CN105838819B - The molecular labeling of rice amylose content micro-control gene ISA and application - Google Patents
The molecular labeling of rice amylose content micro-control gene ISA and application Download PDFInfo
- Publication number
- CN105838819B CN105838819B CN201610389803.XA CN201610389803A CN105838819B CN 105838819 B CN105838819 B CN 105838819B CN 201610389803 A CN201610389803 A CN 201610389803A CN 105838819 B CN105838819 B CN 105838819B
- Authority
- CN
- China
- Prior art keywords
- rice
- isa
- amylose content
- nipponbare
- oryzasativalcv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the molecular labeling ISA-m of rice amylose content micro-control gene ISA a kind of, using rice as species, the molecular labeling primer is selected from following primer pair, and nucleotides sequence therein is classified as 5 ' → 3 ', ISA-m forward direction: ATAGATGCTAATGTGATGTGGC；It is reversed: TGGTATAGGCACAACCGTAGA.Molecular labeling ISA-m can be used for amylose content of rice identification and/or its offspring's assisted selection.
Description
Technical field
The invention belongs to agricultural biotechnology engineerings, in particular to related with rice grain amylose content controlling gene ISA
Molecular labeling ISA-m and its preparation method.
Background technique
The target of high yield, high-quality always rice breeding long-sought.By long-term effort, especially hybrid paddy rice technology
Utilization, China achieves universally acknowledged achievement in Rice Production.But since how one straight grip of past solves people's
Problem of food and clothing is placed above the other things, so the emphasis of rice breeding work is largely focused on the cultivation of new high-yielding rice varieties, from
And the breeding of fine quality rice is caused seriously to lag, the universal deviation of hybrid paddy rice quality of especially some high yields.
Another main cause for causing grain quality improving progress slower is the complexity and tradition of rice quality heredity
The limitation of breeding technique.The quality trait of rice includes exterior quality, processing quality, cooking quality, nutritional quality and food flavor
All various aspects such as quality, and Rice Cooking is the most important index for evaluating rice quality.Cooking quality refers to that rice is steaming
The characteristic showed during boiling, mainly by amylose content (Amylose Content, AC), gel consistence (Gel
Consistency, GC), gelatinization point (Gelatinization Temperature, GT) three physical and chemical indexes evaluate,
Middle AC is to influence the most important physical and chemical index of rice quality.Breeding scholar and geneticist have done a large amount of work to seek rice
The genetic base of AC, however the result of different experiments room has biggish difference.Early stage research shows that rice AC is by one
A major gene resistance control, and by the regulation of other minor effects QTL [1,2].Subsequent research discovery Waxy (Wx) is for rice AC
Number have conclusive effect, may be exactly the major gene resistance [3-5] for controlling AC.1 master is detected on body except contaminating the 6th
It imitates outside QTL, the minor effect QTL number and position that difference research detects are very inconsistent.For example, Tan etc. is examined on the 1st, 2 chromosomes
Two minor effect QTLs [6] are measured, He etc. detects a minor effect QTL [6] in the 5th chromosome, and Aluko etc. is in the 3rd and 8 dyes
Minor effect QTLs [7] are detected on colour solid respectively.The researchs such as Huang Zuliu find other than the Wx gene loci of the 6th chromosome,
3rd chromosome also detects that the main effect QTL of a control rice AC；Other 5 minor effect QTLs are located at the 4th, 4,6,9,11
On the different seats of chromosome [8].Other laboratories have also detected that the QTLs [9] of control AC in the 4th, 6,7 chromosomes.Wu is long
Bright wait is not found QTL site related with AC on the 6th chromosome, only finds 5 on the 1st, 7,8,9,12 chromosome
A QTL site [10].
Another main cause for causing grain quality improving progress slower is the limitation in traditional breeding method means.Tradition
Breeding method is mainly oriented selection and fixation to favo(u)rable target character, cultivates improved Varieties, this has very big
Blindness and unpredictability [11].Also, the method for individual choice is carried out directly to the economical character for meeting breeding objective
Selection, i.e., selection is individual phenotype rather than genotype.Since there are one between gene because of multiple-effect, mostly because of an effect, regulation base
Because and modifier etc. effect, often there is larger difference in individual Phenotype and genotype, thus pass through field phenotype
The accuracy that character carries out individual choice is poor.Molecular marker assisted selection (Marker-assisted Selection, MAS)
Technology provides new approach to rice breeding, combines with traditional breeding technology and is greatly improved breeding efficiency, shortens breeding
Period.The core of MAS is the Phenotypic Selection in conventional breeding to be converted into genotype selection, it directly reflects the sequence of DNA
Difference is not influenced by gene expression, and result reliability is strong, and not by the growth and development stage of plant and the shadow of environmental condition
It rings [12].
Bibliography involved in above is as follows:
1.Bollich C.W.,BD.Inheritance of amylose in two hybrid populations of
Rice.Cereal Chem.1973,50,631-636 (Bollich C.W., BD. amylose content in two hybrid Populations
Heredity, cereal chemistry .1973.50:631-636)；
2.McKenzie K.R.,JN.Genetic analysis of amylose content,alkali
spreading score,and grain dimensions in rice.Crop Sci.1983,23,306-311
(the genetic analysis crop science .1983 of McKenzie K.R., JN. content of amylose in rice, caustic SCC and Grain Morphology,
23:306-311)；
3.Sano Y.Differential regulation of waxy gene expression in rice
Endosperm.Theor.Appl.Genet.1984,68,467-473 (the difference of Sano Y. paddy endosperm waxy gene expression
Regulate and control theory and apply heredity .1984,68:467-473)；
4.Kumar I.K.,G S.Juliano,B O.Genetic analysis of waxy locus in rice
(Oryza sativa L.).Theor.Appl.Genet.1987,73,481-488(Kumar I.K.,G S.Juliano,B
O. the genetic analysis in paddy endosperm waxy gene site is theoretical and applies heredity .1987,73:481-488)；
5.Kumar I.K.,GS.Inheritance of amylose content in rice(Oryza sativa
L.) .Euphytica 1988,38,261-269. (the hereditary European plant of Kumar I.K., GS. content of amylose in rice
Learn .1988,38:261-269)
6.Tan Y.F.,Li J.X.,Yu S.B.,et al.The three important traits for
cooking and eating quality of rice grains are controlled by a single locus in
an elite rice hybrid,Shanyou 63.Theor.Appl.Genet.1999,99,642-648(Tan Y.F.,Li
J.X., Yu S.B. waits three important indicators of the excellent hybrid paddy rice Shanyou 63 rice cooking and eating quality of to be controlled reason by unit point
By and using heredity .1999,99:642-648)；
7.Aluko G.,Martinez C.,Tohme J.,et al.QTL mapping of grain quality
traits from the interspecific cross Oryza sativa x O.glaberrima.Theor.Appl.G
(Aluko G., Martinez C., Tohme J. waits Rice Kernel character to cultivate in Asia to enet.2004,109,630-639
QTL positioning in rice and Oryza glaberrima Steud interspecific hybridization group is theoretical and applies heredity .2004,109:630-639)；
8. Huang Zuliu, and Tan Xuelin, the molecule of Tragoonrung S., et al. rice grain amylose content gene locus
Label positioning Acta Agronomica Sinica 2000,26,777-782；
9.Lanceras J.C.,Huang Z.L.,Naivikul O.,et al.Mapping of genes for
cooking and eating qualities in Thai jasmine rice(KDML105).DNA Res.2000,7,93-
101 (Lanceras J.C., Huang Z.L., Naivikul O., waits the gene mapping of THAI Fragrant rice cooking and eating quality
.DNA .2000,7:93-101 is studied)；
10. Wu is kept burning day and night, Sun Chuanqing, Chen Liang, waits the QTL of content of amylose in rice and indica japonicadifferentiation and its mutually close
System research China Agricultural University journal 2000,5,6-11；
11. the tactful Molecular Plant Breeding 2005,3,603-608 of Li Zhi health China's Rice molecular breeding plan；
12. Feng builds up application China agronomy notification 2006,22 of the Molecular Marker Assisted Selection Technology on rice breeding,
43-47。
Summary of the invention
The technical problem to be solved in the present invention is to provide one kind synthesize with rice starch the related molecular labeling of gene ISA and
Its purposes, the molecular labeling that the resulting molecular labeling ISA-m of the present invention is rice amylose content micro-control gene ISA, can use
In rice grain amylose content identification and corresponding assisted selection.
In order to solve the above technical problem, the present invention provides the molecules of rice amylose content micro-control gene ISA a kind of
Mark ISA-m, using rice as species, the molecular labeling primer selected from following primer pair, nucleotides sequence therein is classified as 5 ' →
3 ',
ISA-m is positive: ATAGATGCTAATGTGATGTGGC
It is reversed: TGGTATAGGCACAACCGTAGA.
The present invention also provides the development approaches of above-mentioned molecular labeling ISA-m, for example including following steps:
1), using japonica rice variety OryzasativaLcv.Nipponbare as low amylose content gene donor parents and as the spy of high amylose starches
Blueness is hybridized, is returned and is selfed, to obtain the single plant of the rice low amylose content as offspring；
2), with CTAB (cetyltriethylammonium bromide, Hexadecyl trimethyl ammonium Bromide)
Method extracts parental rice seedling and offspring's seedling genomic DNA；
3), low using Indel (insertion/deletion segment, insertion/deletions) molecule labelling method progress rice
The screening of amylose content gene label；
4) an Indel molecular labeling ISA-m, is developed.
Molecular labeling ISA-m related with rice low amylose content, is specifically obtained with following methods:
1), according to the nucleotide sequence of gene ISA, design develops Indel molecular labeling, for detecting low amylose
Content OryzasativaLcv.Nipponbare and the special green polymorphism of high amylose content；The sequence in the section primer I SA-m is further determined that by being sequenced
The difference being listed between the OryzasativaLcv.Nipponbare of low amylose content and the spy blueness of high amylose content；By hybridization, backcrossing and from
Knot closes marker assisted selection, obtains the rice new germ plasm of the low amylose content of special green background；
2) parental rice seedling and offspring's seedling genomic DNA, are extracted with CTAB method；
3), low straight chain is screened using the genetic marker that Indel molecule labelling method carries out rice low amylose content to form sediment
The rice new germ plasm of powder content；
4) it, identifies an Indel molecular labeling ISA-m and finds itself and rice grain amylose content through polymorphic detection
It is associated.
The present invention goes back while providing the purposes of above-mentioned molecular labeling ISA-m, reflects for amylose content of rice
Fixed and/or its offspring's assisted selection.
The improvement of purposes as molecular labeling ISA-m of the invention: when screening OryzasativaLcv.Nipponbare and long-grained nonglutinous rice (including special green, osmanthus
Towards No. 2) offspring when, select banding pattern and the consistent single plant of OryzasativaLcv.Nipponbare banding pattern in offspring to be used for subsequent breeding improvement.
Sequence of the resulting molecular labeling ISA-m of primer I SA-m PCR amplification in OryzasativaLcv.Nipponbare are as follows:
ATAGATGCTAATGTGATGTGGCAGCACCGACGTCACACCTGTGACATCTGGCCATATGTCTACAGCTA
ATGCTGTGTTTTGTTCAATTTTTATTAAAGGCAAATAAATATCTATATCTAC GGTTGTGCCT ATACCA。
Sequence of the resulting molecular labeling ISA-m of primer I SA-m PCR amplification in special blueness are as follows:
ATAGATGCTAATGTGATGTGGCAGACACCTGTGACATCTGGCCATATGTCTACAGCTAATGCTGTGTT
TTGTTCAATTTTTATTAAAGGCAAATAAATATCTATATCTACGGTTGTGCCT ATACCA。
It is specifically using the method that Indel molecular labeling ISA-m carries out rice grain amylose content screening:
(1), DNA polymorphism point of the Indel label between high and low rice grain amylose content kind OryzasativaLcv.Nipponbare and special blueness
Analysis:
According to the nucleotide sequence of gene ISA, design develops Indel molecular labeling ISA-m, forms sediment for detecting low straight chain
Polymorphism between the OryzasativaLcv.Nipponbare of powder content and the spy blueness of high amylose content.Primer entrusts Shen Neng betting office in Shanghai to close
At carrying out PCR amplification, PCR reaction system on PTC-225PCR instrument are as follows: 20ng/ul oryza sativa genomic dna 1ul, 10 × PCR
Buffer 2.0ul,25mM MgCl22.0ul, 2mM dNTP 2.0ul, 10uM primer 2 .0ul, 5U/ul Taq DNA polymerization
Enzyme 0.2ul, ddH2O 10.8ul, total system 20ul.Response procedures: 95 DEG C are denaturalized 5 minutes；94 DEG C are denaturalized 1 minute, 55 DEG C of annealing
1 minute, 72 DEG C extended 1 minute, 40 circulations；72 DEG C polishing 10 minutes；Product detection: containing 0.5%ug/ul EB's
4.0% agarose gel electrophoresis, observation and film recording result under ultraviolet lamp.
(2), Indel marks the sequence of interval of ISA-m between low, high rice grain amylose content kind OryzasativaLcv.Nipponbare and special blueness
Genome sequence difference:
According to the Indel molecular labeling ISA-m of acquisition, it to be used for PCR amplification low amylose content kind OryzasativaLcv.Nipponbare and height
The special green genome sequence of amylose content kind, pcr amplification product entrust Ying Jun Bioisystech Co., Ltd in Shanghai to carry out
Sequencing analysis.PCR amplification is carried out referring to above-mentioned (1), and the recycling of PCR product selects hundred Tyke Bioisystech Co., Ltd of Beijing to open
The PCR product QIAquick Gel Extraction Kit (centrifugal column type, catalog number (Cat.No.): DP1403) of hair.
(3), carry out the assisted selection of low amylose content using Indel label ISA-m
Genetic donor parent's OryzasativaLcv.Nipponbare of low amylose content, with the special green progress of the rice variety of high amylose content
Hybridization, by being returned, being selfed binding marker assisted Selection, imported into Gao Zhi for the low amylose content gene ISA of OryzasativaLcv.Nipponbare
In the spy blueness of chain content of starch, selects banding pattern and the consistent single plant of OryzasativaLcv.Nipponbare banding pattern in segregating population to be used for breeding improvement, obtain
The material with OryzasativaLcv.Nipponbare ISA gene of the special green backgrounds of several pieces；The seed tied on these plant is harvested, its straight chain shallow lake is detected
Powder content finds that its amylose content significantly reduces.
Amylose content height is the inferior main factor of rice quality.The present invention uses molecular biology method with low
The OryzasativaLcv.Nipponbare of amylose content is material, development and screening it is new and also stable can reduce rice grain amylose content
Molecular labeling and its method, the assisted selection for fine quality rice；Since the material for studying used can be effectively reduced generally
The amylose content of rice has generality to the improvement of China's rice quality.
The Indel of the invention rice starch synthesis related gene ISA marks ISA-m.With this method, not only
The disadvantages of period is long the time required to overcoming conventional breeding methods, can be targetedly by the low amylose content base of OryzasativaLcv.Nipponbare
Because ISA selects to obtain in laboratory and purposefully carries out multiple good polymerizations, to cultivate with good rice
New varieties.In the present invention, when gained plant the band of OryzasativaLcv.Nipponbare occurs through detection, we determine that it belongs to low amylose
The rice of content；When gained plant the band of special blueness occurs through detection, we determine that it belongs to the water of high amylose content
Rice；When gained plant is through detecting while the band of special blueness+OryzasativaLcv.Nipponbare occur, we determine that it may belong to high amylose starches and contain
The rice of amount.
Label choosing between the applicable most long-grained nonglutinous rice (such as special green, Gui Chao 2) of the present invention and japonica rice (such as OryzasativaLcv.Nipponbare)
It selects.
Therefore, result of the present invention is of great significance in the practice of rice quality breeding.Its advantage is specifically summarized as follows:
(1) molecular labeling that can regulate and control rice grain amylose content of the invention is by low amylose content
The long-grained nonglutinous rice of japonica rice OryzasativaLcv.Nipponbare and high amylose content it is special it is green hybridize, screening obtains in backcrossing and selfing, can significantly reduce
Rice grain amylose content, and be stabilized, it can be used for the assisted selection of fine quality rice.
(2) present invention is based on the Indel molecule that rice starch synthesizes the nucleotide sequence development of gene ISA and obtains
ISA-m is marked, ISA-m of the invention and GBSSII-m, SSIVb-m are in different chromosomes, although ISA-m and AGPS2a-m is equal
It positioned at the 8th chromosome, but is obviously to belong to different positions.And the present invention marks screened better effect, and is greatly improved
The efficiency of assisted Selection, that is, label of the invention can make the effect of the assisted selection of rice low amylose content more
It is good.
Detailed description of the invention
Specific embodiments of the present invention will be described in further detail with reference to the accompanying drawing.
Fig. 1 is Indel label ISA-m in the japonica rice OryzasativaLcv.Nipponbare of low amylose content, the long-grained nonglutinous rice of high amylose content
Special green, F1 electrophoretic band figure；
Fig. 2 is sequence difference of the pcr amplification product of primer I SA-m between OryzasativaLcv.Nipponbare and special blueness；
Fig. 3 is the OryzasativaLcv.Nipponbare for 9 parts of low amylose contents that Indel label ISA-m identification the obtains offspring green with spy
Electrophoretic band figure；
Fig. 4 is the amylose content for marking 9 parts of materials of ISA-m assist-breeding；
Symbol in above-mentioned Fig. 1, Fig. 3~4 is explained as follows respectively:
1 represents: the japonica rice OryzasativaLcv.Nipponbare of low amylose content；
2 represent: the long-grained nonglutinous rice of high amylose content is special green；
3 represent: OryzasativaLcv.Nipponbare/spy blueness F1 plant；
4,5,6,7,8,9,10,11,12 represent: OryzasativaLcv.Nipponbare and special green offspring, the screening through Indel label ISA-m
After obtain.
Specific embodiment
Embodiment 1 is contained with the japonica rice OryzasativaLcv.Nipponbare and high amylose starches of Indel label ISA-m identification low amylose content
The special green polymorphism of the long-grained nonglutinous rice of amount
Specific practice is: choosing rice material OryzasativaLcv.Nipponbare from China Paddy Rice Inst's germplasm resource bank and spy is green, with day
This warm and fine special green hybridization obtains its F1, identifies its polymorphism (Fig. 1) using primer I SA-m.
One, DNA is extracted
1) DNA Extraction buffer, is prepared:
The DNA of 1 volume is successively added to extract solution (0.35M sorbitol in order；0.1M Tris,pH8.2；0.005M
EDTA；Remaining is water), karyorhexis liquid (the 0.2M Tris, pH7.5 of 1 volume；0.05M EDTA；2M NaCl；0.055M
CTAB；Remaining is water) and 0.4 volume 5% (mass concentration) sarkosyl solution (i.e. lauroyl-sarcosine sodium
Aqueous solution)；It is eventually adding sodium hydrogensulfite, is configured to DNA Extraction buffer；Sodium hydrogensulfite is in DNA Extraction buffer
Final concentration of 0.02M.
Above-mentioned DNA extract solution the preparation method comprises the following steps: in the sorbitol (D-sorbite) of 0.35mol, 0.1mol
Tris (trishydroxymethylaminomethane, pH8.2), 0.005mol EDTA (ethylenediamine tetra-acetic acid) Zhong Jiashui be settled to 1L.
Above-mentioned karyorhexis liquid the preparation method comprises the following steps: 0.2mol Tris (trishydroxymethylaminomethane, pH7.5),
CTAB (the cetyl trimethyl of the EDTA (ethylenediamine tetra-acetic acid) of 0.05mol, the NaCl (sodium chloride) of 2mol, 0.055mol
Ammonium bromide) add water to be settled to 1L.
2), above-mentioned OryzasativaLcv.Nipponbare, special green, F1 rice leaf are handled as follows respectively:
1., weigh the rice leaf liquid nitrogen grinding powdering of 0.1g, the above-mentioned steps 1 of 700 μ l are then added) prepare
DNA Extraction buffer, 65 DEG C water-bath 40 minutes.Again plus the chloroform of 700 μ l: isoamyl alcohol (volume ratio of 24:1), and mix.10,
000rpm is centrifuged 5 minutes, supernatant is transferred in new centrifuge tube.
2., after 1. above-mentioned steps are centrifuged in resulting supernatant plus the isopropanol of 2/3~1 times of volume pre-cooling (to 4 DEG C),
It mixes gently to DNA and precipitates.13,000rpm centrifugations 8 minutes, pour out supernatant.
3., with the 200 μ l of alcohol of 70% (volumetric concentration) wash above-mentioned steps 2. resulting DNA sediment again.
4., the DNA after above-mentioned washing is dried and is dissolved in 100 μ l TE buffers or pure water.
5., the concentration of ultraviolet spectrophotometry detection above-mentioned steps 4. resulting DNA sample, 0.7% Ago-Gel
The integrality of electrophoresis detection DNA.Complete suitable DNA is used for PCR amplification, and incomplete DNA is then extracted again, until having obtained
Whole DNA.
Two, PCR amplification
1), reaction system:
Oryza sativa genomic dna 20ng/ul 1ul, 10 × PCR Buffer 2.0ul, 25mM MgCl22.0ul, 2mM
DNTP 2.0ul, 10uM primer each 1.0ul, 5U/ul Taq archaeal dna polymerase 0.2ul, ddH2O 10.8ul, total system 20ul.
The primer are as follows: ISA-m is positive: ATAGATGCTAATGTGATGTGGC
It is reversed: TGGTATAGGCACAACCGTAGA；
2), response procedures:
95 DEG C are denaturalized 5 minutes；94 DEG C are denaturalized 1 minute, and 55 DEG C are annealed 1 minute, and 72 DEG C extend 1 minute, 40 circulations；72℃
Polishing 10 minutes.
Three, electrophoresis detection
Amplified production 20ul is taken, with 4.0% Ago-Gel (containing 0.5%ug/ul EB) electrophoresis, is seen under ultraviolet lamp
Examine simultaneously film recording result.As shown in Figure 1.
In Fig. 1, OryzasativaLcv.Nipponbare is the band of 136bp, and the special green band for being 126bp, " F1 " is the item of 136bp+126bp
Band.
According to Fig. 1, we can obtain following conclusions: Indel molecular labeling ISA-m is able to detect between special green and OryzasativaLcv.Nipponbare
Polymorphism, and the pcr amplification product segment of OryzasativaLcv.Nipponbare is greater than special blueness, and special green and OryzasativaLcv.Nipponbare can be used for by being indicated above ISA-m
Between Molecular Detection and its offspring marker assisted selection.
Embodiment 2 is formed sediment with the japonica rice OryzasativaLcv.Nipponbare and high straight chain of Indel molecular labeling ISA-m identification low amylose content
The special green sequence difference of the long-grained nonglutinous rice of powder content
Specific practice is: carrying out PCR expansion to OryzasativaLcv.Nipponbare and special green genomic DNA using Indel molecular labeling ISA-m
Increase, amplified production commission Shanghai Ying Jun Bioisystech Co., Ltd is sequenced, and the difference (Fig. 2) of its sequence is compared.
One, DNA is extracted
1) DNA Extraction buffer, is prepared:
With embodiment 1.
2), above-mentioned OryzasativaLcv.Nipponbare and special green rice leaf are handled as follows respectively:
With embodiment 1.
3) PCR amplification
With embodiment 1.
4) recycling of PCR product
PCR product recycling select hundred Tyke Bioisystech Co., Ltd of Beijing exploitation PCR product QIAquick Gel Extraction Kit (from
Stem type, catalog number (Cat.No.): DP1403), it requires to carry out referring to the description of product, the PCR product of recycling entrusts Shanghai English fine horse biotechnology
Co., Ltd is sequenced.
According to fig. 2, we can be concluded that OryzasativaLcv.Nipponbare and special green ISA-m amplified production there are the bases of 10bp
Difference (as shown in the underscore in Fig. 2), this is that we are able to use Indel molecular labeling ISA-m and detect its polymorphism
Where reason and we can be used for the hereditary basis of its offspring's marker assisted selection.
Embodiment 3, the assisted selection for carrying out low amylose content using Indel label ISA-m
Specific practice is: genetic donor parent's OryzasativaLcv.Nipponbare of low amylose content, the long-grained nonglutinous rice with high amylose content
Kind spy blueness hybridizes, is returned and is selfed, to the assisted Selection of gained offspring's binding molecule label ISA-m, selection separation group
Banding pattern and the consistent single plant of OryzasativaLcv.Nipponbare banding pattern are used for breeding improvement in body.
One, DNA is extracted
1) DNA Extraction buffer, is prepared:
With embodiment 1.
2), above-mentioned OryzasativaLcv.Nipponbare, special green, gained offspring rice leaf are handled as follows respectively:
With embodiment 1.
Two, Indel label detection
1), PCR amplification
With embodiment 1.
2), electrophoresis detection
With embodiment 1.
Three, Indel molecular labeling ISA-m carries out the assisted selection of low amylose content
The genetic donor japonica rice variety OryzasativaLcv.Nipponbare of low amylose content and the common rice variety of high amylose content
Special blueness is hybridized, is returned and is selfed, and binding molecule marks the assisted Selection of ISA-m, selects banding pattern and Japan in segregating population
The fine consistent single plant of banding pattern is further used for breeding improvement (Fig. 3), eliminates banding pattern and the special green banding pattern one of high amylose content
It causes and the individual of heterozygosis banding pattern (while having OryzasativaLcv.Nipponbare and special leukorrhagia with greenish discharge type), the rice grain amylose content of breeding material uses state
Family's standard (GB/T15683-2008) is detected.Analysis shows selected 9 with OryzasativaLcv.Nipponbare banding pattern single plant compares circulation
Parent spy blueness is substantially reduced (Fig. 4).This is the results showed that Indel label ISA-m can be used for rice grain amylose content
Assisted selection.
Remarks explanation:
" 4~12 " in Fig. 3 and Fig. 4 are that OryzasativaLcv.Nipponbare and special blueness are successively hybridized, are returned and are selfed acquisition, and are
The single plant of " banding pattern is consistent with OryzasativaLcv.Nipponbare banding pattern " is selected.
Experiment 1 differentiates rice grain amylose content using Indel label ISA-m
Specific practice is: by the banding pattern being eliminated in the step of embodiment 3 three and the special green banding pattern of high amylose content
The individual of consistent and heterozygosis banding pattern (while having OryzasativaLcv.Nipponbare and special leukorrhagia with greenish discharge type) continues to plant, by its offspring's rice seed
The measurement of grain amylose content, the reliability of further analyzing molecules label ISA-m assisted Selection.
One, DNA is extracted
1) DNA Extraction buffer, is prepared:
With embodiment 1.
2), above-mentioned rice leaf is handled as follows respectively:
With embodiment 1.
Two, Indel label detection
1), PCR amplification
With embodiment 1.
2), electrophoresis detection
With embodiment 1.
Three, Indel marks ISA-m to differentiate rice grain amylose content
It has randomly choosed in three embodiment 3 the step of 4 banding patterns that are eliminated to continue to plant with special green consistent single plant, pass through
Indel molecular labeling ISA-m detection, offspring shows and special green consistent banding pattern, harvests these single plant seeds respectively and surveys
Its fixed amylose content.In addition, randomly choosing the individual of wherein 1 heterozygosis banding pattern (while there is OryzasativaLcv.Nipponbare and special leukorrhagia with greenish discharge type)
For continuing to plant, 12 single plants are randomly selected in generation behind, Indel molecular labeling ISA-m detection shows 12 single plants
In there are 3 single plants to show special leukorrhagia with greenish discharge types, 6 single plants show heterozygosis banding patterns, and 3 performance OryzasativaLcv.Nipponbare banding patterns meet the separation of 1:2:1
Relationship；After plant is mature, these single plants are harvested respectively and measure the amylose content of its seed.Table 1 is this 16 single plants
The amylose content of the Rice Kernel of (strain), 4 show and special green similar Gao Zhi with the special consistent single plant of leukorrhagia with greenish discharge type
Chain content of starch；And in 12 offspring's single plants of banding pattern heterozygosis, there are 9 single plants to behave like and contains with special green high amylose starches
Amount (wherein, the banding pattern of 3 single plants shows special leukorrhagia with greenish discharge type, and the banding pattern of 6 single plants shows heterozygosis banding pattern)；3 are in OryzasativaLcv.Nipponbare banding pattern
Single plant, amylose content is substantially less than special green.It should be the results showed that Indel molecular labeling ISA-m can be used for sentencing
Other rice grain amylose content.
1. rice grain amylose content of table and its corresponding genotype
Note: letter represents the genotype of the single plant in bracket, and T is special leukorrhagia with greenish discharge type, and H is heterozygosis banding pattern, and N is OryzasativaLcv.Nipponbare banding pattern
Comparative example 1, with ISA-m forward and reverse primer homology high label ISA-m-1 and ISA-m-2 (such as table 2, it is therein
Nucleotides sequence is classified as 5 ' → 3 ')；The above method according to the invention is detected, and finds the two label expanding effects very not
It is good, occur without band or there are many non-characteristic band, it is impossible to be used in differentiates rice grain amylose content, that is, can't be rice
Rice amylose content micro-control gene molecule marker.
Table 2
| It is positive | Reversely | |
| ISA-m-1 | attaatgcta atgtgatgtg gc | taatataggc acaaccgtag a |
| ISA-m-2 | atttatgcta atgtgatgtg gc | ttatataggc acaaccgtag a |
Comparative example 2, by 4 kinds of molecular labeling AGPS2a-m, SSIVb-m, GBSSII-m, ISA-m (this hairs as described in Table 3
It is bright) it is tested according to 3 the method for embodiment, at this point, the genetic donor parent of low amylose content is still OryzasativaLcv.Nipponbare, it is high
The rice variety of amylose content has been changed to osmanthus towards No. 2 by special blueness.
Table 3
| It is positive | Reversely | |
| AGPS2a-m | TCTTCTTTTAGATCTTAAATTTCAGA | CACATCAAAGTTGTAGTTTTGTGA |
| SSIVb-m | ATTTTCCTCAGTAGTAAGCAAGAGTT | AAAACATTGCTCCAAAACAGC |
| GBSSII-m | TGTCAGTCGCTGTCCTCGTA | GATCTCATCCCATGCTAAGTTACT |
| ISA-m | ATAGATGCTAATGTGATGTGGC | TGGTATAGGCACAACCGTAGA |
Banding pattern and the consistent single plant of OryzasativaLcv.Nipponbare banding pattern, the rice grain amylose content of breeding material in segregating population is selected to adopt
It is detected with national standard (GB/T 15683-2008).
The selected amylose content in OryzasativaLcv.Nipponbare banding pattern single plant with recurrent parent osmanthus towards the result compared with No. 2 such as
The following table 4:
Table 4
This experiment has carried out repetition several times, as a result described in basic as above table 4.
The above list is only a few specific embodiments of the present invention for finally, it should also be noted that.Obviously, this hair
Bright to be not limited to above embodiments, acceptable there are many deformations.Those skilled in the art can be from present disclosure
All deformations for directly exporting or associating, are considered as protection scope of the present invention.
Claims (1)
1. a kind of purposes of molecular labeling ISA-m, it is characterized in that: using japonica rice variety OryzasativaLcv.Nipponbare as low amylose content base
Because donor parents are hybridized, are returned and are selfed with the long-grained nonglutinous rice as high amylose content, to gained offspring's binding molecule mark
Remember that banding pattern and the consistent single plant of OryzasativaLcv.Nipponbare banding pattern are used for breeding in ISA-m identification amylose content and/or offspring；The Xian
Rice is special blueness, Gui Chao 2；
The molecular labeling primer is selected from following primer pair, and nucleotides sequence therein is classified as 5 ' → 3 ',
ISA-m is positive: ATAGATGCTAATGTGATGTGGC
It is reversed: TGGTATAGGCACAACCGTAGA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610389803.XA CN105838819B (en) | 2016-06-02 | 2016-06-02 | The molecular labeling of rice amylose content micro-control gene ISA and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610389803.XA CN105838819B (en) | 2016-06-02 | 2016-06-02 | The molecular labeling of rice amylose content micro-control gene ISA and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105838819A CN105838819A (en) | 2016-08-10 |
| CN105838819B true CN105838819B (en) | 2019-09-17 |
Family
ID=56575487
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610389803.XA Active CN105838819B (en) | 2016-06-02 | 2016-06-02 | The molecular labeling of rice amylose content micro-control gene ISA and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105838819B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591435A (en) * | 2016-11-22 | 2017-04-26 | 南京农业大学 | Molecular marker method for site of low-amylose-content gene of dark endosperm mutant w54 of japonica rice variety Koshihikari |
| CN108424974B (en) * | 2017-11-10 | 2021-09-03 | 浙江省农业科学院 | Genetic identification and molecular marker assisted breeding method for rice amylose content QTL locus qSAC3 |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101491212B (en) * | 2009-03-10 | 2011-11-30 | 四川省农业科学院作物研究所 | Marker-assisted selection quick cultivation method of rice strain containing amylase of middle content |
| CN103602675B (en) * | 2013-11-19 | 2016-03-09 | 中国水稻研究所 | Molecular marker of rice amylose content micro-control gene GBSSII and application |
-
2016
- 2016-06-02 CN CN201610389803.XA patent/CN105838819B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105838819A (en) | 2016-08-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lu et al. | Efficient indica and japonica rice identification based on the InDel molecular method: Its implication in rice breeding and evolutionary research | |
| CN103602673B (en) | Rice amylose content micro-control gene AGPS2a molecule marker and application | |
| CN103602674B (en) | The molecule marker of rice amylose content micro-control gene SSIVb and application | |
| CN106754954B (en) | A kind of corn MS8 gene mutation bodies and its method for identifying molecules and application | |
| CN103602675B (en) | Molecular marker of rice amylose content micro-control gene GBSSII and application | |
| CN108504773B (en) | Molecular marker of major QTL (quantitative trait loci) site for grain weight and silique length of brassica napus and application of molecular marker | |
| CN105671183B (en) | Rice amylose content micro-control gene AGPL3 molecular labeling and application | |
| CN103333953A (en) | Method for identification of purity of two-line hybrid rice seed | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| CN108330163A (en) | Characteristic sequence, primer and the identification method of thin shell mountain pecan Peach cultivars Nacono and Sumner | |
| Ma et al. | Construction of chromosome segment substitution lines of Dongxiang common wild rice (Oryza rufipogon Griff.) in the background of the japonica rice cultivar Nipponbare (Oryza sativa L.) | |
| CN105838819B (en) | The molecular labeling of rice amylose content micro-control gene ISA and application | |
| CN105861725B (en) | The molecular labeling of rice amylose content micro-control gene AGPL1 and application | |
| CN110055348A (en) | The Functional marker of rice grain shape gene GL3 and its application | |
| CN105671042A (en) | Molecular marker for rice amylose content micro-control genes SSIII-1 and application of molecular marker | |
| CN110106271B (en) | SSR marker primer pair for assisting in selecting large-grain broad beans and application thereof | |
| Nowicka et al. | Precise karyotyping of carrot mitotic chromosomes using multicolour-FISH with repetitive DNA | |
| CN106048011A (en) | Molecular marker of rice grain AC (amylose content) micro-control gene SSIIIb and application | |
| Kishii et al. | Production of wheat-Psathyrostachys huashanica chromosome addition lines | |
| CN110423838A (en) | The molecular labeling of main effect QTL section close linkage related to corn seed keeping quality is located at and its application | |
| CN113197089B (en) | Breeding method facilitating early generation selection of soft weak gluten wheat | |
| AU2020103461A4 (en) | Molecular marker of rice amylose content micro-control gene SSIIIb and application thereof | |
| Singh et al. | Microsatellite markers revealed genetic diversity in mungbean mutant lines | |
| CN111172317B (en) | Molecular marker HSRC3911 closely linked with major QTL site in flowering phase of sesame and application thereof | |
| CN105671182B (en) | Rice gel consistency controls gene PUL molecular labeling and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210326 Address after: Room 1001, 10 / F, Baodi building, 2399 Hongxing Road, Xiuzhou District, Jiaxing City, Zhejiang Province, 314000 Patentee after: Zhejiang hetianxia Seed Industry Co.,Ltd. Address before: 310006 No. 359, Stadium Road, Xiacheng District, Zhejiang, Hangzhou Patentee before: CHINA NATIONAL RICE Research Institute |