN114480718B (en) | Primer group and detection kit for rice high temperature resistant genotyping based on KASP technology and application of primer group and detection kit | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN113637790B (en) | KASP molecular marker of stripe rust resistance gene YrAS2388R, primer, kit and application | |
| CN112609018B (en) | SNP molecular marker of rice grain type related gene GLW2 and application thereof | |
| CN103014136B (en) | Homozygous Ke-Ming-Dao 1 identification method established based on exogenous gene flanking sequence | |
| CN114214448A (en) | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof | |
| KR101464247B1 (en) | Single nucleotide polymorphism marker for selecting fusarium wilt-resistant or sensitive cabbage cultivar and uses thereof | |
| KR20180060624A (en) | Snp markers for discrimination of raphanus sativus | |
| Li et al. | Identification of a nuclear-recessive gene locus for male sterility on A2 chromosome using the Brassica 60 K SNP array in non-heading Chinese cabbage | |
| CN109161605B (en) | Development and application of SNP molecular marker of rice blast resistance gene Pi1 | |
| CN105754996B (en) | The flanking sequence of the lucky raw 3 extra source Insert Fragment of round-grained rice of transgenic paddy rice | |
| CN103014133B (en) | Primers for identifying homozygotic type transgene insect resistance rice oryza sativa L 1 | |
| CN109652578B (en) | Method for high-throughput detection of maize head smut resistance genotyping and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180410 Termination date: 20210702 |