CN103602673B - Rice amylose content micro-control gene AGPS2a molecule marker and application - Google Patents
Rice amylose content micro-control gene AGPS2a molecule marker and application Download PDFInfo
- Publication number
- CN103602673B CN103602673B CN201310581339.0A CN201310581339A CN103602673B CN 103602673 B CN103602673 B CN 103602673B CN 201310581339 A CN201310581339 A CN 201310581339A CN 103602673 B CN103602673 B CN 103602673B
- Authority
- CN
- China
- Prior art keywords
- agps2a
- rice
- amylose content
- molecule marker
- fine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the molecule marker AGPS2a-m of a kind of rice amylose content micro-control gene AGPS2a, using paddy rice as species, described molecule marker primer is selected from following primer pair, nucleotides sequence is wherein classified as 5 ' → 3 ', AGPS2a-m forward: TCTTCTTTTAGATCTTAAATTTCAGA, oppositely: CACATCAAAGTTGTAGTTTTGTGA.Above-mentioned molecule marker AGPS2a-m can be used for amylose content of rice qualification and/or its offspring's assisted selection.As special blue or green offspring warm and fine for Japan, select individual plant that in offspring, the fine banding pattern of banding pattern and Japan is consistent for breeding improvement.
Description
Technical field
The invention belongs to agricultural biotechnology engineering, particularly relevant with rice grain amylose content regulatory gene AGPS2a molecule marker and preparation method thereof and purposes.
Background technology
High yield, high-quality are the targets of rice breeding long-sought always.Through long-term effort, the especially utilization of hybridisation rice technology, China achieves universally acknowledged achievement in Rice Production.But because the past places the problem of food and clothing how solving people above the other things always, so the emphasis major part of rice breeding work concentrates on the cultivation of new high-yielding rice varieties, thus cause the breeding of fine quality rice seriously delayed, the particularly general deviation of hybridisation rice quality of some high yields.
Another slower major cause of grain quality improving progress is caused to be the complicacy of rice quality heredity and the limitation of traditional breeding method means.The quality trait of rice comprises all many-sides such as exterior quality, processing quality, cooking properties, nutritional quality and Cooking Quality, and Rice Cooking is the most important index evaluating rice quality.Cooking properties refers to the characteristic that rice shows in digestion process, primarily of amylose content (Amylose Content, AC), gel consistence (Gel Consistency, GC), gelatinization point (Gelatinization Temperature, GT) three physical and chemical indexs are evaluated, and wherein AC affects the topmost physical and chemical index of rice quality.Breeding scholar and geneticist do a large amount of work seeking the genetic base of rice AC, but the result of different experiments room has larger difference.Early stage research shows that rice AC is controlled by a major gene, and is subject to the regulation and control [1,2] of other minor effects QTL.Research subsequently find Waxy (Wx) for rice AC number there is conclusive effect, may the major gene [3-5] of control AC exactly.Except 1 main effect QTL detected on the 6th dye body except, different study the minor effect QTL number that detects and position very inconsistent.Such as, Tan etc. detect two minor effect QTLs [6] the 1st, on 2 karyomit(e)s, and He etc. detect a minor effect QTL [6] at the 5th karyomit(e), and Aluko etc. detect minor effect QTLs [7] respectively on the 3rd and 8 karyomit(e)s.The research such as Huang Zuliu finds except the 6th chromosomal Wx gene locus, a main effect QTL controlling rice AC also detected at the 3rd karyomit(e); Other 5 minor effect QTLs lay respectively on the 4th, 4,6,9,11 chromosomal different seats [8].Other laboratories the 4th, 6,7 karyomit(e)s also detect the QTLs [9] of control AC.Wu Changming etc. do not find the QTL site relevant with AC on the 6th karyomit(e), just on the the the 1st, 7,8,9,12 karyomit(e), find 5 QTL site [10].
Causing grain quality improving to be in progress another slower major cause is limitation in traditional breeding method means.Traditional breeding way mainly carries out orthoselection to favo(u)rable target proterties and fixes, and cultivate improved Varieties, this tool bears the character of much blindness and unpredictability [11].Further, the method for individual selection directly selects the economical character meeting breeding objective, and what namely select is individual phenotype instead of genotype.Owing to having one between gene because of multiple-effect, many effects because of an effect, regulatory gene and modifying factor etc., often there is larger difference in the Phenotype and genotype of individuality, thus carries out the accuracy of individual selection by field phenotypic character poor.Molecular marker assisted selection (Marker-assisted Selection, MAS) technology provides new approach to rice breeding, combines greatly can improve breeding efficiency with traditional breeding technology, shortens breeding cycle.The core of MAS the Phenotypic Selection in conventional breeding is converted into genotype select, it directly reflects the sequence difference of DNA, not by the impact of genetic expression, result reliability is strong, and not by the growth and development stage of plant and the impact [12] of envrionment conditions.
The reference above related to is as follows:
1.Bollich C.W., BD.Inheritance of amylose in two hybrid populations of rice.Cereal Chem.1973,50,631-636(Bollich C.W., BD. the heredity at two hybrid Populations of amylose content, cereal chemistry .1973.50:631-636);
2.McKenzie K.R., JN.Genetic analysis of amylose content, alkali spreading score, and graindimensions in rice.Crop Sci.1983,23, the genetic analysis of 306-311(McKenzie K.R., JN. content of amylose in rice, caustic SCC and Grain Morphology. crop science .1983,23:306-311);
3.Sano Y.Differential regulation of waxy gene expression in rice endosperm.Theor.Appl.Genet.1984,68,467-473 (the difference regulation and control that Sano Y. paddy endosperm waxy gene is expressed. Theory and applications heredity .1984,68:467-473);
4.Kumar I.K., G S.Juliano, B O.Genetic analysis of waxy locus in rice (Oryza sativa L.) .Theor.Appl.Genet.1987,73,481-488. (Kumar I.K., the genetic analysis in G S.Juliano, B O. paddy endosperm waxy gene site. Theory and applications heredity .1987,73:481-488);
5.Kumar I.K., GS.Inheritance of amylose content in rice (Oryza sativa L.) .Euphytica1988,38,261-269 (Kumar I.K., GS. the heredity of content of amylose in rice. European plant .1988,38:261-269);
6.Tan Y.F., Li J.X., Yu S.B., et al.The three important traits for cooking and eating quality ofrice grains are controlled by a single locus in an elite rice hybrid, Shanyou63.Theor.Appl.Genet.1999,99,642-648 (Tan Y.F., Li J.X., Yu S.B., Deng. three important indicators of excellent hybridisation rice Shanyou 63 rice cooking and eating quality control by unit point. Theory and applications heredity .1999,99:642-648);
7.Aluko G., Martinez C., Tohme J., et al.QTL mapping of grain quality traits from theinterspecific cross Oryza sativa x O.glaberrima.Theor.Appl.Genet.2004,109,630-639 (Aluko G., Martinez C., Tohme J., Deng. the QTL location of Rice Kernel proterties in Asian Cultivated Rice and Oryza glaberrima Steud species hybridization colony. Theory and applications heredity .2004,109:630-639.);
8. yellow ancestral six, and the Molecular mapping of Tan Xuelin, Tragoonrung S., et al. rice grain amylose content locus. Acta Agronomica Sinica 2000,26,777-782;
9.Lanceras J.C., Huang Z.L., Naivikul O., et al.Mapping of genes for cooking and eatingqualities in Thai jasmine rice (KDML105) .DNA Res.2000,7,93-101 (Lanceras J.C., Huang Z.L., Naivikul O., etc. the gene mapping .DNA of thailand scented rice cooking and eating quality studies .2000,7:93-101);
10. Wu is kept burning day and night, Sun Chuanqing, Chen Liang, etc. the QTL of content of amylose in rice and indica japonicadifferentiation and interrelationship study thereof. China Agricultural University's journal 2000,5,6-11;
11. Li Zhi health. the strategy of China's Rice molecular breeding plan. Molecular Plant Breeding 2005,3,603-608;
12. Feng build up. the application of Molecular Marker Assisted Selection Technology on rice breeding. and Chinese agronomy circular 2006,22,43-47.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of molecule marker relevant with rice starch synthetic gene AGPS2a and development approach thereof and purposes, the molecule marker AGPS2a-m of gained of the present invention is the molecule marker of rice amylose content micro-control gene AGPS2a, can be used for the assisted selection of rice grain amylose content.
In order to solve the problems of the technologies described above, the invention provides the molecule marker of a kind of rice amylose content micro-control gene AGPS2a, using paddy rice as species, this molecule marker primer is selected from following primer pair, and nucleotides sequence is wherein classified as 5 ' → 3 ',
AGPS2a-m forward: TCTTCTTTTAGATCTTAAATTTCAGA
Reverse: CACATCAAAGTTGTAGTTTTGTGA.
Present invention also offers the development approach of above-mentioned molecule marker AGPS2a-m, comprise the following steps:
1), so that japonica rice variety Japan is fine carry out hybridizing, backcrossing and selfing as low amylose content gene donor parents and the spy green grass or young crops as high amylose starch, thus obtain the individual plant as the rice low amylose content of offspring;
2), CTAB(cetyltriethylammonium bromide is used, Hexadecyl trimethyl ammonium Bromide) method extracts the genomic dna of parental rice seedling and offspring seedling;
3), Indel(insertion/deletion fragment is adopted, insertion/deletions) molecule marking method carries out the screening of rice low amylose content gene mark;
4) an Indel molecule marker AGPS2a-m, is developed.
The molecule marker AGPS2a-m relevant with rice low amylose content, specifically obtains by following method:
1), according to the nucleotide sequence of Gene A/G PS2a, design, development Indel molecule marker, for detecting the special blue or green polymorphism of the warm and fine high amylose content of low amylose content Japan; By order-checking to determine the difference of the sequence in primer AGPS2a-m interval between the spy green grass or young crops of the warm and fine high amylose content of the Japan of low amylose content further; By hybridization, backcross and selfing bonding mark assisted Selection, obtain the paddy rice new germ plasm of the low amylose content of special blue or green background;
2) genomic dna of parental rice seedling and offspring seedling, is extracted by CTAB method;
3) Indel molecule marking method, is adopted to carry out the paddy rice new germ plasm of the genetic marker screening low amylose content of rice low amylose content;
4), identify an Indel molecule marker AGPS2a-m, through polymorphic detection, find that it is associated with rice grain amylose content.
The present invention also provides the purposes of above-mentioned molecule marker AGPS2a-m simultaneously, for amylose content of rice qualification and/or its offspring's assisted selection.
Improvement as the purposes of molecule marker AGPS2a-m of the present invention: as special blue or green offspring warm and fine for Japan, selects individual plant that in offspring, the fine banding pattern of banding pattern and Japan is consistent for breeding improvement.
Indel molecule marker AGPS2a-m is adopted to carry out the method for rice grain amylose content screening specifically:
(1), Indel is marked at the DNA polymorphism analysis between the warm and fine special green grass or young crops of high and low rice grain amylose content kind Japan:
According to the nucleotide sequence of Gene A/G PS2a, design, development Indel molecule marker AGPS2a-m, the polymorphism between the spy green grass or young crops of the warm and fine high amylose content of the Japan for detecting low amylose content.Primer entrusts the synthesis of Shanghai Shen Neng betting office, and in the enterprising performing PCR amplification of PTC-225PCR instrument, PCR reaction system is: 20ng/ul oryza sativa genomic dna 1ul, 10 × PCR Buffer2.0ul, 25mM MgCl
22.0ul, 2mM dNTP2.0ul, 10uM primer 2 .0ul, 5U/ul Taq archaeal dna polymerase 0.2ul, ddH
2o10.8ul, total system 20ul.Response procedures: 95 DEG C of sex change 5 minutes; 94 DEG C of sex change 1 minute, 55 DEG C of annealing 1 minute, 72 DEG C extend 1 minute, 40 circulations; 72 DEG C of polishings 10 minutes; Product detects: containing 0.5%ug/ulEB 4.0% agarose gel electrophoresis, observe also photographic recording result under ultraviolet lamp.
(2), Indel marks the genome sequence difference of sequence of interval between the warm and fine special green grass or young crops of low, high rice grain amylose content kind Japan of AGPS2a-m:
According to the Indel molecule marker AGPS2a-m obtained, for the special blue or green genome sequence of the warm and fine high amylose content kind of pcr amplification low amylose content kind Japan, pcr amplification product entrusts Shanghai Ying Jun Bioisystech Co., Ltd to carry out sequencing analysis.Pcr amplification carries out with reference to above-mentioned (1), and the PCR primer that the recovery of PCR primer selects Beijing hundred Tyke Bioisystech Co., Ltd to develop reclaims test kit (centrifugal column type, catalog number (Cat.No.): DP1403).
(3) Indel mark AGPS2a-m, is utilized to carry out the assisted selection of low amylose content
The genetic donor parent Japan of low amylose content is fine, hybridize with the special green grass or young crops of the rice variety of high amylose content, by backcrossing, selfing bonding mark assisted Selection, low amylose content gene AGPS2a fine for Japan is imported in the spy green grass or young crops of high amylose content, select the individual plant that the fine banding pattern of banding pattern and Japan is consistent in segregating population to be used for breeding improvement, obtain the material of the Japanese fine AGPS2a gene of band of the some parts of blue or green backgrounds of spy; Gather in the crops the seed that these plant are tied, detect its amylose content, find that its amylose content significantly reduces.
Amylose content height is the inferior main factor of rice quality.The present invention adopts molecular biology method fine for material with the Japan of low amylose content, develops and screens the new and stable molecule marker that can reduce rice grain amylose content and method thereof, for the assisted selection of fine quality rice; Material due to institute effectively can reduce the amylose content of general rice, and it has ubiquity to the improvement of China's rice quality.
The Indel of the invention rice starch synthesis related gene AGPS2a marks AGPS2a-m.Profit in this way, not only overcome the shortcomings such as conventional breeding methods required time cycle length, targetedly low amylose content gene AGPS2a fine for Japan can be selected in laboratory to obtain the polymerization also on purpose carrying out multiple high-quality, thus cultivate the new rice variety with high-quality.In the present invention, when Japanese fine band appears in gained plant after testing, we judge that it belongs to the paddy rice of low amylose content; When special blue or green band appears in gained plant after testing, we judge that it belongs to the paddy rice of high amylose content; When special blue or green+Japanese fine band appears in gained plant after testing simultaneously, we judge that it may belong to the paddy rice of high amylose content.
Marker selection between the applicable most long-grained nonglutinous rice of the present invention (as special blue or green) and japonica rice (as Japan is fine).
Therefore, result of the present invention is significant in the practice of paddy rice quality breeding.Its advantage is specifically summarized as follows:
(1) molecule marker that can regulate and control rice grain amylose content of the present invention, be by the japonica rice of low amylose content Japan fine with the special blue or green hybridization of the long-grained nonglutinous rice of high amylose content, backcross, screen in selfing and obtain, significantly can reduce rice grain amylose content, and stable existence, can be used for the assisted selection of fine quality rice.
(2) the present invention be based on rice starch synthetic gene AGPS2a nucleotide sequence development and obtain Indel molecule marker, greatly improve the efficiency of assisted Selection.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is the electrophoretic band figure of the special green grass or young crops of Indel mark AGPS2a-m long-grained nonglutinous rice that is fine in the japonica rice Japan of low amylose content, high amylose content, F1;
Fig. 2 is the sequence difference of pcr amplification product between the warm and fine special green grass or young crops of Japan of primer AGPS2a-m;
Fig. 3 is the electrophoretic band figure that Indel marks the warm and fine special blue or green offspring of 8 parts of low amylose content Japan that AGPS2a-m qualification obtains;
Fig. 4 is the amylose content of 8 parts of materials of mark AGPS2a-m assist-breeding;
Symbol in above-mentioned Fig. 1 ~ 4 is explained as follows respectively:
1 representative: the japonica rice Japan of low amylose content is fine;
2 representatives: the long-grained nonglutinous rice of high amylose content is special blue or green;
3 representatives: fine/special blue or green F1 plant of Japan;
4,5,6,7,8,9,10,11 all represent: the warm and fine special blue or green offspring of Japan, obtains after the screening that Indel marks AGPS2a-m.
Embodiment
Embodiment 1, mark AGPS2a-m with Indel and identify the polymorphism that the long-grained nonglutinous rice of the warm and fine high amylose content of japonica rice Japan of low amylose content is special blue or green
Specific practice is: from China Paddy Rice Inst's germplasm resource bank, choose rice material Japan warm and fine special blue or green, obtains its F1, utilize primer AGPS2a-m to identify its polymorphism (Fig. 1) with the warm and fine special blue or green hybridization of Japan.
One, DNA is extracted
1), DNA extraction damping fluid is prepared:
Add DNA extraction solution (the 0.35M sorbitol of 1 volume in order successively; 0.1M Tris, pH8.2; 0.005M EDTA; All the other are water), karyorhexis liquid (0.2M Tris, the pH7.5 of 1 volume; 0.05M EDTA; 2M NaCl; 0.055M CTAB; All the other are water) and the 5%(mass concentration of 0.4 volume) sarkosyl solution (i.e. the aqueous solution of dodecanoyl-sarcosine sodium); Finally add sodium bisulfite, be mixed with DNA extraction damping fluid; The final concentration of sodium bisulfite in DNA extraction damping fluid is 0.02M.
The preparation method of above-mentioned DNA extraction solution is: the sorbitol(Sorbitol Powder at 0.35mol), the Tris(Tutofusin tris of 0.1mol, pH8.2), the EDTA(ethylenediamine tetraacetic acid (EDTA) of 0.005mol) in add water and be settled to 1L.
The preparation method of above-mentioned karyorhexis liquid is: at the Tris(Tutofusin tris of 0.2mol, pH7.5), the EDTA(ethylenediamine tetraacetic acid (EDTA) of 0.05mol), the NaCl(sodium-chlor of 2mol), the CTAB(cetyl trimethylammonium bromide of 0.055mol) in add water and be settled to 1L.
2), fine to above-mentioned Japan, special rice leaf that is blue or green, F1 is handled as follows respectively:
1., take the rice leaf liquid nitrogen grinding powdering of 0.1g, then add the above-mentioned steps 1 of 700 μ l) the DNA extraction damping fluid prepared, 65 DEG C of water-baths 40 minutes.Add the chloroform of 700 μ l again: primary isoamyl alcohol (volume ratio of 24:1), and mix.Centrifugal 5 minutes of 10,000rpm, transfers to supernatant liquor in new centrifuge tube.
2., in the supernatant liquor of above-mentioned steps 1. centrifugal rear gained, add the Virahol of 2/3 ~ 1 times of volume precooling (to 4 DEG C), mix gently to DNA and precipitate.Centrifugal 8 minutes of 13,000rpm, pours out supernatant liquor.
3., use 70%(volumetric concentration again) alcohol 200 μ l wash the DNA throw out of above-mentioned steps 2. gained.
4., the DNA after above-mentioned washing dried and be dissolved in 100 μ l TE damping fluids or pure water.
5., ultraviolet spectrophotometry detects the concentration of the above-mentioned steps 4. DNA sample of gained, and the agarose gel electrophoresis of 0.7% detects the integrity of DNA.Complete suitable DNA is used for pcr amplification, and incomplete DNA then extracts again, until obtain complete DNA.
Two, pcr amplification
1), reaction system:
Oryza sativa genomic dna 20ng/ul1ul, 10 × PCR Buffer2.0ul, 25mM MgCl
22.0ul, 2mM dNTP2.0ul, 10uM primer each 1.0ul, 5U/ul Taq archaeal dna polymerase 0.2ul, ddH
2o10.8ul, total system 20ul.
Described primer is: AGPS2a-m forward: TCTTCTTTTAGATCTTAAATTTCAGA
Reverse: CACATCAAAGTTGTAGTTTTGTGA.
2), response procedures:
95 DEG C of sex change 5 minutes; 94 DEG C of sex change 1 minute, 55 DEG C of annealing 1 minute, 72 DEG C extend 1 minute, 40 circulations; 72 DEG C of polishings 10 minutes.
Three, electrophoresis detection
Get amplified production 20ul, sepharose (containing the 0.5%ug/ul EB) electrophoresis with 4.0%, observe and photographic recording result under ultraviolet lamp.As shown in Figure 1.
In FIG, Japan is fine be the band of 138bp, and spy green grass or young crops is the band of 143bp, the band that " F1 " is 143bp+138bp.
According to Fig. 1, we can draw following conclusion: Indel molecule marker AGPS2a-m can detect special blue or green and Japan fine between polymorphism, and the fine pcr amplification product fragment of Japan is less than special blue or green, show thus AGPS2a-m can be used for special blue or green and Japan fine between Molecular Detection and the marker assisted selection of offspring.
Embodiment 2, the sequence difference using the long-grained nonglutinous rice spy of the warm and fine high amylose content of japonica rice Japan of Indel molecule marker AGPS2a-m qualification low amylose content blue or green
Specific practice is: application Indel molecule marker AGPS2a-m carries out pcr amplification to the warm and fine special blue or green genomic dna of Japan, and amplified production entrusts Shanghai Ying Jun Bioisystech Co., Ltd to check order, and compares the difference (Fig. 2) of its sequence.
One, DNA is extracted
1), DNA extraction damping fluid is prepared:
With embodiment 1.
2), the warm and fine special blue or green rice leaf of above-mentioned Japan is handled as follows respectively:
With embodiment 1.
3) pcr amplification
With embodiment 1.
4) recovery of PCR primer
The PCR primer that the recovery of PCR primer selects Beijing hundred Tyke Bioisystech Co., Ltd to develop reclaims test kit (centrifugal column type, catalog number (Cat.No.): DP1403), require to carry out with reference to the description of product, the PCR primer of recovery entrusts Shanghai Ying Jun Bioisystech Co., Ltd to check order.
According to Fig. 2, we can draw to draw a conclusion: the warm and fine special blue or green AGPS2a-m amplified production of Japan exists the base difference (as shown in the underscore in Fig. 2) of 5bp, this is that we can use Indel molecule marker AGPS2a-m to detect the reason place of its polymorphism, is also that we can be used for the hereditary basis of its offspring's marker assisted selection.
Embodiment 3, utilize Indel to mark AGPS2a-m to carry out the assisted selection of low amylose content
Specific practice is: the genetic donor parent Japan of low amylose content is fine, carry out successively hybridizing, backcrossing and selfing with the special green grass or young crops of the rice variety of high amylose content, to the assisted Selection of gained offspring binding molecule mark AGPS2a-m, select the fine banding pattern of banding pattern and Japan is consistent in segregating population individual plant for breeding improvement.
One, DNA is extracted
1), DNA extraction damping fluid is prepared:
With embodiment 1.
2), fine to above-mentioned Japan, special rice leaf that is blue or green, gained offspring is handled as follows respectively:
With embodiment 1.
Two, Indel marker detection
1), pcr amplification
With embodiment 1.
2), electrophoresis detection
With embodiment 1.
Three, Indel molecule marker AGPS2a-m carries out the assisted selection of low amylose content
The genetic donor japonica rice variety Japan of low amylose content is fine to carry out hybridizing, backcrossing and selfing with the special green grass or young crops of the common rice variety of high amylose content, the assisted Selection of binding molecule mark AGPS2a-m, the individual plant that the fine banding pattern of banding pattern and Japan is consistent in segregating population is selected to be further used for breeding improvement (Fig. 3), eliminate the special blue or green banding pattern one of banding pattern and high amylose content to make peace the individuality of heterozygosis banding pattern (simultaneously having the warm and fine special leukorrhagia with greenish discharge type of Japan), rice grain amylose content employing national standard (GB/T15683-2008) of breeding material detects.Analysis shows, all special than the recurrent parent blue or green obviously reduction (Fig. 4) of 8 individual plants of the selected fine banding pattern of band Japan.This experimental result shows: Indel marks the assisted selection that AGPS2a-m may be used for rice grain amylose content.
Remarks illustrate:
" 4 ~ 11 " in Fig. 3 and Fig. 4 are Japan and warm and finely special blue or green carry out successively hybridizing, to backcross and selfing obtains, and are the individual plants that have selected " banding pattern with Japan fine banding pattern consistent ".
Comparative example 1, utilize Indel mark AGPS2a-m differentiate rice grain amylose content
Specific practice is: the individuality of heterozygosis banding pattern (simultaneously having the warm and fine special leukorrhagia with greenish discharge type of Japan) of the banding pattern be eliminated in the step 3 of embodiment 3 and the special blue or green banding pattern one of high amylose content being made peace proceeds to plant, by the mensuration to its offspring's Rice Kernel amylose content, the reliability of further analyzing molecules mark AGPS2a-m assisted Selection.
One, DNA is extracted
1), DNA extraction damping fluid is prepared:
With embodiment 1.
2), above-mentioned rice leaf is handled as follows respectively:
With embodiment 1.
Two, Indel marker detection
1), pcr amplification
With embodiment 1.
2), electrophoresis detection
With embodiment 1.
Three, Indel marks AGPS2a-m differentiation rice grain amylose content
Be eliminated in the step 3 of embodiment 34 banding patterns of Stochastic choice continue to plant with the blue or green consistent individual plant of spy, detect through Indel molecule marker AGPS2a-m, its offspring all shows consistent banding pattern blue or green with spy, gathers in the crops these individual plant seeds respectively and measures its amylose content.In addition, the individuality of Stochastic choice wherein 1 heterozygosis banding pattern (simultaneously having the warm and fine special leukorrhagia with greenish discharge type of Japan) is for continuing plantation, random selecting 12 individual plants in its offspring, Indel molecule marker AGPS2a-m detects and shows, 3 individual plants are had to show special leukorrhagia with greenish discharge type in these 12 individual plants, 6 individual plant performance heterozygosis banding patterns, 3 Japanese fine banding patterns of performance, meet the separation relation of 1:2:1; After plant to be planted maturation, gather in the crops these individual plants respectively and measure the amylose content of its seed.Table 1 is the amylose content of the Rice Kernel of these 16 individual plants (strain), and 4 individual plants consistent with special leukorrhagia with greenish discharge type all show the blue or green similar high amylose content with spy; And in 12 offspring's individual plants of banding pattern heterozygosis, have 9 individual plants to show high amylose content (wherein, the banding pattern of 3 individual plants shows special leukorrhagia with greenish discharge type, the banding pattern performance heterozygosis banding pattern of 6 individual plants) that is similar and spy green grass or young crops; 3 individual plants in Japanese fine banding pattern, its amylose content is significantly lower than special blue or green.This experimental result shows: Indel molecule marker AGPS2a-m may be used for differentiating rice grain amylose content.
The genotype of table 1. rice grain amylose content and correspondence thereof
Note: in bracket, letter represents the genotype of this individual plant, and T is special leukorrhagia with greenish discharge type, and H is heterozygosis banding pattern, and N is Japanese fine banding pattern
Finally, it is also to be noted that what enumerate above is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be had.All distortion that those of ordinary skill in the art can directly derive from content disclosed by the invention or associate, all should think protection scope of the present invention.
Claims (4)
1. the molecule marker AGPS2a-m of rice amylose content micro-control gene AGPS2a, using paddy rice as species, is characterized in that: the amplimer of described molecule marker is selected from following primer pair, and nucleotides sequence is wherein classified as 5 ' → 3 ',
AGPS2a-m forward: TCTTCTTTTAGATCTTAAATTTCAGA
Reverse: CACATCAAAGTTGTAGTTTTGTGA;
The sequence of molecule marker AGPS2a-m in Japan is fine of primer AGPS2a-m pcr amplification gained is: TCTTCTTTTAGATCTTAAATTTCAGAAAACTATAACTACAAGTGATAGAACTATCA GTTTGCTGTAATATTAATGATCTATTTCAGTTTTTTGCACCAATAGCATGAAAAAT TATCACAAAACTACAACTTTGATGTG;
The sequence of molecule marker AGPS2a-m in special green grass or young crops of primer AGPS2a-m pcr amplification gained is: TCTTCTTTTAGATCTTAAATTTCAGAAAACTATAACTACAACTACAGTGATAGAAC TATCAGTTTGCTGTAATATTAATGATCTATTTCAGTTTTTTGCACCAATAGCATGA AAAATTATCACAAAACTACAACTTTGATGTG.
2. the development approach of molecule marker AGPS2a-m as claimed in claim 1, is characterized in that comprising the following steps:
1), so that japonica rice variety Japan is fine carry out hybridizing, backcrossing and selfing as low amylose content gene donor parents and the special green grass or young crops of long-grained nonglutinous rice as high amylose content, thus obtain the individual plant of the rice low amylose content of offspring;
2) genomic dna of parental rice seedling and offspring seedling, is extracted by CTAB method;
3), Indel molecule marking method is adopted to carry out the screening of rice low amylose content molecule marker;
4) an Indel molecule marker AGPS2a-m, is identified.
3. the purposes of molecule marker AGPS2a-m as claimed in claim 1, is characterized in that: for amylose content of rice qualification and/or its offspring's assisted selection; This paddy rice is that Japan is warm and fine special blue or green.
4. the purposes of molecule marker AGPS2a-m according to claim 3, is characterized in that: as special blue or green offspring warm and fine for Japan, selects individual plant that in offspring, the fine banding pattern of banding pattern and Japan is consistent for breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310581339.0A CN103602673B (en) | 2013-11-19 | 2013-11-19 | Rice amylose content micro-control gene AGPS2a molecule marker and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310581339.0A CN103602673B (en) | 2013-11-19 | 2013-11-19 | Rice amylose content micro-control gene AGPS2a molecule marker and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103602673A CN103602673A (en) | 2014-02-26 |
| CN103602673B true CN103602673B (en) | 2015-10-28 |
Family
ID=50120940
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310581339.0A Active CN103602673B (en) | 2013-11-19 | 2013-11-19 | Rice amylose content micro-control gene AGPS2a molecule marker and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103602673B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671183A (en) * | 2016-03-28 | 2016-06-15 | 浙江师范大学 | Molecular marker for rice amylose content micro-control genes AGPL3 and application of molecular marker |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106318937B (en) * | 2015-06-17 | 2019-03-15 | 深圳华大生命科学研究院 | Molecular labeling and its application |
| CN105400783B (en) * | 2015-12-21 | 2018-06-19 | 武汉大学 | Lotus Root Starch synthesizes relative enzyme gene HXK Functional markers primer and application |
| CN106591435A (en) * | 2016-11-22 | 2017-04-26 | 南京农业大学 | Molecular marker method for site of low-amylose-content gene of dark endosperm mutant w54 of japonica rice variety Koshihikari |
| CN108424974B (en) * | 2017-11-10 | 2021-09-03 | 浙江省农业科学院 | Genetic identification and molecular marker assisted breeding method for rice amylose content QTL locus qSAC3 |
| CN111394492B (en) * | 2019-08-08 | 2023-05-16 | 中国水稻研究所 | Multi-effect QTL (quantitative trait locus) and molecular marker related to regulation and control of amylose content and viscosity of rice and application of multi-effect QTL and molecular marker |
| CN116334127B (en) * | 2023-03-29 | 2024-01-26 | 青岛农业大学 | Cloning method and application of peanut kernel soluble sugar content regulating gene AhSS1 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102747153A (en) * | 2012-07-03 | 2012-10-24 | 董志平 | Millet waxy gene cosegregation molecular marker and detection method thereof |
-
2013
- 2013-11-19 CN CN201310581339.0A patent/CN103602673B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102747153A (en) * | 2012-07-03 | 2012-10-24 | 董志平 | Millet waxy gene cosegregation molecular marker and detection method thereof |
Non-Patent Citations (2)
| Title |
|---|
| Discovery of polymorphisms in starch-related genes in rice germplasm by amplification of pooled DNA and deeply parallel sequencing;Ardashir Kharabian-Masouleh et al.;《Plant Biotechnology Journal》;20111231;第9卷;第107段左栏第3-4段，表2和3 * |
| 糯稻淀粉品质性状与淀粉合成相关基因的关联分析;张敢;《中国优秀硕士学位论文全文数据库（电子期刊）农业科技辑D047-127》;20130815;第一章1.4，表1.2 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105671183A (en) * | 2016-03-28 | 2016-06-15 | 浙江师范大学 | Molecular marker for rice amylose content micro-control genes AGPL3 and application of molecular marker |
| CN105671183B (en) * | 2016-03-28 | 2019-05-07 | 浙江师范大学 | Rice amylose content micro-control gene AGPL3 molecular labeling and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103602673A (en) | 2014-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103602673B (en) | Rice amylose content micro-control gene AGPS2a molecule marker and application | |
| CN103602674B (en) | The molecule marker of rice amylose content micro-control gene SSIVb and application | |
| CN103602675B (en) | Molecular marker of rice amylose content micro-control gene GBSSII and application | |
| Jauhar et al. | Cytogenetic and molecular characterization of a durum alien disomic addition line with enhanced tolerance to Fusarium head blight | |
| CN106011287B (en) | The molecular labeling in the site rice bacterial leaf streak major gene resistance BLS1 and its application | |
| CN103993011B (en) | Semen Sesami dominant genic male sterility gene molecule marker and preparation method and application | |
| CN106755480A (en) | A kind of SSR molecular marker I for identifying Gala apple Progeny plants and its application | |
| CN108588272A (en) | A kind of molecular labeling and its application with Plant Height in Wheat and spike length character main effect QTL compact linkage | |
| CN106244678B (en) | The molecular labeling of rice bacterial leaf streak major gene resistance BLS1 and its application | |
| CN105671042A (en) | Molecular marker for rice amylose content micro-control genes SSIII-1 and application of molecular marker | |
| Ma et al. | Construction of chromosome segment substitution lines of Dongxiang common wild rice (Oryza rufipogon Griff.) in the background of the japonica rice cultivar Nipponbare (Oryza sativa L.) | |
| CN103865925B (en) | Flag leaf width of rice regulatory gene NAL1 molecule marker and application thereof | |
| CN102586240B (en) | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof | |
| CN105671183B (en) | Rice amylose content micro-control gene AGPL3 molecular labeling and application | |
| AU2020103461A4 (en) | Molecular marker of rice amylose content micro-control gene SSIIIb and application thereof | |
| Han et al. | Development and identification of two novel wheat-rye 6R derivative lines with adult-plant resistance to powdery mildew and high-yielding potential | |
| CN105861725B (en) | The molecular labeling of rice amylose content micro-control gene AGPL1 and application | |
| CN105838819B (en) | The molecular labeling of rice amylose content micro-control gene ISA and application | |
| CN106048011A (en) | Molecular marker of rice grain AC (amylose content) micro-control gene SSIIIb and application | |
| CN110423838A (en) | The molecular labeling of main effect QTL section close linkage related to corn seed keeping quality is located at and its application | |
| Chen et al. | Genetic background of the citrus landrace ‘Huarongdao Zhoupigan’revealed by simple sequence repeat marker and genomic analyses | |
| CN103160583A (en) | Method for classifying sterile genes RNaseZ of paddy rice temperature-sensitive male nucleus | |
| CN110373487A (en) | One kind InDel label relevant to capsicum pungent character and its application | |
| Walker et al. | Optimizing the breeding of pierce's disease resistant Winegrapes with marker-assisted selection | |
| Wei et al. | Quantitative trait locus analysis for grain size related traits of rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |