CN105671183B - Rice amylose content micro-control gene AGPL3 molecular labeling and application - Google Patents

Rice amylose content micro-control gene AGPL3 molecular labeling and application Download PDF

Info

Publication number
CN105671183B
CN105671183B CN201610184348.XA CN201610184348A CN105671183B CN 105671183 B CN105671183 B CN 105671183B CN 201610184348 A CN201610184348 A CN 201610184348A CN 105671183 B CN105671183 B CN 105671183B
Authority
CN
China
Prior art keywords
rice
agpl3
amylose content
nipponbare
oryzasativalcv
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610184348.XA
Other languages
Chinese (zh)
Other versions
CN105671183A (en
Inventor
饶玉春
徐江民
曾大力
钱前
胡瑚倩
马路
肖飒清
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang Normal University CJNU
Original Assignee
Zhejiang Normal University CJNU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang Normal University CJNU filed Critical Zhejiang Normal University CJNU
Priority to CN201610184348.XA priority Critical patent/CN105671183B/en
Publication of CN105671183A publication Critical patent/CN105671183A/en
Application granted granted Critical
Publication of CN105671183B publication Critical patent/CN105671183B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses the molecular labeling AGPL3-m of rice amylose content micro-control gene AGPL3 a kind of, using rice as species, the molecular labeling primer is selected from following primer pair, nucleotides sequence therein is classified as 5 ' → 3 ', AGPL3-m is positive: GAAGATAGACGACACAGGAAGAGT, reversed: ACTGAAATTGAGGTTTGGCAT.The present invention further simultaneously discloses the purposes of above-mentioned molecular labeling AGPL3-m: for amylose content of rice identification and/or its offspring's assisted selection.When for the offspring of OryzasativaLcv.Nipponbare and long-grained nonglutinous rice, banding pattern and the consistent single plant of OryzasativaLcv.Nipponbare banding pattern in offspring is selected to be used for breeding.

Description

Rice amylose content micro-control gene AGPL3 molecular labeling and application
Technical field
The invention belongs to agricultural biotechnology engineerings, in particular to have with rice grain amylose content controlling gene AGPL3 The molecular labeling of pass and its application.
Background technique
The target of high yield, high-quality always rice breeding long-sought.By long-term effort, especially hybrid paddy rice technology Utilization, China achieves universally acknowledged achievement in Rice Production.But since how one straight grip of past solves people's Problem of food and clothing is placed above the other things, so the emphasis of rice breeding work is largely focused on the cultivation of new high-yielding rice varieties, from And the breeding of fine quality rice is caused seriously to lag, the universal deviation of hybrid paddy rice quality of especially some high yields.
Another main cause for causing grain quality improving progress slower is the complexity and tradition of rice quality heredity The limitation of breeding technique.The quality trait of rice includes exterior quality, processing quality, cooking quality, nutritional quality and food flavor All various aspects such as quality, and Rice Cooking is the most important index for evaluating rice quality.Cooking quality refers to that rice is steaming The characteristic showed during boiling, mainly by amylose content (Amylose COntent, AC), gel consistence (GelCOnsistency, GC), gelatinization point (Gelatinization TEmperature, GT) three physical and chemical indexes evaluate, Middle AC is to influence the most important physical and chemical index of rice quality.Breeding scholar and geneticist have done a large amount of work to seek rice The genetic base of AC, however the result of different experiments room has biggish difference.Early stage research shows that rice AC is by one A major gene resistance control, and by the regulation of other minor effects QTL [1,2].Subsequent research discovery Waxy (Wx) is for rice AC Number have conclusive effect, may be exactly the major gene resistance [3-5] for controlling AC.1 master is detected on body except contaminating the 6th It imitates outside QTL, the minor effect QTL number and position that difference research detects are very inconsistent.For example, Tan etc. is examined on the 1st, 2 chromosomes Two minor effect QTLs [6] are measured, He etc. detects a minor effect QTL [6] in the 5th chromosome, and Aluko etc. is in the 3rd and 8 dyes Minor effect QTLs [7] are detected on colour solid respectively.The researchs such as Huang Zuliu find other than the Wx gene loci of the 6th chromosome, 3rd chromosome also detects that the main effect QTL of a control rice AC；Other 5 minor effect QTLs are located at the 4th, 4,6,9,11 On the different seats of chromosome [8].Other laboratories have also detected that the QTLs [9] of control AC in the 4th, 6,7 chromosomes.Wu is long Bright wait is not found QTL site related with AC on the 6th chromosome, only finds 5 on the 1st, 7,8,9,12 chromosome A QTL site [10].
Another main cause for causing grain quality improving progress slower is the limitation in traditional breeding method means.Tradition Breeding method is mainly oriented selection and fixation to favo(u)rable target character, cultivates improved Varieties, this has very big Blindness and unpredictability [11].Also, the method for individual choice is carried out directly to the economical character for meeting breeding objective Selection, i.e., selection is individual phenotype rather than genotype.Since there are one between gene because of multiple-effect, mostly because of an effect, regulation base Because and modifier etc. effect, often there is larger difference in individual Phenotype and genotype, thus pass through field phenotype The accuracy that character carries out individual choice is poor.Molecular marker assisted selection (Marker-assisted SElection, MAS) Technology provides new approach to rice breeding, combines with traditional breeding technology and is greatly improved breeding efficiency, shortens breeding Period.The core of MAS is the Phenotypic Selection in conventional breeding to be converted into genotype selection, it directly reflects the sequence of DNA Difference is not influenced by gene expression, and result reliability is strong, and not by the growth and development stage of plant and the shadow of environmental condition It rings [12].
Bibliography involved in above is as follows:
1.Bollich C.W.,BD.Inheritance of amylose in two hybrid populations of Rice.Cereal Chem.1973,50,631-636 (Bollich C.W., BD. amylose content in two hybrid Populations Hereditary cereal chemistry .1973,50:631-636)；
2.McKenzie K.R.,JN.Genetic analysis of amylose content,alkali spreading score,and grain dimensions in rice.Crop Sci.1983,23,306-311 (the genetic analysis crop science .1983 of McKenzie K.R., JN. content of amylose in rice, caustic SCC and Grain Morphology, 23:306-311)；
3.Sano Y.Differential regulation of waxy gene expression in rice Endosperm.Theor.Appl.Genet.1984,68,467-473 (the difference of Sano Y. paddy endosperm waxy gene expression Regulate and control theory and apply heredity .1984,68:467-473)；
4.Kumar I.K.,G S.Juliano,B O.Genetic analysis of waxy locus in rice (Oryza sativa L.).Theor.Appl.Genet.1987,73,481-488(Kumar I.K.,G S.Juliano,B O. the genetic analysis in paddy endosperm waxy gene site is theoretical and applies heredity .1987,73:481-488)；
5.Kumar I.K.,GS.Inheritance of amylose content in rice(Oryza sativa L.) .Euphytica 1988,38,261-269 (the hereditary European plant of Kumar I.K., GS. content of amylose in rice Learn .1988,38:261-269)；
6.Tan Y.F.,Li J.X.,Yu S.B.,et al.The three important traits for cooking and eating quality of rice grains are controlled by a single locus in an elite rice hybrid,Shanyou 63.Theor.Appl.Genet.1999,99,642-648(Tan Y.F.,Li J.X., Yu S.B. waits three important indicators of the excellent hybrid paddy rice Shanyou 63 rice cooking and eating quality of to be controlled reason by unit point By and using heredity .1999,99:642-648)；
7.Aluko G.,Martinez C.,Tohme J.,et al.QTL mapping of grain quality traits from the interspecific cross Oryza sativa x O.glaberrima.Theor.Appl.G (Aluko G., Martinez C., Tohme J. waits Rice Kernel character to cultivate in Asia to enet.2004,109,630-639 QTL positioning in rice and Oryza glaberrima Steud interspecific hybridization group is theoretical and applies heredity .2004,109:630-639.)；
8. Huang Zuliu, and Tan Xuelin, the molecule of Tragoonrung S., et al. rice grain amylose content gene locus Label positioning Acta Agronomica Sinica 2000,26,777-782；
9.Lanceras J.C.,Huang Z.L.,Naivikul O.,et al.Mapping of genes for cooking and eating qualities in Thai jasmine rice(KDML105).DNA Res.2000,7,93- 101 (Lanceras J.C., Huang Z.L., Naivikul O., waits the gene mapping of THAI Fragrant rice cooking and eating quality .DNA .2000,7:93-101 is studied)；
10. Wu is kept burning day and night, Sun Chuanqing, Chen Liang, waits the QTL of content of amylose in rice and indica japonicadifferentiation and its mutually close System research China Agricultural University journal 2000,5,6-11；
11. the tactful Molecular Plant Breeding 2005,3,603-608 of Li Zhi health China's Rice molecular breeding plan；
12. Feng builds up application China agronomy notification 2006,22 of the Molecular Marker Assisted Selection Technology on rice breeding, 43-47。
In addition, invention " the Molecular marker of rice amylose content micro-control gene GBSSII of the patent No. 201310586095.5 And application ", 201310585846.1 invention " molecular labeling of rice amylose content micro-control gene SSIVb and application ", 201310581339.0 invention " rice amylose content micro-control gene AGPS2a molecular labeling and application " gives Synthesize the related molecular labeling of gene with rice starch, above-mentioned label is, SSIVb-m and AGPS2a-m, these marks Note is minor gene, it has been found that, minor gene polymerization is more, and choice accuracy will be higher, so exploitation is more straight Chain content of starch minor gene or the bigger gene of contribution rate, it appears particularly important.
Summary of the invention
The technical problem to be solved in the present invention is to provide one kind, and the related molecular labeling of Gene A/G PL3 is synthesized with rice starch And application thereof, the gene mark that the resulting molecular labeling AGPL3-m of the present invention is rice amylose content micro-control gene AGPL3 Note can be used for amylose content of rice identification and/or its offspring's assisted selection.
In order to solve the above technical problem, the present invention provides a kind of with rice amylose content micro-control gene AGPL3's Genetic marker, using rice as species, which is selected from following primer pair, and nucleotides sequence therein is classified as 5 ' → 3 ',
AGPL3-m is positive: GAAGATAGACGACACAGGAAGAGT
It is reversed: ACTGAAATTGAGGTTTGGCAT.
The present invention goes back while providing the purposes of above-mentioned molecular labeling AGPL3-m: for amylose content of rice Identification and/or its offspring's assisted selection.
The improvement of purposes as molecular labeling AGPL3-m of the invention: when for OryzasativaLcv.Nipponbare (japonica rice) and long-grained nonglutinous rice (for example, Special green, 93-11) offspring when, select banding pattern and the consistent single plant of OryzasativaLcv.Nipponbare banding pattern in offspring to be used for breeding.
Remarks explanation:
Sequence of the resulting molecular labeling AGPL3-m of primer AGPL3-m PCR amplification in OryzasativaLcv.Nipponbare are as follows: GAAGATAGA CGACACAGGAAGAGTTATCGCATTTAGTGAAAAACCAAAAGGAGATGATTTAAAGGCAATGGTAGGTCATATATGT TTATTCATACGGGAATGGATTCTAAACCCTCGAGGGGATATCCCCTCGTATATCTTTTTCTTTCAAATTCGATACA AATAGTTATGAAAAAATCTGAAAAAAATTGACAATGTAGAGTATAATGATACCTACTAATCCACCAAAATTCAAGT TCAAATTCGATCTACACATCGAGAAACAAAAAAGACAAATTTAGATATAAACAGTACGCTACTATTCATATGCTGA ATTTGTCTTTTTTATATCTCGATGTGTGAGTTGAGTTTGGACTTAAGATTTTGTGGAGTTGTATATATGTGTTGTA TGAATGTTGTTAAATTTTTCCAGAATTTTTCATAACCGTTTAGATGGTTTTTAGGTAAACGAGGGAACATCCCCTC GAGGGATTAGAATAGTTTCCCTATTCATACCACCCATCTGTCCTATGTACATATTGGAATCATATTCTAGATGGCC CAATGCACCAGTTAGTGCTGCACACAAAGAAAATAACTGATAATTTCATCAGACATTCTTTATTTTTCTTTGTGCA GCAAGTTGACACCACTGTTCTAGGCTTACCACAGGATGAAGCAAAAGAGAAGCCATACATAGCGTCAATGGGGGTT TATATATTTAAGAAAGAGATACTTCTAAATCTTTTGAGGTATGCCAATTCAACTCAATGGAGCTCACATAAAAATT CAGTAAAATGCTCCATTTAATCATCTGACTATAAAGTGTACTTTCATTCTAATGCCAAACCTCAATTTCAGT；
Sequence of the resulting molecular labeling AGPL3-m of primer AGPL3-m PCR amplification in special blueness are as follows: GAAGATAGACG ACACAGGAAGAGTTATCGCATTTAGTGAAAAACCAAAAGGAGATGATTTAAAGGCAATGGTAGGTCATATATGTTT ATTCATACCACTCATCTGTCCTATGTACATATTGGAATCATATTCTAGATGGCCCAATGCACCAGTTAGTGCTGCA CACAAAGAAAATAACTGATAATTTCATCAGACATTCTTTATTTTTCTTTGTGCAGCAAGTTGACACCACTGTTCTA GGCTTACCACAGGATGAAGCAAAAGAGAAGCCATACATAGCGTCAATGGGGGTTTATATATTTAAGAAAGAGATAC TTCTAAATCTTTTGAGGTATGCCAATTCAACTCAATGGAGCTCACATAAAAATTCAGTAAAATGCTCCATTTAATC ATCTGACTATAAAGTGTACTTTCATTCTAATGCCAAACCTCAATTTCAGT。
The development approach of molecular labeling of the invention, comprising the following steps:
1), using japonica rice variety OryzasativaLcv.Nipponbare as low amylose content gene donor parents and as the spy of high amylose starches Blueness is hybridized, is returned and is selfed, to obtain the single plant as offspring's rice low amylose content；
2), with CTAB (cetyltriethylammonium bromide, Hexadecyl trimethyl ammonium Bromide) Method extracts parental rice seedling and filial generation seedling genomic DNA；
3), low using Indel (insertion/deletion segment, insertion/deletions) molecule labelling method progress rice The screening of amylose content gene label；
4) an Indel molecular labeling AGPL3-m, is developed.
Molecular labeling AGPL3-m related with rice low amylose content, is specifically obtained with following methods:
1), according to the nucleotide sequence of Gene A/G PL3, design develops Indel molecular labeling, forms sediment for detecting low straight chain Powder content OryzasativaLcv.Nipponbare and the special green polymorphism of high amylose content；By being sequenced to further determine that the section primer AGPL3-m Sequence low amylose content OryzasativaLcv.Nipponbare and high amylose content spy blueness between difference；By hybridizing, being returned With selfing binding marker assisted Selection, the rice new germ plasm of the low amylose content of special green background is obtained；
2) parental rice seedling and filial generation seedling genomic DNA, are extracted with CTAB method；
3), low straight chain is screened using the genetic marker that Indel molecule labelling method carries out rice low amylose content to form sediment The rice new germ plasm of powder content；
4) it, identifies an Indel molecular labeling AGPL3-m and finds that it contains with rice amylose through polymorphic detection Amount is associated.
It is specifically using the method that Indel molecular labeling AGPL3-m carries out rice grain amylose content screening:
(1), DNA polymorphism point of the Indel label between high and low rice grain amylose content kind OryzasativaLcv.Nipponbare and special blueness Analysis:
According to the nucleotide sequence of Gene A/G PL3, design develops Indel molecular labeling AGPL3-m, low straight for detecting Polymorphism between the OryzasativaLcv.Nipponbare of chain content of starch and the spy blueness of high amylose content.Primer entrusts Shanghai Shen Neng betting office Synthesis, carries out PCR amplification, PCR reaction system on PTC-225PCR instrument are as follows: 20ng/ul oryza sativa genomic dna 1ul, 10 × PCRBuffer 2.0ul, 25mM MgCl22.0ul, 2mM dNTP 2.0ul, 10uM primer 2 .0ul, 5U/ul Taq DNA are poly- Synthase 0.2ul, ddH2O 10.8ul, total system 20ul.Response procedures: 95 DEG C are denaturalized 5 minutes；94 DEG C are denaturalized 1 minute, and 55 DEG C are moved back Fire 1 minute, 72 DEG C extend 1 minute, 40 circulations；72 DEG C polishing 10 minutes；Product detection: containing 0.5%ug/ulEB's 4.0% agarose gel electrophoresis, observation and film recording result under ultraviolet lamp.
(2), Indel marks the sequence of interval of AGPL3-m green in low, high rice grain amylose content kind OryzasativaLcv.Nipponbare and spy Between genome sequence difference:
According to the Indel molecular labeling AGPL3-m of acquisition, for PCR amplification low amylose content kind OryzasativaLcv.Nipponbare and The special green genome sequence of high amylose content kind, pcr amplification product entrust Shanghai Ying Jun Bioisystech Co., Ltd into Row sequencing analysis.PCR amplification is carried out referring to above-mentioned (1), and hundred Tyke Bioisystech Co., Ltd of Beijing is selected in the recycling of PCR product The PCR product QIAquick Gel Extraction Kit (centrifugal column type, catalog number (Cat.No.): DP1403) of exploitation.
(3), carry out the assisted selection of low amylose content using Indel label AGPL3-m
Genetic donor parent's OryzasativaLcv.Nipponbare of low amylose content, with the special green progress of the rice variety of high amylose content Hybridization, by being returned, being selfed binding marker assisted Selection, imported into height for the low amylose content gene AGPL3 of OryzasativaLcv.Nipponbare In the spy blueness of amylose content, selects banding pattern and the consistent single plant of OryzasativaLcv.Nipponbare banding pattern in segregating population to be used for breeding improvement, obtain Obtained the material with OryzasativaLcv.Nipponbare AGPL3 gene of the special green background of several pieces；The seed tied on these plant is harvested, it is straight to detect it Chain content of starch finds that its amylose content significantly reduces.
Amylose content height is the inferior main factor of rice quality.The present invention uses molecular biology method with low The OryzasativaLcv.Nipponbare of amylose content is material, development and screening it is new and also stable can reduce rice grain amylose content Molecular labeling and its method, the assisted selection for fine quality rice；Since general rice can be effectively reduced in material used Amylose content, there is generality to the improvement of China's rice quality.
The Indel of the invention rice starch synthesis related gene AGPL3 marks AGPL3-m.With this method, The disadvantages of period is long the time required to not only overcoming conventional breeding methods, can targetedly contain the low amylose of OryzasativaLcv.Nipponbare Amount Gene A/G PL3 is selected to obtain in laboratory and is purposefully carried out multiple good polymerizations, to cultivate with high-quality New rice variety.In the present invention, when gained plant the band of OryzasativaLcv.Nipponbare occurs through detection, it is low straight that we determine that it belongs to The rice of chain content of starch；When there is special green band or the band of special blueness+OryzasativaLcv.Nipponbare occurs simultaneously through detection in gained plant, We determine that it belongs to the rice of high amylose content.
Label selection between the applicable most long-grained nonglutinous rice (such as special green, 93-11) of the present invention and japonica rice (such as OryzasativaLcv.Nipponbare).
Therefore, result of the invention is of great significance in the practice of rice quality breeding；Its advantage is specifically summarized as follows:
(1) molecular labeling that can regulate and control rice grain amylose content of the invention is by low amylose content The long-grained nonglutinous rice of japonica rice OryzasativaLcv.Nipponbare and high amylose content it is special it is green hybridize, backcrossing, screening obtains in selfing, can significantly reduce rice Rice amylose content, and be stabilized, it can be used for the assisted selection of fine quality rice.
(2) Indel that the present invention is based on the nucleotide sequence development of rice starch synthesis Gene A/G PL3 and obtains divides Son label, it is of the invention compared with other related amylose content molecular labeling GBSSII-m, SSIVb-m and AGPS2a-m Label is located on the different chromosome of rice, and the present invention marks screened better effect, and greatly improves assisted Selection Efficiency, that is, label of the invention can make the better effect of the assisted selection of rice low amylose content.
Detailed description of the invention
Specific embodiments of the present invention will be described in further detail with reference to the accompanying drawing.
Fig. 1 is Indel label AGPL3-m in the japonica rice OryzasativaLcv.Nipponbare of low amylose content and the Xian of high amylose content The special green electrophoretic band figure of rice；
Fig. 2 is sequence difference of the pcr amplification product of primer AGPL3-m between OryzasativaLcv.Nipponbare and special blueness；
Fig. 3 is the green electrophoretic band figure of the spy for 12 parts of low amylose contents that Indel label AGPL3-m identification obtains；
Fig. 4 is the amylose content for marking 12 parts of materials of AGPL3-m assist-breeding；
Symbol in above-mentioned Fig. 1, Fig. 3~4 is explained as follows respectively:
1 represents: the long-grained nonglutinous rice of high amylose content is special green；
2 represent: the japonica rice OryzasativaLcv.Nipponbare of low amylose content；
3 represent: OryzasativaLcv.Nipponbare/spy blueness F1 plant；
4,5,6,7,8,9,10,11,12,13,14,15 represent: OryzasativaLcv.Nipponbare and special green offspring mark through Indel It is obtained after the screening of AGPL3-m.
Specific embodiment
Embodiment 1, the japonica rice OryzasativaLcv.Nipponbare and high amylose starches that low amylose content is identified with Indel label AGPL3-m The special green polymorphism of the long-grained nonglutinous rice of content
Specific practice is: it is green to choose rice material OryzasativaLcv.Nipponbare and spy, obtains its F1 with OryzasativaLcv.Nipponbare and special green hybridization, using drawing Object AGPL3-m identifies its polymorphism (Fig. 1).
One, DNA is extracted
1) DNA Extraction buffer, is prepared:
The DNA of 1 volume is successively added to extract solution (0.35M sorbitol in order；0.1M Tris,pH8.2；0.005M EDTA；Remaining is water), karyorhexis liquid (the 0.2M Tris, pH7.5 of 1 volume；0.05M EDTA；2M NaCl；0.055M CTAB；Remaining is water) and 0.4 volume 5% (mass concentration) sarkosyl solution (i.e. lauroyl-sarcosine sodium Aqueous solution)；It is eventually adding sodium hydrogensulfite, is configured to DNA Extraction buffer；Sodium hydrogensulfite is in DNA Extraction buffer Final concentration of 0.02M.
Above-mentioned DNA extract solution the preparation method comprises the following steps: in the sorbitol (D-sorbite) of 0.35mol, 0.1mol Tris (trishydroxymethylaminomethane, pH8.2), the EDTA (ethylenediamine tetra-acetic acid) of 0.005mol plus water are settled to 1L.
Above-mentioned karyorhexis liquid the preparation method comprises the following steps: 0.2mol Tris (trishydroxymethylaminomethane, pH7.5), CTAB (the cetyl trimethyl of the EDTA (ethylenediamine tetra-acetic acid) of 0.05mol, the NaCl (sodium chloride) of 2mol, 0.055mol Ammonium bromide) add water to be settled to 1L.
2), above-mentioned OryzasativaLcv.Nipponbare, special green, F1 rice leaf are handled as follows respectively:
1., weigh the rice leaf liquid nitrogen grinding powdering of 0.1g, the above-mentioned steps 1 of 700 μ l are then added) prepare DNA Extraction buffer, 65 DEG C water-bath 40 minutes.Again plus the chloroform of 700 μ l: isoamyl alcohol (volume ratio of 24:1), and mix.10, 000rpm is centrifuged 5 minutes, supernatant is transferred in new centrifuge tube.
2., after 1. above-mentioned steps are centrifuged in resulting supernatant plus the isopropanol of 2/3~1 times of volume pre-cooling (to 4 DEG C), It mixes gently to DNA and precipitates.13,000rpm centrifugations 8 minutes, pour out supernatant.
3., with the 200 μ l of alcohol of 70% (volumetric concentration) wash above-mentioned steps 2. resulting DNA sediment again.
4., the DNA after above-mentioned washing is dried and is dissolved in 100 μ l TE buffers or pure water.
5., the concentration of ultraviolet spectrophotometry detection above-mentioned steps 4. resulting DNA sample, 0.7% Ago-Gel The integrality of electrophoresis detection DNA.Complete suitable DNA is used for PCR amplification, and incomplete DNA is then extracted again, until having obtained Whole DNA.
Two, PCR amplification
1), reaction system:
Oryza sativa genomic dna 20ng/ul 1ul, 10 × PCR Buffer 2.0ul, 25mM MgCl22.0ul, 2mM DNTP 2.0ul, 10uM primer each 1.0ul, 5U/ul Taq archaeal dna polymerase 0.2ul, ddH2O 10.8ul, total system 20ul.
The primer are as follows: AGPL3-m is positive: GAAGATAGACGACACAGGAAGAGT
It is reversed: ACTGAAATTGAGGTTTGGCAT；
2), response procedures:
95 DEG C are denaturalized 5 minutes；94 DEG C are denaturalized 1 minute, and 55 DEG C are annealed 1 minute, and 72 DEG C extend 1 minute, 40 circulations；72℃ Polishing 10 minutes.
Three, electrophoresis detection
Amplified production 20ul is taken, with 4.0% Ago-Gel (containing 0.5%ug/ul EB) electrophoresis, is seen under ultraviolet lamp Examine simultaneously film recording result.As shown in Figure 1.
In Fig. 1, OryzasativaLcv.Nipponbare is the band of 841bp, and the special green band for being 441bp, " F1 " is the item of 841bp+441bp Band.
According to Fig. 1, we can obtain following conclusions: Indel molecular labeling AGPL3-m be able to detect special green and OryzasativaLcv.Nipponbare it Between polymorphism, and the pcr amplification product segment of OryzasativaLcv.Nipponbare is greater than special blueness, and special green and day can be used for by being indicated above AGPL3-m The marker assisted selection of Molecular Detection and its offspring between this is fine.
Embodiment 2, the japonica rice OryzasativaLcv.Nipponbare and Gao Zhilian that low amylose content is identified with Indel molecular labeling AGPL3-m The special green sequence difference of the long-grained nonglutinous rice of content of starch
Specific practice is: carrying out PCR expansion to OryzasativaLcv.Nipponbare and special green genomic DNA using Indel molecular labeling AGPL3-m Increase, amplified production commission Shanghai Ying Jun Bioisystech Co., Ltd is sequenced, and the difference (Fig. 2) of its sequence is compared.
One, DNA is extracted
1) DNA Extraction buffer, is prepared:
With embodiment 1.
2), above-mentioned OryzasativaLcv.Nipponbare and special green rice leaf are handled as follows respectively:
With embodiment 1.
3) PCR amplification
With embodiment 1.
4) recycling of PCR product
PCR product recycling select hundred Tyke Bioisystech Co., Ltd of Beijing exploitation PCR product QIAquick Gel Extraction Kit (from Stem type, catalog number (Cat.No.): DP1403), it requires to carry out referring to the description of product, the PCR product of recycling entrusts Shanghai English fine horse biotechnology Co., Ltd is sequenced.
According to fig. 2, we can be concluded that OryzasativaLcv.Nipponbare and special green AGPL3-m amplified production there are the alkali of 400bp Basis is different (as shown in the underscore in Fig. 2), this is that we are able to use Indel molecular labeling AGPL3-m and detect that its is polymorphic Property reason for it and we can be used for the hereditary basis of its offspring's marker assisted selection.
Embodiment 3, the assisted selection for carrying out low amylose content using Indel label AGPL3-m
Specific practice is: genetic donor parent's OryzasativaLcv.Nipponbare of low amylose content, the long-grained nonglutinous rice with high amylose content The special blueness of kind is successively hybridized, is returned and is selfed, to the assisted Selection of gained offspring's binding molecule label AGPL3-m, selection Banding pattern and the consistent single plant of OryzasativaLcv.Nipponbare banding pattern are used for breeding improvement in segregating population.
One, DNA is extracted
1) DNA Extraction buffer, is prepared:
With embodiment 1.
2), above-mentioned OryzasativaLcv.Nipponbare, special green, gained offspring rice leaf are handled as follows respectively:
With embodiment 1.
Two, Indel label detection
1), PCR amplification
With embodiment 1.
2), electrophoresis detection
With embodiment 1.
Three, Indel molecular labeling AGPL3-m carries out the assisted selection of low amylose content
The genetic donor japonica rice variety OryzasativaLcv.Nipponbare of low amylose content and the common rice variety of high amylose content Special blueness is hybridized, is returned and is selfed, and binding molecule marks the assisted Selection of AGPL3-m, selects banding pattern and day in segregating population This fine consistent single plant of banding pattern is further used for breeding improvement (Fig. 3), eliminates banding pattern and the special green banding pattern of high amylose content The individual of consistent and heterozygosis banding pattern (while having OryzasativaLcv.Nipponbare and special leukorrhagia with greenish discharge type), the rice grain amylose content of breeding material use National standard (GB/T 15683-2008) is detected.Analysis shows selected 12 with OryzasativaLcv.Nipponbare banding pattern single plant compares Recurrent parent spy blueness is substantially reduced (Fig. 4).It should be the results showed that Indel label AGPL3-m can be used for rice amylose The assisted selection of content.
Remarks explanation:
" 4~15 " in Fig. 3 and Fig. 4 are that OryzasativaLcv.Nipponbare and special blueness are successively hybridized, are returned and are selfed acquisition, and are The single plant of " banding pattern is consistent with OryzasativaLcv.Nipponbare banding pattern " is selected.
Experiment 1 differentiates rice grain amylose content using Indel label AGPL3-m
Specific practice is: by the banding pattern being eliminated in the step of embodiment 3 three and the special green banding pattern of high amylose content The individual of consistent and heterozygosis banding pattern (while having OryzasativaLcv.Nipponbare and special leukorrhagia with greenish discharge type) continues to plant, by its offspring's rice seed The measurement of grain amylose content, the reliability of further analyzing molecules label AGPL3-m assisted Selection.
One, DNA is extracted
1) DNA Extraction buffer, is prepared:
With embodiment 1.
2), above-mentioned rice leaf is handled as follows respectively:
With embodiment 1.
Two, Indel label detection
1), PCR amplification
With embodiment 1.
2), electrophoresis detection
With embodiment 1.
Three, Indel marks AGPL3-m to differentiate rice grain amylose content
It has randomly choosed in three embodiment 3 the step of 4 banding patterns that are eliminated to continue to plant with special green consistent single plant, pass through Indel molecular labeling AGPL3-m detection, offspring shows and special green consistent banding pattern, harvests these single plant seeds respectively simultaneously Measure its amylose content.In addition, randomly choosing of wherein 1 heterozygosis banding pattern (while there is OryzasativaLcv.Nipponbare and special leukorrhagia with greenish discharge type) Body randomly selects 16 single plants for continuing to plant behind in generation, Indel molecular labeling AGPL3-m detection shows this 16 There are 4 single plants to show special leukorrhagia with greenish discharge type in single plant, 8 single plants show heterozygosis banding pattern, and 4 performance OryzasativaLcv.Nipponbare banding patterns meet 1:2:1's Separation relation；After plant is mature, these single plants are harvested respectively and measure the amylose content of its seed.Table 1 is this 20 The amylose content of the Rice Kernel of single plant (strain), 4 show with the special consistent single plant of leukorrhagia with greenish discharge type it is similar with spy blueness High amylose content；And in 16 offspring's single plants of banding pattern heterozygosis, there are 12 single plants to behave like and special green high straight chain Content of starch (wherein, the banding pattern of 4 single plants shows special leukorrhagia with greenish discharge type, and the banding pattern of 8 single plants shows heterozygosis banding pattern)；4 in Japan The single plant of fine banding pattern, amylose content are substantially less than special green.It should be the results showed that Indel molecular labeling AGPL3-m can For differentiating rice grain amylose content.
1. rice grain amylose content of table and its corresponding genotype
Note: letter represents the genotype of the single plant in bracket, and T is special leukorrhagia with greenish discharge type, and H is heterozygosis banding pattern, and N is OryzasativaLcv.Nipponbare band Type.
Comparative example 1 and the very high label AGPL3-m-1 of AGPL3-m forward and reverse primer homology and AGPL3-m-2 (such as table 2, nucleotides sequence therein is classified as 5 ' → 3 ')；The above method according to the invention is detected, and finds the two label amplification effects Fruit is very bad, occurs without band or there are many non-characteristic band, it is impossible to be used in differentiates rice grain amylose content, that is, no Rice amylose content micro-control gene molecular labeling can be become.
Table 2
It is positive Reversely
AGPL3-m-1 ATAGACGACACAGGAAGAGTT GAAATTGAGGTTTGGCATTAG
AGPL3-m-2 ACAGGAAGAGTTATCGCATTTAGT TTGAGGTTTGGCATTAGAATG
Comparative example 2, by 4 kinds of molecular labelings AGPS2a-m, SSIVb-m, GBSSII-m, AGPL3-m as described in Table 3 (this Invention) it is tested according to 3 the method for embodiment, at this point, the genetic donor parent of low amylose content is still OryzasativaLcv.Nipponbare, The rice variety of high amylose content has been changed to 93-11 by special blueness.
Table 3
It is positive Reversely
AGPS2a-m TCTTCTTTTAGATCTTAAATTTCAGA CACATCAAAGTTGTAGTTTTGTGA
SSIVb-m ATTTTCCTCAGTAGTAAGCAAGAGTT AAAACATTGCTCCAAAACAGC
GBSSII-m TGTCAGTCGCTGTCCTCGTA GATCTCATCCCATGCTAAGTTACT
AGPL3-m GAAGATAGACGACACAGGAAGAGT ACTGAAATTGAGGTTTGGCAT
Banding pattern and the consistent single plant of OryzasativaLcv.Nipponbare banding pattern, the rice grain amylose content of breeding material in segregating population is selected to adopt It is detected with national standard (GB/T 15683-2008).
Result of the selected amylose content in OryzasativaLcv.Nipponbare banding pattern single plant compared with recurrent parent 93-11 is as follows Table 4:
Table 4
This experiment has carried out repetition several times, as a result described in basic as above table 4.
The above list is only a few specific embodiments of the present invention for finally, it should also be noted that.Obviously, this hair Bright to be not limited to above embodiments, acceptable there are many deformations.Those skilled in the art can be from present disclosure All deformations for directly exporting or associating, are considered as protection scope of the present invention.

Claims (3)

1. the molecular labeling AGPL3-m of rice amylose content micro-control gene AGPL3, using rice as species, it is characterized in that: The molecular labeling primer is selected from following primer pair, and nucleotides sequence therein is classified as 5 ' → 3 ',
AGPL3-m is positive: GAAGATAGACGACACAGGAAGAGT
It is reversed: ACTGAAATTGAGGTTTGGCAT；
Sequence of the resulting molecular labeling AGPL3-m of primer AGPL3-m PCR amplification in OryzasativaLcv.Nipponbare are as follows: GAAGATAGACGAC ACAGGAAGAGTTATCGCATTTAGTGAAAAACCAAAAGGAGATGATTTAAAGGCAATGGTAGGTCATATATGTTTAT TCATACGGGAATGGATTCTAAACCCTCGAGGGGATATCCCCTCGTATATCTTTTTCTTTCAAATTCGATACAAATA GTTATGAAAAAATCTGAAAAAAATTGACAATGTAGAGTATAATGATACCTACTAATCCACCAAAATTCAAGTTCAA ATTCGATCTACACATCGAGAAACAAAAAAGACAAATTTAGATATAAACAGTACGCTACTATTCATATGCTGAATTT GTCTTTTTTATATCTCGATGTGTGAGTTGAGTTTGGACTTAAGATTTTGTGGAGTTGTATATATGTGTTGTATGAA TGTTGTTAAATTTTTCCAGAATTTTTCATAACCGTTTAGATGGTTTTTAGGTAAACGAGGGAACATCCCCTCGAGG GATTAGAATAGTTTCCCTATTCATACCACCCATCTGTCCTATGTACATATTGGAATCATATTCTAGATGGCCCAAT GCACCAGTTAGTGCTGCACACAAAGAAAATAACTGATAATTTCATCAGACATTCTTTATTTTTCTTTGTGCAGCAA GTTGACACCACTGTTCTAGGCTTACCACAGGATGAAGCAAAAGAGAAGCCATACATAGCGTCAATGGGGGTTTATA TATTTAAGAAAGAGATACTTCTAAATCTTTTGAGGTATGCCAATTCAACTCAATGGAGCTCACATAAAAATTCAGT AAAATGCTCCATTTAATCATCTGACTATAAAGTGTACTTTCATTCTAATGCCAAACCTCAATTTCAGT；
Sequence of the resulting molecular labeling AGPL3-m of primer AGPL3-m PCR amplification in special blueness are as follows: GAAGATAGACGACAC AGGAAGAGTTATCGCATTTAGTGAAAAACCAAAAGGAGATGATTTAAAGGCAATGGTAGGTCATATATGTTTATTC ATACCACTCATCTGTCCTATGTACATATTGGAATCATATTCTAGATGGCCCAATGCACCAGTTAGTGCTGCACACA AAGAAAATAACTGATAATTTCATCAGACATTCTTTATTTTTCTTTGTGCAGCAAGTTGACACCACTGTTCTAGGCT TACCACAGGATGAAGCAAAAGAGAAGCCATACATAGCGTCAATGGGGGTTTATATATTTAAGAAAGAGATACTTCT AAATCTTTTGAGGTATGCCAATTCAACTCAATGGAGCTCACATAAAAATTCAGTAAAATGCTCCATTTAATCATCT GACTATAAAGTGTACTTTCATTCTAATGCCAAACCTCAATTTCAGT。
2. the purposes of molecular labeling AGPL3-m as described in claim 1, it is characterized in that: containing for rice amylose Amount identification and/or its offspring's assisted selection；The rice is OryzasativaLcv.Nipponbare, special blueness.
3. the purposes of molecular labeling AGPL3-m according to claim 2, it is characterized in that: when for OryzasativaLcv.Nipponbare and long-grained nonglutinous rice after Dai Shi selects banding pattern and the consistent single plant of OryzasativaLcv.Nipponbare banding pattern in offspring to be used for breeding.
CN201610184348.XA 2016-03-28 2016-03-28 Rice amylose content micro-control gene AGPL3 molecular labeling and application Active CN105671183B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610184348.XA CN105671183B (en) 2016-03-28 2016-03-28 Rice amylose content micro-control gene AGPL3 molecular labeling and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610184348.XA CN105671183B (en) 2016-03-28 2016-03-28 Rice amylose content micro-control gene AGPL3 molecular labeling and application

Publications (2)

Publication Number Publication Date
CN105671183A CN105671183A (en) 2016-06-15
CN105671183B true CN105671183B (en) 2019-05-07

Family

ID=56224293

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610184348.XA Active CN105671183B (en) 2016-03-28 2016-03-28 Rice amylose content micro-control gene AGPL3 molecular labeling and application

Country Status (1)

Country Link
CN (1) CN105671183B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106591435A (en) * 2016-11-22 2017-04-26 南京农业大学 Molecular marker method for site of low-amylose-content gene of dark endosperm mutant w54 of japonica rice variety Koshihikari
CN108424974B (en) * 2017-11-10 2021-09-03 浙江省农业科学院 Genetic identification and molecular marker assisted breeding method for rice amylose content QTL locus qSAC3
CN111118201B (en) * 2020-02-23 2020-11-03 云南省农业科学院农业环境资源研究所 Molecular marker closely linked with gene du13(t) for regulating and controlling low amylose content of rice and application thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103298940A (en) * 2010-11-04 2013-09-11 阿里斯塔谷类科技有限公司 High amylose wheat
CN103602675A (en) * 2013-11-19 2014-02-26 中国水稻研究所 Molecular marker of rice amylose content micro-control gene GBSSII and application thereof
CN103602673B (en) * 2013-11-19 2015-10-28 中国水稻研究所 Rice amylose content micro-control gene AGPS2a molecule marker and application
CN103602674B (en) * 2013-11-19 2015-10-28 中国水稻研究所 The molecule marker of rice amylose content micro-control gene SSIVb and application
CN105087573A (en) * 2015-09-14 2015-11-25 扬州大学 Method for identifying rice Wx-mw gene and application of rice Wx-mw gene in high-quality rice breeding

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103298940A (en) * 2010-11-04 2013-09-11 阿里斯塔谷类科技有限公司 High amylose wheat
CN103602675A (en) * 2013-11-19 2014-02-26 中国水稻研究所 Molecular marker of rice amylose content micro-control gene GBSSII and application thereof
CN103602673B (en) * 2013-11-19 2015-10-28 中国水稻研究所 Rice amylose content micro-control gene AGPS2a molecule marker and application
CN103602674B (en) * 2013-11-19 2015-10-28 中国水稻研究所 The molecule marker of rice amylose content micro-control gene SSIVb and application
CN105087573A (en) * 2015-09-14 2015-11-25 扬州大学 Method for identifying rice Wx-mw gene and application of rice Wx-mw gene in high-quality rice breeding

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Rational design of high-yield and superior-quality rice;Dali Zeng等;《Nature plants》;20170320;第3卷;Article no. 17031
Sequence variations in OsAGPase significantly associated with amylose content and viscosity properties in rice (Oryza sativa L.);FU-HAO LU等;《Genet. Res., Camb.》;20121231;第94卷;179-189
稻米淀粉形状的QTLs定位及其淀粉合成相关酶基因的关联性分析;王震等;《浙江农业学报》;20111231;第23卷(第3期);439-445

Also Published As

Publication number Publication date
CN105671183A (en) 2016-06-15

Similar Documents

Publication Publication Date Title
Lu et al. Efficient indica and japonica rice identification based on the InDel molecular method: Its implication in rice breeding and evolutionary research
CN103602673B (en) Rice amylose content micro-control gene AGPS2a molecule marker and application
CN103602674B (en) The molecule marker of rice amylose content micro-control gene SSIVb and application
CN103602675B (en) Molecular marker of rice amylose content micro-control gene GBSSII and application
CN105671183B (en) Rice amylose content micro-control gene AGPL3 molecular labeling and application
CN108504773B (en) Molecular marker of major QTL (quantitative trait loci) site for grain weight and silique length of brassica napus and application of molecular marker
CN108300801A (en) The molecular labeling and application that a kind of and rape grain weight and Pod length are closely related
CN105861725B (en) The molecular labeling of rice amylose content micro-control gene AGPL1 and application
CN105838819B (en) The molecular labeling of rice amylose content micro-control gene ISA and application
CN110055348A (en) The Functional marker of rice grain shape gene GL3 and its application
CN105671042A (en) Molecular marker for rice amylose content micro-control genes SSIII-1 and application of molecular marker
CN110106271B (en) SSR marker primer pair for assisting in selecting large-grain broad beans and application thereof
CN106048011A (en) Molecular marker of rice grain AC (amylose content) micro-control gene SSIIIb and application
Kishii et al. Production of wheat-Psathyrostachys huashanica chromosome addition lines
AU2020103461A4 (en) Molecular marker of rice amylose content micro-control gene SSIIIb and application thereof
Chunwongse et al. Development of di-nucleotide microsatellite markers and construction of genetic linkage map in mango (Mangifera indica L.).
CN113197089B (en) Breeding method facilitating early generation selection of soft weak gluten wheat
Singh et al. Microsatellite markers revealed genetic diversity in mungbean mutant lines
CN111172317B (en) Molecular marker HSRC3911 closely linked with major QTL site in flowering phase of sesame and application thereof
CN105671182B (en) Rice gel consistency controls gene PUL molecular labeling and application
Tong et al. Genetic analysis and molecular mapping of Rp, a mutant gene encoding red pericarp in rice (Oryza sativa L.).
CN105671043B (en) Rice gel consistency controls gene SBE1 molecular labelings and application
CN103160583A (en) Method for classifying sterile genes RNaseZ of paddy rice temperature-sensitive male nucleus
WANG et al. Construction of near isogenic lines for pericarp color and evaluation on their near isogenicity in rice
RU2774444C1 (en) Intragenic dna marker for the selection of wheat with a high content of anthocyanins in the grain pericarp

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant