CN105671183A - Molecular marker for rice amylose content micro-control genes AGPL3 and application of molecular marker - Google Patents
Molecular marker for rice amylose content micro-control genes AGPL3 and application of molecular marker Download PDFInfo
- Publication number
- CN105671183A CN105671183A CN201610184348.XA CN201610184348A CN105671183A CN 105671183 A CN105671183 A CN 105671183A CN 201610184348 A CN201610184348 A CN 201610184348A CN 105671183 A CN105671183 A CN 105671183A
- Authority
- CN
- China
- Prior art keywords
- agpl3
- rice
- amylose content
- molecular marker
- fine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Botany (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a molecular marker AGPL3-m for rice amylose content micro-control genes AGPL3. The molecular marker is characterized in that paddy rice is used as a species, primers of the molecular marker are selectively primer pairs, nucleotide sequences are 5'->3', the molecular marker AGPL3-m in a forward direction is shown as GAAGATAGACGACACAGGAAGAGT, and the molecular marker AGPL3-m in a reverse direction is shown as ACTGAAATTGAGGTTTGGCAT. The invention further discloses application of the molecular marker AGPL3-m. The molecular marker AGPL3-m can be used for identifying rice amylose contents of the paddy rice and/or assisting in selectively breeding progenies of the paddy rice. Single plants, with banding patterns consistent with Nipponbare banding patterns, of the progenies are selected for breeding when the progenies are progenies of Nipponbare indica rice.
Description
Technical field
The invention belongs to agricultural biotechnology engineering, particularly relevant with rice grain amylose content controlling gene AGPL3 pointSub-mark and application thereof.
Background technology
High yield, high-quality are the long-term targets of pursuing of rice breeding always. Through long-term effort, the especially profit of hybrid paddy rice technologyWith, China has obtained universally acknowledged achievement in Rice Production. But because the past how solving having enough to eat and wear of people asks alwaysTopic is placed above the other things, so the emphasis major part of rice breeding work concentrates on the cultivation of new high-yielding rice varieties, thereby causes excellentThe breeding of matter rice seriously lags behind, particularly the general deviation of hybrid paddy rice quality of some high yields.
Causing another slower main cause of grain quality improving progress is complexity and the traditional breeding method means of rice quality heredityLimitation. The quality trait of rice comprises that exterior quality, processing quality, cooking quality, nutritional quality and Cooking Quality etc. are allMany-side, and Rice Cooking is the most important index of evaluating rice quality. Cooking quality refers to rice institute in digestion processThe characteristic showing, mainly by amylose content (AmyloseCOntent, AC), glue denseness (GelConsistency，GC), gelatinization point (GelatinizationTEmperature, GT) three physical and chemical indexs evaluate, and wherein AC affects riceThe topmost physical and chemical index of quality. Breeding scholar and geneticist have done a large amount of work to seek the science of heredity basis of rice AC,But the result of different experiments chamber has larger difference. Early stage research shows that rice AC is by a major gene resistance control,And be subject to the regulation and control [1,2] of other minor effects QTL. Research subsequently find Waxy (Wx) for rice AC number have certainlyAct on qualitatively, may control exactly the major gene resistance [3-5] of AC. Except dying on body and detect 1 main effect QTL the 6th,Minor effect QTL number and position that different research detects are very inconsistent. For example, Tan etc. detects on the 1st, 2 chromosomesTwo minor effect QTLs[6], He etc. have detected a minor effect QTL[6 at the 5th chromosome], Aluko etc. dye the 3rd and 8Minor effect QTLs[7 on colour solid, detected respectively]. Huang Zuliu etc. study and find except the 6th chromosomal Wx gene loci,Also a main effect QTL of controlling rice AC detected at the 3rd chromosome; Other 5 minor effect QTLs lay respectively at the 4th, 4,6, on 9,11 chromosomal different seats [8]. Other laboratories have also detected and have controlled AC's at the 4th, 6,7 chromosomesQTLs[9]. Wu Changming etc. do not find the QTL site relevant with AC on the 6th chromosome, just the 1st, and 7,8,On 9,12 chromosomes, find 5 QTL sites [10].
Causing another slower main cause of grain quality improving progress is the limitation in traditional breeding method means. Traditional breeding method sideMethod is mainly that favo(u)rable target proterties is carried out to orientation is selected and fixing, cultivates improved Varieties, this tool bear the character of much blindness andUnpredictability [11]. And the method for individual choice is that the economical character to meeting breeding objective is directly selected, i.e. choosingWhat select is individual phenotype instead of genotype. Owing to having one between gene because of multiple-effect, many because of an effect, controlling gene and modificationThe effect of gene etc., often there is larger difference in individual Phenotype and genotype, thereby carries out individuality by field phenotypic characterThe accuracy of selecting is poor. Molecular marker assisted selection (Marker-assistedSElection, MAS) technology carries to rice breedingSupply new approach, combined with traditional breeding technology and can greatly improve breeding efficiency, shortened breeding cycle. The core of MAS isPhenotypic Selection in conventional breeding is converted into genotype and selects, it has directly reflected and the sequence difference of DNA has not been subject to gene tableThe impact reaching, result reliability is strong, and is not subject to the growth and development stage of plant and the impact of environmental condition [12].
The bibliography above relating to is as follows:
1.BollichC.W.,BD.Inheritanceofamyloseintwohybridpopulationsofrice.CerealChem.1973,50,631-636 (BollichC.W., the heredity at two hybrid Populations of BD. amylose content. cerealLearn .1973,50:631-636);
2.McKenzieK.R.,JN.Geneticanalysisofamylosecontent,alkalispreadingscore,andgrainDimensionsinrice.CropSci.1983, (McKenzieK.R., JN. content of amylose in rice, alkali disappear 23,306-311The genetic analysis of value and Grain Morphology. crop science .1983,23:306-311);
3.SanoY.Differentialregulationofwaxygeneexpressioninriceendosperm.Theor.Appl.Genet.1984,68,467-473 (the difference regulation and control that SanoY. paddy endosperm waxy gene is expressed. the theoretical and hereditary .1984 of application,68:467-473)；
4.KumarI.K.,GS.Juliano,BO.Geneticanalysisofwaxylocusinrice(OryzasativaL.).Theor.Appl.Genet.1987,73,481-488 (KumarI.K., GS.Juliano, BO. paddy endosperm waxy gene siteGenetic analysis. theoretical and application hereditary .1987,73:481-488);
5.KumarI.K.,GS.Inheritanceofamylosecontentinrice(OryzasativaL.).Euphytica1988,38,261-269 (KumarI.K., the heredity of GS. content of amylose in rice. European plant is learned .1988,38:261-269);
6.TanY.F.,LiJ.X.,YuS.B.,etal.Thethreeimportanttraitsforcookingandeatingqualityofricegrainsarecontrolledbyasinglelocusinanelitericehybrid,Shanyou63.Theor.Appl.Genet.(YuS.B., etc. three of. excellent hybrid paddy rice Shanyou 63 rice cooking and eating quality for TanY.F., LiJ.X. for 1999,99,642-648Important indicator is subject to unit point control. theoretical and application hereditary .1999,99:642-648);
7.AlukoG.,MartinezC.,TohmeJ.,etal.QTLmappingofgrainqualitytraitsfromtheinterspecificcrossOryzasativaxO.glaberrima.Theor.Appl.Genet.2004,109,630-639(AlukoG.,MartinezC., TohmeJ., the QTL etc. Rice Kernel proterties in Asian Cultivated Rice and African cultivated rice interspecific hybridization colony is fixedPosition. theoretical and application hereditary .2004,109:630-639.);
8. yellow ancestral six, and Tan Xuelin, TragoonrungS., the molecular labeling location of etal. rice grain amylose content gene locus.Acta Agronomica Sinica 2000,26,777-782;
9.LancerasJ.C.,HuangZ.L.,NaivikulO.,etal.MappingofgenesforcookingandeatingqualitiesinThaijasminerice(KDML105).DNARes.2000,7,93-101(LancerasJ.C.,HuangZ.L.,NaivikulO., etc. gene mapping .DNA research .2000, the 7:93-101 of THAI Fragrant rice cooking and eating quality);
10. Wu is kept burning day and night, Sun Chuanqing, and Chen Liang, etc. QTL and the correlation thereof of content of amylose in rice and Xian round-grained rice degree of differentiationResearch. China Agricultural University's journal 2000,5,6-11;
11. Li Zhi health. the strategy of China's Rice molecular breeding plan. Molecular Plant Breeding 2005,3,603-608;
12. Feng builds up. the application of Molecular Marker Assisted Selection Technology on rice breeding. Chinese agronomy circular 2006,22,43-47。
Separately, the invention of the patent No. 201310586095.5 " rice grain amylose content micro-control gene GBSSII molecular labeling and shouldWith ", 201310585846.1 invention " molecular labeling and the application of rice grain amylose content micro-control gene SSIVb ",201310581339.0 invention " rice grain amylose content micro-control Gene A/G PS2a molecular labeling and application " has provided someThe molecular labeling relevant with rice starch synthetic gene, above-mentioned GBSSII-m, SSIVb-m and the AGPS2a-m of being labeled as, theseMark is minor gene, in reality, finds, minor gene polymerization is more, and choice accuracy will be higher, so exploitation is moreThe gene that amylose content minor gene or contribution rate are larger, seems particularly important.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of molecular labeling and the use thereof relevant with rice starch synthetic gene AGPL3On the way, the molecular labeling AGPL3-m of gained of the present invention is the genetic marker of rice grain amylose content micro-control Gene A/G PL3, can useIn amylose content of rice qualification and/or its offspring's assisted selection.
In order to solve the problems of the technologies described above, the invention provides a kind of and gene mark rice grain amylose content micro-control Gene A/G PL3Note, using paddy rice as species, this molecular labeling primer is selected from following primer pair, and nucleotides sequence wherein classifies 5 ' → 3 as ',
AGPL3-m forward: GAAGATAGACGACACAGGAAGAGT
Reverse: ACTGAAATTGAGGTTTGGCAT.
The present invention also provides the purposes of above-mentioned molecular labeling AGPL3-m simultaneously: for amylose content of rice qualification and/ or its offspring's assisted selection.
Improvement as the purposes of molecular labeling AGPL3-m of the present invention: for example, when being that Japan fine (japonica rice) and long-grained nonglutinous rice (are spyBlue or green, 93-11) offspring time, select the banding pattern individual plant consistent with Japanese fine banding pattern in offspring to be used for breeding.
Remarks explanation:
The sequence of the molecular labeling AGPL3-m of primer AGPL3-mPCR amplification gained in Japan is fine is:GAAGATAGACGACACAGGAAGAGTTATCGCATTTAGTGAAAAACCAAAAGGAGATGATTTAAAGGCAATGGTAGGTCATATATGTTTATTCATACGGGAATGGATTCTAAACCCTCGAG GGGATATCCCCTCGTATATCTTTTTCTTTCAAATTCGATACAAATAGTTATGAAAAAATCTGAAAAAAATTGACAATGTAGAGTATAATGATACCTACTAATCCACCAAAATTCAAGTTCAAATTCGATCTACACATCGAGAAACAAAAAAGACAAATTTAGATATAAACAGTACGCTACTATTCATATGCTGAATTTGTCTTTTTTATATCTCGATGTGTGAGTTGAGTTTGGACTTAAGATTTTGTGGAGTTGTATATATGTGTTGTATGAATGTTGTTAAATTTTTCCAGAATTTTTCATAACCGTTTAGATGGTTTTTAGGTAAACGAGGGAACATCCCCTCGAGGGATTAGAATAGTTTCCCTATTCATACCACCCATCTGTCCTATGTACATATTGGAATCATATTCTAGATGGCCCAATGCACCAGTTAGTGCTGCACACAAAGAAAATAACTGATAATTTCATCAGACATTCTTTATTTTTCTTTGTGCAGCAAGTTGACACCACTGTTCTAGGCTTACCACAGGATGAAGCAAAAGAGAAGCCATACATAGCGTCAATGGGGGTTTATATATTTAAGAAAGAGATACTTCTAAATCTTTTGAGGTATGCCAATTCAACTCAATGGAGCTCACATAAAAATTCAGTAAAATGCTCCATTTAATCATCTGACTATAAAGTGTACTTTCATTCTAATGCCAAACCTCAATTTCAGT；
The sequence of the molecular labeling AGPL3-m of primer AGPL3-mPCR amplification gained in special green grass or young crops is:GAAGATAGACGACACAGGAAGAGTTATCGCATTTAGTGAAAAACCAAAAGGAGATGATTTAAAGGCAATGGTAGGTCATATATGTTTATTCATACCACTCATCTGTCCTATGTACATATTGGAATCATATTCTAGATGGCCCAATGCACCAGTTAGTGCTGCACACAAAGAAAATAACTGATAATTTCATCAGACATTCTTTATTTTTCTTTGTGCAGCAAGTTGACACCACTGTTCTAGGCTTACCACAGGATGAAGCAAAAGAGAAGCCATACATAGCGTCAATGGGGGTTTATATATTTAAGAAAGAGATACTTCTAAATCTTTTGAGGTATGCCAATTCAACTCAATGGAGCTCACATAAAAATTCAGTAAAATGCTCCATTTAATCATCTGACTATAAAGTGTACTTTCATTCTAATGCCAAACCTCAATTTCAGT。
The development approach of molecular labeling of the present invention, comprises the following steps:
1), using japonica rice variety Japan fine as low amylose content gene donor parents with carry out as the spy green grass or young crops of high amylose starchesHybridize, backcross and selfing, thereby obtain the individual plant as offspring's rice low amylose content;
2), extract by CTAB (cetyltriethylammonium bromide, HexadecyltrimethylammoniumBromide) methodParental rice seedling and filial generation seedling genomic DNA;
3), adopt Indel (insertion/deletion fragment, insertion/deletions) molecule labelling method to carry out rice low amyloseThe screening of content gene mark;
4), develop an Indel molecular labeling AGPL3-m.
The molecular labeling AGPL3-m relevant with rice low amylose content, specifically obtains by following method:
1), according to the nucleotide sequence of Gene A/G PL3, design, development Indel molecular labeling, for detection of low amyloseThe special blue or green polymorphism of the warm and fine high amylose content of content Japan; By order-checking further to determine primer AGPL3-m intervalThe difference of sequence between the spy green grass or young crops of the warm and fine high amylose content of Japan of low amylose content; By hybridizing, backcross and oneselfKnot is closed marker assisted selection, obtains the paddy rice new germ plasm of the low amylose content of special blue or green background;
2), extract parental rice seedling and filial generation seedling genomic DNA by CTAB method;
3), adopt Indel molecule labelling method to carry out the genetic marker screening low amylose content of rice low amylose contentPaddy rice new germ plasm;
4), identify an Indel molecular labeling AGPL3-m, through polymorphic detection, find itself and rice grain amylose contentBe associated.
Adopt method that Indel molecular labeling AGPL3-m carries out rice grain amylose content screening specifically:
(1), Indel is marked at the DNA polymorphism analysis between the warm and fine special green grass or young crops of high and low rice grain amylose content kind Japan:
According to the nucleotide sequence of Gene A/G PL3, design, development Indel molecular labeling AGPL3-m, for detection of low straight chainPolymorphism between the spy green grass or young crops of the warm and fine high amylose content of Japan of content of starch. Primer entrusts Shanghai Shen Neng betting office synthetic,In the enterprising performing PCR amplification of PTC-225PCR instrument, PCR reaction system is: 20ng/ul oryza sativa genomic dna 1ul, 10 × PCRBuffer2.0ul，25mMMgCl22.0ul, 2mMdNTP2.0ul, 10uM primer 2 .0ul, 5U/ulTaqDNA is poly-Synthase 0.2ul, ddH2O10.8ul, total system 20ul. Response procedures: 95 DEG C of sex change 5 minutes; 94 DEG C of sex change 1 minute, 55 DEG CAnneal 1 minute, 72 DEG C are extended 1 minute, 40 circulations; 72 DEG C of polishings 10 minutes; Product detects: containing 0.5%ug/ul4.0% the agarose gel electrophoresis of EB, observes and film recording result under uviol lamp.
(2), the sequence of interval of Indel mark AGPL3-m is between the warm and fine special green grass or young crops of low, high rice grain amylose content kind JapanGenome sequence difference:
According to the Indel molecular labeling AGPL3-m obtaining, for the warm and fine Gao Zhi of pcr amplification low amylose content kind JapanThe special blue or green genome sequence of chain content of starch kind, pcr amplification product entrusts Shanghai Ying Jun Bioisystech Co., Ltd to check orderAnalyze. Pcr amplification carries out with reference to above-mentioned (1), and the recovery of PCR product selects Beijing hundred Tyke Bioisystech Co., Ltd to developPCR product reclaims kit (centrifugal column type, catalog number (Cat.No.): DP1403).
(3), utilize Indel mark AGPL3-m to carry out the assisted selection of low amylose content
The genetic donor parent Japan of low amylose content is fine, hybridizes with the special green grass or young crops of rice variety of high amylose content,By backcrossing, selfing incorporation of markings assisted Selection, low amylose content gene AGPL3 fine Japan is imported to high straight chain and forms sedimentIn the spy green grass or young crops of powder content, select the banding pattern individual plant consistent with Japanese fine banding pattern in segregating population to be used for breeding improvement, obtained someThe material of the fine AGPL3 gene of band Japan of the special blue or green background of part; Gather in the crops the seed of tying on these plant, detect its amylose and containAmount, finds that its amylose content significantly reduces.
Amylose content height is the inferior main factor of rice quality. The present invention adopts molecular biology method to form sediment with low straight chainJapan of powder content is fine is material, develops and screens the new and stable molecular labeling that can reduce rice grain amylose contentAnd method, for the assisted selection of fine quality rice; Because material used can effectively reduce the amylose of general riceContent, its improvement to China's rice quality has generality.
The invention the Indel mark AGPL3-m of rice starch synthesis related gene AGPL3. Profit in this way, noOnly overcome the shortcomings such as conventional breeding method required time cycle length, can be targetedly by low amylose content base fine JapanBecause AGPL3 selects obtain and on purpose carry out the polymerization of multiple high-qualitys in laboratory, thereby cultivate the paddy rice with high-qualityNew varieties. In the present invention, in the time that Japanese fine band appears in gained plant after testing, we judge that it belongs to low amyloseThe paddy rice of content; In the time that gained plant occurs after testing the band that spy is blue or green or occurs special blue or green+Japanese fine band simultaneously, we judgeIt belongs to the paddy rice of high amylose content.
Marker selection between the applicable most long-grained nonglutinous rice of the present invention (as special blue or green, 93-11) and japonica rice (as fine in Japan).
Therefore, result of the present invention is significant in the practice of paddy rice quality breeding; Its advantage is specifically summarized as follows:
(1) molecular labeling that can regulate and control rice grain amylose content of the present invention is to pass through the japonica rice day of low amylose contentThe special blue or green hybridization of long-grained nonglutinous rice of this fine and high amylose content, backcross, screening obtains in selfing, can significantly reduce rice straight chainContent of starch, and stable existence, can be used for the assisted selection of fine quality rice.
(2) the present invention is based on the nucleotide sequence development of rice starch synthetic gene AGPL3 and the Indel molecule mark that obtainsNote, amylose content molecular labeling GBSSII-m relevant to other, SSIVb-m and AGPS2a-m compare, of the present inventionMark is positioned on the different chromosome of paddy rice, and the effect that mark of the present invention screens is better, and has greatly improved assisted SelectionEfficiency, that is, mark of the present invention can make the effect of assisted selection of rice low amylose content better.
Brief description of the drawings
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is the long-grained nonglutinous rice spy of Indel mark AGPL3-m at the warm and fine high amylose content of japonica rice Japan of low amylose contentBlue or green electrophoretic band figure;
Fig. 2 is the pcr amplification product of the primer AGPL3-m sequence difference between the warm and fine special green grass or young crops of Japan;
Fig. 3 is the electrophoretic band figure of the spy green grass or young crops of 12 parts of low amylose contents of Indel mark AGPL3-m qualification acquisition;
Fig. 4 is the amylose content of 12 parts of materials of mark AGPL3-m assist-breeding;
Symbol in above-mentioned Fig. 1, Fig. 3～4 is explained as follows respectively:
1 representative: the long-grained nonglutinous rice of high amylose content is special blue or green;
2 representatives: the japonica rice Japan of low amylose content is fine;
3 representatives: fine/special blue or green F1 plant of Japan;
4,5,6,7,8,9,10,11,12,13,14,15 all representatives: the warm and fine special blue or green offspring of Japan, through Indel mark AGPL3-mScreening after obtain.
Detailed description of the invention
The warm and fine high amylose content of japonica rice Japan of embodiment 1, use Indel mark AGPL3-m qualification low amylose contentThe special blue or green polymorphism of long-grained nonglutinous rice
Specific practice is: choose rice material Japan warm and fine special blue or green, use warm and fine special blue or green its F1 of hybridization acquisition of Japan, utilize primerAGPL3-m identifies its polymorphism (Fig. 1).
One, extract DNA
1), preparation DNA Extraction buffer:
The DNA that adds successively in order 1 volume extracts solution (0.35Msorbitol; 0.1MTris, pH8.2; 0.005MEDTA;All the other are water), karyorhexis liquid (0.2MTris, the pH7.5 of 1 volume; 0.05MEDTA; 2MNaCl; 0.055MCTAB; Its5% (mass concentration) sarkosyl solution (being the aqueous solution of lauroyl-sarcosine sodium) of Yu Weishui) He 0.4 volume;Finally add sodium hydrogensulfite, be mixed with DNA Extraction buffer; The final concentration of sodium hydrogensulfite in DNA Extraction bufferFor 0.02M.
The preparation method that above-mentioned DNA extracts solution is: at the Tris (three of the sorbitol of 0.35mol (D-sorbite), 0.1molHydroxymethyl aminomethane, pH8.2), the EDTA (ethylenediamine tetra-acetic acid) of 0.005mol adds water and is settled to 1L.
The preparation method of above-mentioned karyorhexis liquid is: at the Tris of 0.2mol (trishydroxymethylaminomethane, pH7.5), 0.05molCTAB (the cetyl trimethyl bromine of NaCl (sodium chloride), 0.055mol of EDTA (ethylenediamine tetra-acetic acid), 2molChange ammonium) adding water is settled to 1L.
2), fine to above-mentioned Japan, special rice leaf blue or green, F1 is handled as follows respectively:
1., take the rice leaf liquid nitrogen grinding powdering of 0.1g, then add the above-mentioned steps 1 of 700 μ l) DNA of preparationExtraction buffer, 65 DEG C of water-baths 40 minutes. Add again the chloroform of 700 μ l: isoamyl alcohol (volume ratio of 24:1), and mix. 10,000Centrifugal 5 minutes of rpm, transfers to supernatant in new centrifuge tube.
2., 1. add the isopropyl alcohol of 2/3～1 times of volume precooling (to 4 DEG C) in the supernatant of centrifugal rear gained in above-mentioned steps, gentlyMix to DNA and precipitate. Centrifugal 8 minutes of 13,000rpm, pours out supernatant.
3., use again the 2. DNA sediment of gained of the 200 μ l washing above-mentioned steps of alcohol of 70% (volumetric concentration).
4., the DNA after above-mentioned washing is dried and is dissolved in 100 μ lTE buffer solutions or pure water.
5., ultraviolet spectrophotometry detects the 4. concentration of the DNA sample of gained of above-mentioned steps, 0.7% agarose gel electrophoresisDetect the integrality of DNA. Complete suitable DNA is for pcr amplification, and incomplete DNA extracts again, until obtainObtain complete DNA.
Two, pcr amplification
1), reaction system:
Oryza sativa genomic dna 20ng/ul1ul, 10 × PCRBuffer2.0ul, 25mMMgCl22.0ul，2mMdNTP2.0ul，The each 1.0ul of 10uM primer, 5U/ulTaqDNA polymerase 0.2ul, ddH2O10.8ul, total system 20ul.
Described primer is: AGPL3-m forward: GAAGATAGACGACACAGGAAGAGT
Reverse: ACTGAAATTGAGGTTTGGCAT;
2), response procedures:
95 DEG C of sex change 5 minutes; 94 DEG C of sex change 1 minute, 55 DEG C of annealing 1 minute, 72 DEG C are extended 1 minute, 40 circulations; 72 DEG CPolishing 10 minutes.
Three, electrophoresis detection
Get amplified production 20ul, Ago-Gel (the containing 0.5%ug/ulEB) electrophoresis with 4.0%, observes under uviol lamp and shinesRecord mutually result. As shown in Figure 1.
In Fig. 1, Japan is fine is the band of 841bp, and special green grass or young crops is the band of 441bp, the band that " F1 " is 841bp+441bp.
According to Fig. 1, we can draw following conclusion: Indel molecular labeling AGPL3-m can detect special blue or green and Japan fine betweenPolymorphism, and the fine pcr amplification product fragment of Japan be greater than special blue or green, show thus AGPL3-m can be used for special blue or green and dayMolecular Detection between this is fine and offspring's marker assisted selection thereof.
The warm and fine high amylose starches of japonica rice Japan of embodiment 2, use Indel molecular labeling AGPL3-m qualification low amylose contentThe special blue or green sequence difference of long-grained nonglutinous rice of content
Specific practice is: application Indel molecular labeling AGPL3-m carries out PCR expansion to the warm and fine special blue or green genomic DNA of JapanIncrease, amplified production entrusts Shanghai Ying Jun Bioisystech Co., Ltd to check order, relatively the difference (Fig. 2) of its sequence.
One, extract DNA
1), preparation DNA Extraction buffer:
With embodiment 1.
2), the warm and fine special blue or green rice leaf of above-mentioned Japan is handled as follows respectively:
With embodiment 1.
3) pcr amplification
With embodiment 1.
4) recovery of PCR product
The recovery of PCR product selects the PCR product of Beijing hundred Tyke Bioisystech Co., Ltd exploitation to reclaim kit (centrifugal columnType, catalog number (Cat.No.): DP1403), requiring to carry out with reference to the description of product, the PCR product of recovery entrusts Shanghai English fine horse biotechnology to haveLimit company checks order.
According to Fig. 2, we can draw to draw a conclusion: the warm and fine special blue or green AGPL3-m amplified production of Japan exists the base of 400bpDifference (as shown in the underscore in Fig. 2), this is that we can use Indel molecular labeling AGPL3-m to detect that it is polymorphicThe reason place of property is also the hereditary basis that we can be used for its offspring's marker assisted selection.
Embodiment 3, utilize Indel mark AGPL3-m to carry out the assisted selection of low amylose content
Specific practice is: the genetic donor parent Japan of low amylose content is fine, with the rice variety spy of high amylose contentGreen grass or young crops hybridizes successively, backcrosses and selfing, to the assisted Selection of gained offspring binding molecule mark AGPL3-m, selects to separateIn colony, the banding pattern individual plant consistent with Japanese fine banding pattern is used for breeding improvement.
One, extract DNA
1), preparation DNA Extraction buffer:
With embodiment 1.
2), fine to above-mentioned Japan, special rice leaf blue or green, gained offspring is handled as follows respectively:
With embodiment 1.
Two, Indel mark detects
1), pcr amplification
With embodiment 1.
2), electrophoresis detection
With embodiment 1.
Three, Indel molecular labeling AGPL3-m carries out the assisted selection of low amylose content
The genetic donor japonica rice variety Japan special green grass or young crops of common rice variety fine and high amylose content of low amylose content carries outHybridize, backcross and selfing, the assisted Selection of binding molecule mark AGPL3-m, selects banding pattern and Japanese fine band in segregating populationThe individual plant that type is consistent is further used for breeding improvement (Fig. 3), eliminates the special blue or green banding pattern one of banding pattern and high amylose content and makes peace assortedThe individuality of crossed belt type (simultaneously having the warm and fine special leukorrhagia with greenish discharge type of Japan), the rice grain amylose content of breeding material adopts national standard(GB/T15683-2008) detect. Analysis shows, 12 individual plants of the Japanese fine banding pattern of selected band are all than samsara parentBlue or green obviously reduce (Fig. 4) of this spy. This experimental result shows: Indel mark AGPL3-m can be for rice grain amylose contentAssisted selection.
Remarks explanation:
" 4～15 " in Fig. 3 and Fig. 4 are that Japan is warm and fine special blue or green hybridized successively, backcross and selfing obtains, and are choosingsSelect the individual plant of " banding pattern is consistent with Japanese fine banding pattern ".
Test 1, utilize Indel mark AGPL3-m to differentiate rice grain amylose content
Specific practice is: the banding pattern being eliminated in the step 3 of embodiment 3 and the special blue or green banding pattern one of high amylose content are made peaceThe individuality of heterozygosis banding pattern (simultaneously have Japan warm and fine special leukorrhagia with greenish discharge type) is proceeded plantation, by its offspring's Rice Kernel straight chainThe mensuration of content of starch, the further reliability of analyzing molecules mark AGPL3-m assisted Selection.
One, extract DNA
1), preparation DNA Extraction buffer:
With embodiment 1.
2), above-mentioned rice leaf is handled as follows respectively:
With embodiment 1.
Two, Indel mark detects
1), pcr amplification
With embodiment 1.
2), electrophoresis detection
With embodiment 1.
Three, Indel mark AGPL3-m differentiates rice grain amylose content
4 banding patterns of having selected to be at random eliminated in the step 3 of embodiment 3 continue plantation with special blue or green consistent individual plant, through IndelMolecular labeling AGPL3-m detects, and its offspring all shows and special blue or green consistent banding pattern, gathers in the crops respectively these individual plant seeds and measuresIts amylose content. In addition, the random wherein individuality of 1 heterozygosis banding pattern (simultaneously thering is the warm and fine special leukorrhagia with greenish discharge type of Japan) of selectingBe used for continuing plantation, choose at random 16 individual plants in its offspring, Indel molecular labeling AGPL3-m detects and shows, these are 16 years oldIn individual individual plant, there are 4 individual plants to show special leukorrhagia with greenish discharge type, 8 individual plant performance heterozygosis banding patterns, 4 Japanese fine banding patterns of performance, meet 1:2:1Separation relation; After plant to be planted maturation, gather in the crops respectively these individual plants and measure the amylose content of its seed. Table 1 be this 20The amylose content of the Rice Kernel of individual individual plant (strain), 4 individual plants consistent with special leukorrhagia with greenish discharge type all show with special blue or green similarHigh amylose content; And in 16 offspring's individual plants of banding pattern heterozygosis, have 12 similar and special blue or green Gao Zhi of individual plant performanceChain content of starch (wherein, the banding pattern of 4 individual plants shows special leukorrhagia with greenish discharge type, the banding pattern performance heterozygosis banding pattern of 8 individual plants); 4 areThe individual plant of the fine banding pattern of Japan, its amylose content is significantly lower than special blue or green. This experimental result shows: Indel molecular labeling AGPL3-mCan be for differentiating rice grain amylose content.
Table 1. rice grain amylose content and corresponding genotype thereof
Note: in bracket, letter represents the genotype of this individual plant, and T is special leukorrhagia with greenish discharge type, and H is heterozygosis banding pattern, and N is Japanese fine banding pattern.
Comparative example 1, with the very high mark AGPL3-m-1 of the forward and reverse primer homology of AGPL3-m and AGPL3-m-2 (asTable 2, nucleotides sequence wherein classifies 5 ' → 3 as '); Detect according to said method of the present invention, find this two mark amplificationsEffect is very bad, does not have band appearance or non-characteristic band a lot, can not be used for differentiating rice grain amylose content, that is,Can not become rice grain amylose content micro-control gene molecule marker.
Table 2
| Forward | Oppositely | |
| AGPL3-m-1 | ATAGACGACACAGGAAGAGTT | GAAATTGAGGTTTGGCATTAG |
| AGPL3-m-2 | ACAGGAAGAGTTATCGCATTTAGT | TTGAGGTTTGGCATTAGAATG |
Comparative example 2, by 4 kinds of molecular labeling AGPS2a-m, SSIVb-m, GBSSII-m, AGPL3-m as described in Table 3(the present invention) tests according to method described in embodiment 3, and now, the genetic donor parent of low amylose content is still dayThis is fine, and the rice variety of high amylose content has made 93-11 into by special green grass or young crops.
Table 3
| Forward | Oppositely | |
| AGPS2a-m | TCTTCTTTTAGATCTTAAATTTCAGA | CACATCAAAGTTGTAGTTTTGTGA |
| SSIVb-m | ATTTTCCTCAGTAGTAAGCAAGAGTT | AAAACATTGCTCCAAAACAGC |
| GBSSII-m | TGTCAGTCGCTGTCCTCGTA | GATCTCATCCCATGCTAAGTTACT |
| AGPL3-m | GAAGATAGACGACACAGGAAGAGT | ACTGAAATTGAGGTTTGGCAT |
Select the banding pattern individual plant consistent with Japanese fine banding pattern in segregating population, the rice grain amylose content of breeding material adopts countryStandard (GB/T15683-2008) detects.
The result of amylose content in the Japanese fine banding pattern individual plant of selected band compared with recurrent parent 93-11 is as following table 4:
Table 4
The repetition of several times has been carried out in this experiment, and result is all substantially as above described in table 4.
Finally, it is also to be noted that, what more than enumerate is only several specific embodiments of the present invention. Obviously, the present invention is notBe limited to above embodiment, can also have many distortion. Those of ordinary skill in the art can directly lead from content disclosed by the inventionThe all distortion that go out or associate, all should think protection scope of the present invention.
Claims (3)
1. the molecular labeling AGPL3-m of rice grain amylose content micro-control Gene A/G PL3, using paddy rice as species, is characterized in that:Described molecular labeling primer is selected from following primer pair, and nucleotides sequence wherein classifies 5 ' → 3 as ',
AGPL3-m forward: GAAGATAGACGACACAGGAAGAGT
Reverse: ACTGAAATTGAGGTTTGGCAT.
2. the purposes of molecular labeling AGPL3-m as claimed in claim 1, is characterized in that: for amylose content of riceQualification and/or its offspring's assisted selection.
3. the purposes of molecular labeling AGPL3-m according to claim 2, is characterized in that: as the offspring for Japanese warm and fine long-grained nonglutinous riceTime, select the banding pattern individual plant consistent with Japanese fine banding pattern in offspring to be used for breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610184348.XA CN105671183B (en) | 2016-03-28 | 2016-03-28 | Rice amylose content micro-control gene AGPL3 molecular labeling and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610184348.XA CN105671183B (en) | 2016-03-28 | 2016-03-28 | Rice amylose content micro-control gene AGPL3 molecular labeling and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105671183A true CN105671183A (en) | 2016-06-15 |
| CN105671183B CN105671183B (en) | 2019-05-07 |
Family
ID=56224293
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610184348.XA Active CN105671183B (en) | 2016-03-28 | 2016-03-28 | Rice amylose content micro-control gene AGPL3 molecular labeling and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105671183B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591435A (en) * | 2016-11-22 | 2017-04-26 | 南京农业大学 | Molecular marker method for site of low-amylose-content gene of dark endosperm mutant w54 of japonica rice variety Koshihikari |
| CN108424974A (en) * | 2017-11-10 | 2018-08-21 | 浙江省农业科学院 | The Genetic identification and molecular mark method of rice grain amylose content QTL site qSAC3 |
| CN111118201A (en) * | 2020-02-23 | 2020-05-08 | 云南省农业科学院农业环境资源研究所 | Molecular marker closely linked with gene du13(t) for regulating and controlling low amylose content of rice and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103298940A (en) * | 2010-11-04 | 2013-09-11 | 阿里斯塔谷类科技有限公司 | High amylose wheat |
| CN103602675A (en) * | 2013-11-19 | 2014-02-26 | 中国水稻研究所 | Molecular marker of rice amylose content micro-control gene GBSSII and application thereof |
| CN103602674B (en) * | 2013-11-19 | 2015-10-28 | 中国水稻研究所 | The molecule marker of rice amylose content micro-control gene SSIVb and application |
| CN103602673B (en) * | 2013-11-19 | 2015-10-28 | 中国水稻研究所 | Rice amylose content micro-control gene AGPS2a molecule marker and application |
| CN105087573A (en) * | 2015-09-14 | 2015-11-25 | 扬州大学 | Method for identifying rice Wx-mw gene and application of rice Wx-mw gene in high-quality rice breeding |
-
2016
- 2016-03-28 CN CN201610184348.XA patent/CN105671183B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103298940A (en) * | 2010-11-04 | 2013-09-11 | 阿里斯塔谷类科技有限公司 | High amylose wheat |
| CN103602675A (en) * | 2013-11-19 | 2014-02-26 | 中国水稻研究所 | Molecular marker of rice amylose content micro-control gene GBSSII and application thereof |
| CN103602674B (en) * | 2013-11-19 | 2015-10-28 | 中国水稻研究所 | The molecule marker of rice amylose content micro-control gene SSIVb and application |
| CN103602673B (en) * | 2013-11-19 | 2015-10-28 | 中国水稻研究所 | Rice amylose content micro-control gene AGPS2a molecule marker and application |
| CN105087573A (en) * | 2015-09-14 | 2015-11-25 | 扬州大学 | Method for identifying rice Wx-mw gene and application of rice Wx-mw gene in high-quality rice breeding |
Non-Patent Citations (3)
| Title |
|---|
| DALI ZENG等: "Rational design of high-yield and superior-quality rice", 《NATURE PLANTS》 * |
| FU-HAO LU等: "Sequence variations in OsAGPase significantly associated with amylose content and viscosity properties in rice (Oryza sativa L.)", 《GENET. RES., CAMB.》 * |
| 王震等: "稻米淀粉形状的QTLs定位及其淀粉合成相关酶基因的关联性分析", 《浙江农业学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591435A (en) * | 2016-11-22 | 2017-04-26 | 南京农业大学 | Molecular marker method for site of low-amylose-content gene of dark endosperm mutant w54 of japonica rice variety Koshihikari |
| CN108424974A (en) * | 2017-11-10 | 2018-08-21 | 浙江省农业科学院 | The Genetic identification and molecular mark method of rice grain amylose content QTL site qSAC3 |
| CN108424974B (en) * | 2017-11-10 | 2021-09-03 | 浙江省农业科学院 | Genetic identification and molecular marker assisted breeding method for rice amylose content QTL locus qSAC3 |
| CN111118201A (en) * | 2020-02-23 | 2020-05-08 | 云南省农业科学院农业环境资源研究所 | Molecular marker closely linked with gene du13(t) for regulating and controlling low amylose content of rice and application thereof |
| CN111118201B (en) * | 2020-02-23 | 2020-11-03 | 云南省农业科学院农业环境资源研究所 | Molecular marker closely linked with gene du13(t) for regulating and controlling low amylose content of rice and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105671183B (en) | 2019-05-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103602673B (en) | Rice amylose content micro-control gene AGPS2a molecule marker and application | |
| CN109735652B (en) | Wheat stripe rust resistant gene QYr.nwafu-6BL.2 linked KASP molecular marker, primer and application | |
| CN103602674B (en) | The molecule marker of rice amylose content micro-control gene SSIVb and application | |
| CN103602675B (en) | Molecular marker of rice amylose content micro-control gene GBSSII and application | |
| CN108588272B (en) | Molecular marker closely linked with main effect QT L of wheat plant height and ear length characters and application thereof | |
| CN106011287B (en) | The molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 and its application | |
| CN108504773B (en) | Molecular marker of major QTL (quantitative trait loci) site for grain weight and silique length of brassica napus and application of molecular marker | |
| CN105671042A (en) | Molecular marker for rice amylose content micro-control genes SSIII-1 and application of molecular marker | |
| CN109929945A (en) | The molecular labeling BrSF2604 primer and its application in cabbage type rape florescence and maturity period main effect QTL site | |
| CN102586240B (en) | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof | |
| CN105671183A (en) | Molecular marker for rice amylose content micro-control genes AGPL3 and application of molecular marker | |
| CN103865925B (en) | Flag leaf width of rice regulatory gene NAL1 molecule marker and application thereof | |
| AU2020103461A4 (en) | Molecular marker of rice amylose content micro-control gene SSIIIb and application thereof | |
| CN101880723A (en) | Molecular marker of gene for regulating gel consistency of rice and application thereof | |
| CN105838819A (en) | Molecular marker for rice grain amylose content micro-control gene ISA and application thereof | |
| CN105861725A (en) | Molecular marker of rice amylose content micro-control gene AGPL1 and application | |
| CN106048011A (en) | Molecular marker of rice grain AC (amylose content) micro-control gene SSIIIb and application | |
| CN110004242A (en) | The molecular labeling BrSF0239 primer and its application in cabbage type rape florescence and maturity period main effect QTL site | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN112029886B (en) | Single primer molecule identification method of rice low amylose content regulatory gene | |
| CN103160583A (en) | Method for classifying sterile genes RNaseZ of paddy rice temperature-sensitive male nucleus | |
| CN103667484B (en) | Oil content character main gene locus of rape 6F313 and applications thereof | |
| CN101942512B (en) | Development and application of molecule marker for corn with considerable number of kernels and excellent allele function in low-nitrogen adverse environment | |
| CN109913576A (en) | It is a kind of for detecting the primer pair and its application of brown planthopper resistant gene in rice Bph14 | |
| CN104328168B (en) | Molecular marker of rice brown planthopper major gene qBph30(t) and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |