CN103667484B - Oil content character main gene locus of rape 6F313 and applications thereof - Google Patents
Oil content character main gene locus of rape 6F313 and applications thereof Download PDFInfo
- Publication number
- CN103667484B CN103667484B CN201310658487.8A CN201310658487A CN103667484B CN 103667484 B CN103667484 B CN 103667484B CN 201310658487 A CN201310658487 A CN 201310658487A CN 103667484 B CN103667484 B CN 103667484B
- Authority
- CN
- China
- Prior art keywords
- oil content
- rape
- 6f313a10oc
- oleaginousness
- main gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an oil content character main gene locus of rape 6F313 and applications thereof. The method to find the locus comprises the following steps: (1) hybridizing a combination of rape 6F313 with a high oil content (50%) and rape Y817 with a low oil content (35%) so as to obtain F2 generation population with separated oil content character and a F2:3 family; (2) establishing a linkage map of F2 generation segregation population by utilizing the SNP chip of rape 60K, then obtaining the molecular label tightly linked with the oil content character and the main gene locus according to the oil content data of the F2 population and the F2:3 family. The invention discloses a main gene locus 6F313A10OC which locates on the A10 chromosome and controls the high oil content character of rape 6F313, and discloses two molecular labels 6F313A10OC-1 and 6F313A10OC-2 which are tightly linked with the main gene locus at the same time. The tightly linked molecular labels can detect whether rape 61616 or derivated species (line) contains a main gene QTL locus or not, thus can predict the oil content, so the breeding efficiency of high oil content rape is greatly improved.
Description
Technical field
The invention belongs to molecular biology and Biotechnology in Genetic Breeding field.More specifically relate to a kind of rape oil content character major gene resistance bit and the closely linked molecule marker of major gene loci, also relate to the application of molecule marker in the breeding of rape oleaginousness simultaneously.
Background technology
As one of large oil crops in the world four, Rape-seed production, to the effective supply ensureing China's edible vegetable oil and fat and feed protein matter, to improving foodstuff texture, promotes that the aspects such as aquaculture and processing industry development all has material impact.Although China's rapeseed cultivation area and output all rank first in the world, far can not meet domestic consumers demand, the edible vegetable oil dependence on import of about 63%.Along with the growth of the size of population and the raising of living standards of the people, expect China's edible vegetable oil consumption in 2010 and will be increased to 2,5,000,000 tons, by current industrial scale, breach will be huger.Although Oilseed market demand is like this, the enthusiasm of peasant planting rape is not high.Cause the one of the main reasons of this situation to be the rapeseed oil content about 5 percentage points of the Semen Brassicae campestris production more Canadian than leading exporter of China, and cost is high, the market competitiveness is relatively weak.Therefore, from ensureing that food oil supply security and the angle of increasing farmers' income are considered, the quantum of output increasing unit surface rapeseed oil is by a relatively large margin one of countermeasure solving As-Is.
China's rape research and breeding work have comparatively solid foundation, and some fields are in rank first.The approach of High-Oil Rapeseed Breeding mainly contains many Single-plant selection from generation to generation, species hybridization, yellow seed rape breeding and mutagenic and breeding.
In recent years, along with genomics research obtains a series of breakthrough, the successful Application of the molecular breeding technology being representative with Marker-assisted selection, transgenosis and kind molecular designing, substantially increases Crop Genetic Breeding level.Compared with conventional breeding, this technology can by analyze judge goal gene with the closely linked molecule marker of objective trait gene existence whether, and carry out Fine Mapping.Meanwhile, utilize molecule marker to carry out assisted selection, decrease blindness, shortening the breeding cycle, substantially increase efficiency of selection.The key of molecular marker assisted selection breeding technique is the qualification of the closely linked DNA molecular marker with Main Agronomic Characters.The country such as the U.S., Japan, every Western Europe country all drops into the work that huge fund carries out this respect in recent years.Along with paddy rice, the exploitation of the molecule marker of some economical characters of the important crops such as wheat, corn, cotton, soybean, utilize the molecule marker that identifies to carry out assisted selection mainly comprises the qualification of germ plasm resource, the assignment of genes gene mapping, gene add up or be polymerized, the screening and identification of allos goal gene and the structure etc. of genetic map, breeding objective comprises all respects such as disease-resistant, pest-resistant, drought resisting, high yield, quality-improving.Along with the development of biotechnology, the research of rape molecule marker day by day receives publicity, the field of research relates to the many-sides such as the structure of genetic map, genetic marker and the assignment of genes gene mapping, Genetic relationship, object innovation, marker assisted selection, and achieves impressive progress.But compared with developed countries, the rape molecular breeding research work of China also has larger gap, is mainly reflected in: effectively can not excavate and utilize the beneficial gene in germ plasm resource, lack the gene that has independent intellectual property right and Breeding value and mark etc.
Molecular marking technique conventional is at present broadly divided into two kinds, and one is based on southern hybridization technique, and another kind is then core with round pcr.Grodzicker etc. (1974) have founded restriction fragment length polymorphism (restriction fragmentlength polymorphism, RFLP) labeling technique.Botstein etc. (1980) first propose with restriction fragment length polymorphism (restriction fragment length polymorphism, be called for short RFLP) build the imagination of genetic map as genetic marker, thus started the new period utilizing molecule marker as genetic marker.Hybridize or polymerase chain reaction (polymerase chain reaction based on Southern for tens kinds subsequently, PCR) DNA molecular marker technology is set up successively, the polymorphism that these DNA molecular markers detect is mostly stochastic distribution in genomic position, therefore random dna molecule marker (random DNA markers, RDMs) can be commonly referred to as.The development of RDMs substantially increases the Efficiency of people to genome diversity, genetic mapping etc., and is widely used in the research of plant science.
Most of important economical character all shows genetics of quantitative characters feature, as yield traits, ripening stage, quality, drought resistance etc.Quantitative character is subject to the impact of envrionment conditions, and therefore Selection effect is bad.The traditional breeding way cycle is long, is mainly caused by quantitative character.Due to the development of molecular marking technique, the quantitative character of complexity can be decomposed by people, and multiple genes of paired domination number amount proterties are studied as the quality of research character gene.QTL is on highdensity genetic map basis, by certain experimental design, obtains molecule marker, determines by Mapmarker software analysis the gene position on chromosome controlling a certain proterties.When objective trait is by Marker selection during a few Gene Handling, very effective to excavation genetic potential.
Also have some to report to the QTL Position Research of Semen Brassicae campestris oleaginousness at present, the QTL number usually detected is more, but effect value is less, more difficultly applies in rapeseed breeding.This research, by genetic analysis and QTL location, is intended to screen QTL seed oil content to positive result, for the marker assisted selection of rape oleaginousness.
Summary of the invention
The present invention seeks to the major gene loci 6F313A10OC that there are provided a kind of rape oleaginousness proterties.This major gene loci not only contributes to effect and the distribution of understanding oleaginousness QTL site in 6F313 strain in depth, is that the clone of oleaginousness major gene from now on provides certain basis simultaneously.
Another object of the present invention there are provided a kind of and closely linked two molecule marker 6F313A10OC-1 and 6F313A10OC-2 of rape oil content character major gene resistance bit.Provide a great convenience with the oleaginousness proterties breeding of the closely linked molecule marker of oleaginousness to 6F313 and derivative strain thereof from now on.
Another object of the present invention there are provided above-mentioned oleaginousness compact linkage molecule to be marked at application in the breeding of High Oil Content Oilseed Rape proterties.Utilize this mark to allow rapid screening high light wood material, thus just can carry out high oily material screening in seedling stage, reduce breeding cost, save labour cost.
In order to realize above-mentioned object, the present invention adopts following technical measures:
A method of excavation for rape oil content character major gene resistance bit, it comprises the steps:
A) rape height low oil content is utilized to combine 6F313(50%) and Y817(35%) to hybridize, F1 generation selfing produces F2 for segregating population;
B) parent 6F313 and Y817, F1 generation and the F2 blade STb gene for segregating population is extracted, reagent used in process comprises CTAB extracting solution (0.2M Tris-Cl, 0.25NaCl, 25mM EDTA, 0.5%(mass ratio) SDS, pH7.5), chloroform, primary isoamyl alcohol, dehydrated alcohol;
C) the 60K rape SNP chip utilizing Illumina company to develop carries out somatotype to rape two parent and F2 segregating population DNA sample.Screen the SNP site of polymorphism in parent after, obtain the distribution of polymorphic SNP site in F2 colony;
D) by building genetic map at F2 for the distribution in segregating population, QTL site analysis is carried out by oleaginousness data, and obtain and the closely linked 4-8 of an oleaginousness proterties major gene SNP marker, wherein two change into SNP marker 6F313A10OC-1 and the 6F313A10OC-2 of convenient detection.Main software used in process comprises Joinmap3.0, WinQTLcart4.0(commercial sources and obtains).
Parent material used in this research is the 6F313(50% of nearly 15 percentage points of oleaginousness difference) and Y817(35%), lead lower incubation by oil plant institute of the Chinese Academy of Agricultural Sciences biotechnology breeding seminar technician Wang Hanzhong researcher.6F313 strain by with in two No. 9 high grease separation strains and No. 1, China Huang hybridize the F1 that obtains for parent, with in two No. 4 high grease separation strains carry out composite hybridization as male parent, obtain basic population, by selecting fine individual plant to carry out microspores culture and chromosome doubling, finally obtain (right of ownership returns this seminar to own) through the oily orthoselection of height.Y817 be assorted No. 1 of oil in Hybrid maintenance line (middle oil mix a seeding technique research and apply, rural economy with scientific and technological, phase calendar year 2001 the 10th).The mensuration of rape two parent, F1 and F2 segregating population individual plant oleaginousness is completed by near-infrared analyzer, the extraction of plant leaf STb gene, PCR and polyacrylamide gel electrophoresis are conventional Protocols in Molecular Biology, usual conveniently condition is as people such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989), or the condition described in people (Blackwell Science Press, 1988) such as Draper is carried out.The all agent formulations (listed in embodiment) related in experimentation all can obtain from commercial channels, and use according to the condition that the conditioned disjunction agents useful for same manufacturer in laboratory manual advises.
Utilize abovementioned technology, applicant finally obtains a relevant major gene loci of oleaginousness proterties, specific as follows: a kind of major gene loci of rape oleaginousness proterties of separation, the molecule marker of main effect effect gene locus is 6F313A10OC-1 and 6F313A10OC-2, and its primer sequence is respectively: 6F313A10OC-1F:
5’-CTCAGTTCACAACTCCAGTG-3’；6F313A10OC-1R：
5’-TCTCTCAAGGATCCCTTCGA-3’；6F313A10OC-2F：
5’-CCCATCATCAAAATAGATGGTG-3’；6F313A10OC-2R:
5’-CCAGTTCTTGGCACAGTCTTGA-3’。6F313A10OC, this major gene loci is positioned at A10 karyomit(e), by 6F313A10OC-1 and 6F313A10OC-2(independent development SNP marker) location, its primer sequence is 6F313A10OC-1 and 6F313A10OC-2.The contribution rate that to utilize Joinmap3.0 software analysis to record with oleaginousness proterties (2010 and two annual datas in 2012) incoherent probability P value be 0.0001, two years is respectively 24.05% and 15.8%;
Described QTL is the abbreviation of quantitative trait locus, and quantitative trait loci or quantitative trait locus can be translated in Chinese, and it refers to the position of gene in genome of proterties of controlling the size.Must use genetic marker to the location of QTL, one or more QTL, by finding the contact between genetic marker and interested quantitative character, navigates to and is positioned at by same chromosomal genetic marker by people, and in other words, mark and QTL are chain.QTL position application was comparatively extensive in recent years, and the assignment of genes gene mapping relevant with disease on Human genome is a lot of; On plant, the location of model plant resistance gene is more.
The application of major gene loci in the breeding of High Oil Content Oilseed Rape proterties for rape oleaginousness proterties, the steps include:
A, utilizing 6F313 height oil product system and another high yield but oleaginousness to be only in the kind of about 44% two No. 9 hybridize and plant F2 generation afterwards, carrying out Molecular Identification at F2 for utilizing molecule marker primer 6F313A10OC-1 and 6F313A10OC-2 in main effect site seedling stage.
Oleaginousness test result after B, seed harvest shows, the plant oleaginousness obtained by molecular marker assisted selection accounts for 83% more than 48%.
C, be tested and appraised above-mentioned major gene loci to predict Semen Brassicae campestris oleaginousness, the breeding process of High Oil Content Oilseed Rape kind can be improved rapidly.
The present invention compared with prior art, has the following advantages and effect:
The present invention located an oil content character major gene resistance bit in napus lines 6F313 first, and the change of soluble oleaginousness 24.05% makes the positioning work of rape oil content character major gene resistance bit occupy same domain prostatitis.In traditional breeding way, phenotypic evaluation will gather in the crops seed testing oleaginousness by the time, and affected by environment larger.Therefore oleaginousness breeding is not only time-consuming, and difficulty is large, and cost is high.By detecting oleaginousness proterties main effect QTL site, can eliminate in seedling stage, not only save production cost but also greatly improve efficiency of selection.Oleaginousness major gene loci locality specific in the present invention, major gene loci fast easy to detect, not affected by environment.By detecting the molecule marker relevant to oleaginousness proterties, namely can predict the height of oleaginousness, and then rapid screening floorboard with high oil content strain can be used for the breeding of rape oleaginousness, assistant breeding select target is clear and definite, cost-saving.
Accompanying drawing explanation
Fig. 1 is a kind of Wuhan Yangluo F2 colony, F2:3 family oleaginousness distribution plan.
Result shows oleaginousness performance distribution distribution in continuity, and variation distribution is in normal distribution, and range of variation is very wide, proves that oleaginousness belongs to quantitative character.
Fig. 2 is a kind of QTL site be positioned on A10 karyomit(e).
Fig. 3 is a kind of according to 2010F2 oleaginousness data analysis 6F313A10OC oil content character major gene resistance bit.
Fig. 4 be a kind of molecule marker 6F313A10OC-1 and 6F313A10OC-2 at F2 for the screening in strain.
In figure, 1,2,5, No. 8 is floorboard with high oil content strain.
Embodiment
Usual conveniently condition is as people such as Sambrook, molecular cloning: laboratory manual (New York:Cold SpringHarbor Laboratory Press, 1989), or people (the Blackwell Science Press such as Draper, 1988) condition described in, or according to the condition that agents useful for same manufacturer advises.
Embodiment 1:
The high structure of low oil content napus lines combination F2 segregating population and the mensuration of F2, F2:3 family oleaginousness
The colony used in the present embodiment is high low oil content parent (oleaginousness is respectively the 6F313 of the 50% and Y817 of 35%) filial generation--F2 generation.Parent, F1 and F2 seed oil content are measured by near-infrared analyzer.F2 shows oleaginousness performance distribution distribution in continuity for segregating population oleaginousness DATA DISTRIBUTION result, and variation distribution is in normal distribution, and range of variation is very wide, proves that oleaginousness belongs to quantitative character (Fig. 1).
Embodiment 2:
The extraction of parent, F1 and F2 segregating population blade STb gene
Utilize CTAB method to extract blade STb gene, concrete steps are as follows:
A. appropriate leaf sample takes from Ultralow Temperature Freezer (-70 DEG C), puts into frappe mortar immediately, adds liquid nitrogen grinding powdering; In quick loading 50ml centrifuge tube, be added in extracting solution (0.2M Tris-Cl, 0.25NaCl, 25mM EDTA, 0.5%(mass ratio) SDS, pH7.5 preheated in the water-bath of 60 DEG C), mix, put into the water-bath water-bath 40min of 60 DEG C;
B. take out centrifuge tube, add equal-volume chloroform: primary isoamyl alcohol (24:1, V/V), slowly turn upside down centrifuge tube 30-50 time, makes abundant mixing, centrifugal 10 minutes of 1300g;
C. get supernatant in another centrifuge tube, add equal-volume chloroform: primary isoamyl alcohol (24:1, V/V), extracting once again.Get supernatant and add 0.6 times of volumes ice cold primary isoamyl alcohol, slowly put upside down centrifuge tube, till having flocks to assemble.Static 30min, chooses precipitation, 70%(volume ratio) alcohol washes 2-3 time, and dehydrated alcohol is washed once, adds sterilized water 65 DEG C of 20min and dissolve after drying;
D. equal-volume chloroform is again added: primary isoamyl alcohol (24:1, V/V), again extracting.Get supernatant, add 0.1 times of NaAc(3mol/L, PH5.2), slowly add the ice dehydrated alcohol of 2 times of volumes after mixing, slowly rotate centrifuge tube until flocks occurs after static 5min, choose precipitation and proceed in 1.5ml centrifuge tube, 70%(volume ratio) alcohol washes 2-3 time, dehydrated alcohol is washed once, adds sterilized water and dissolves, save backup in-20 DEG C of refrigerators after drying.
Embodiment 3:
SNP chip analyze 6F313, Y817 two parent and F2 segregating population genotype and linkage analysis
The 60K rape SNP chip utilizing Illumina company to develop carries out somatotype to rape two parent and F2 segregating population DNA sample.Screen the SNP site of polymorphism in parent after, analyze its distribution in F2 colony.By carrying out data analysis at F2 for the distribution in segregating population, according to chain exchange rule, utilize colony's genotype data to build the genetic map of rape, software used is Joinmap3.0, minimum LOD value is set to 2.5, obtains linkage map (Fig. 2 is A10 linkage group collection of illustrative plates).The distribution situation of the oleaginousness data of 105 of F2 colony individual plants and polymorphism primer is inputted computer, run WinQTL cart4.0 software and correlation analysis is carried out to data, One-way ANOVA records the probability P value relevant to oleaginousness proterties and site to the contribution rate (table 2, Fig. 3) of oleaginousness proterties.Result shows, the SNP marker of P<0.0001 is namely chain with major gene loci.Utilize SNP site difference and genome sequence to develop two pairs of SNP marker primers, marker assisted selection breeding (table 1) can be used for by the rear agarose gel electrophoresis somatotype of Direct PCR amplification.PCR reaction system is: 20ul system, and DNA profiling 1ul(concentration is 50ng/ul), each 1ul(concentration of upstream and downstream primer is 10umol), dNTP0.5ul, Taq enzyme 0.5ul(5u/ul), MgCl22ul, ddH2O14ul.The time of reaction and temperature are done as follows: 94 DEG C of 3min, 94 DEG C of 45s, 62 DEG C of 45s, 72 DEG C of 30s, 30cycles, 72 DEG C of 5min.PCR primer 2%(mass ratio) agarose gel electrophoresis detection.
The sequence of table 1 labeled primer
| Mark | Upstream primer | Downstream primer |
| 6F313A10OC-1 | CTCAGTTCACAACTCCAGTG | TCTCTCAAGGATCCCTTCGA |
| 6F313A10OC-2 | CCCATCATCAAAATAGATGGTG | CCAGTTCTTGGCACAGTCTTGA |
The One-way ANOVA of table 2 6F313 strain oil content character major gene resistance bit
| The data time | Major gene loci | Mark | P value | Contribution rate |
| 2010F2 | 6F313A10OC | 6F313A10OC-1、6F313A10OC-2 | 0.0001 | 24.05% |
| 2011F2:3 | 6F313A10OC | 6F313A10OC-1、6F313A10OC-2 | 0.0001 | 15.8% |
Embodiment 5:
The application of molecule marker 6F313A10OC-1 and 6F313A10OC-2 in oleaginousness breeding, the steps include:
A, utilize 6F313 height oil product system and another high yield but oleaginousness to be only in the kind of about 44% two No. 9 hybridize and plant F2 generation afterwards, carry out Molecular Identification at F2 for seedling stage.Concrete steps comprise the extraction (see embodiment 2), PCR qualification (see embodiment 3) etc. of F2 segregating population blade STb gene.
B, result as 6F313A10OC-1 primer in Fig. 4 the different individual plant of the F2 that increases band shown in, the band in No. 6 circles does not exist in low oil content strain.Therefore, in F2 generation, 1,2,7, No. 11 Brassica campestris L seedling can remain.Oleaginousness test result after seed harvest shows, the plant obtained by molecular marker assisted selection, and most single-strain seed oleaginousness is more than 47%(table 3).
C, by detecting the molecule marker relevant to oleaginousness proterties, namely the height of oleaginousness can be predicted, eliminate in seedling stage, not only save production cost but also greatly improve efficiency of selection, and then rapid screening floorboard with high oil content strain can be used for the breeding of rape oleaginousness.
Table 3
| Numbering | Oleaginousness | Numbering | Oleaginousness |
| L09-1 | 48.5 | L09-77 | 49.25 |
| L09-2 | 49.13 | L09-79 | 47.88 |
| L09-7 | 48.78 | L09-84 | 50.73 |
| L09-11 | 47.98 | L09-89 | 51.54 |
| L09-18 | 49.12 | L09-97 | 48.5 |
| L09-23 | 47.09 | L09-109 | 48.92 |
| L09-30 | 48.15 | L09-122 | 49 |
| L09-38 | 47.14 | L09-127 | 48.63 |
| L09-45 | 50.81 | LO9-131 | 49.57 |
| L09-51 | 48.8 | L09-139 | 48.89 |
| L09-55 | 49.33 | L09-143 | 48.43 |
| L09-63 | 48.3 | L09-149 | 47.42 |
| L09-64 | 48.25 | L09-156 | 49.12 |
Claims (2)
1. a molecule marker primer for rape oil content character major gene resistance bit, is characterized in that: 6F313A10OC-1F:5 '-CTCAGTTCACAACTCCAGTG-3 '; 6F313A10OC-1R:5 '-TCTCTCAAGGATCCCTTCGA-3 '.
2. the application of molecule marker primer according to claim 1 in the breeding of High Oil Content Oilseed Rape proterties.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310658487.8A CN103667484B (en) | 2013-12-09 | 2013-12-09 | Oil content character main gene locus of rape 6F313 and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310658487.8A CN103667484B (en) | 2013-12-09 | 2013-12-09 | Oil content character main gene locus of rape 6F313 and applications thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103667484A CN103667484A (en) | 2014-03-26 |
| CN103667484B true CN103667484B (en) | 2015-02-18 |
Family
ID=50306253
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310658487.8A Active CN103667484B (en) | 2013-12-09 | 2013-12-09 | Oil content character main gene locus of rape 6F313 and applications thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103667484B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109097486A (en) * | 2018-07-27 | 2018-12-28 | 华中科技大学 | The oil content gene loci of rape seed tissue site specificity and its application |
| CN111363785B (en) * | 2020-03-18 | 2021-07-16 | 新疆农业科学院粮食作物研究所 | Construction method of maize flowering period tassel drought-resistant QTL positioning segregation population |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005176619A (en) * | 2003-12-16 | 2005-07-07 | Mie Prefecture | Selection marker for clubroot-resistant rapes |
| CN101988118A (en) * | 2009-08-07 | 2011-03-23 | 中国农业科学院油料作物研究所 | Rape oil content character major gene resistance bit and application |
-
2013
- 2013-12-09 CN CN201310658487.8A patent/CN103667484B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005176619A (en) * | 2003-12-16 | 2005-07-07 | Mie Prefecture | Selection marker for clubroot-resistant rapes |
| CN101988118A (en) * | 2009-08-07 | 2011-03-23 | 中国农业科学院油料作物研究所 | Rape oil content character major gene resistance bit and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103667484A (en) | 2014-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Singh et al. | Assessment of genetic diversity in Brassica juncea Brassicaceae genotypes using phenotypic differences and SSR markers | |
| CN103952402B (en) | A kind of SNP site relevant to root system of plant proterties and application thereof | |
| CN102766627B (en) | Molecular marker closely linked with oil content character of rapes and application | |
| Ahmad et al. | Genetic diversity and population structure of Pisum sativum accessions for marker-trait association of lipid content | |
| CN103820476A (en) | Gene relevant to wheat thousand seed weight, functional marker and application thereof | |
| CN109929945B (en) | Molecular marker BrSF2604 primer of main effect QTL sites in flowering phase and mature phase of brassica napus and application thereof | |
| Lou et al. | Association analysis of simple sequence repeat (SSR) markers with agronomic traits in tall fescue (Festuca arundinacea Schreb.) | |
| US20140053294A1 (en) | Pongamia Genetic Markers and Method of Use | |
| CN105441457B (en) | A kind of QTL molecule labelling method relevant to low nitrogen Rice under Condition mass of 1000 kernel | |
| CN105238866B (en) | One SNP site related to upland cotton Early mature apricot and its application | |
| CN105296472B (en) | The molecular labeling and its screening technique in Sand Pear ' faint scent ' pericarp brown character gene site entirely | |
| CN110358854A (en) | Main effect QTL site, SNP marker exploitation and the application of one cabbage type rape main inflorescence silique number character | |
| CN106755413B (en) | Rice nitrogen absorption and utilization site qNUE6 and molecular marking method thereof | |
| CN103667484B (en) | Oil content character main gene locus of rape 6F313 and applications thereof | |
| CN101988118B (en) | Rape oil content character major gene resistance bit and application | |
| CN110004242B (en) | Molecular marker BrSF0239 primer of main QTL sites in flowering phase and mature phase of brassica napus and application thereof | |
| CN103834647B (en) | Wheat Dwarfing gene Rht dC20closely linked SSR marker Xgwm537 and uses thereof | |
| CN107746895B (en) | Molecular marker for improving barley harvest index QTL site under low-phosphorus condition and application | |
| CN103667485B (en) | Oil content character major gene resistance bit and application in napus lines 61616 | |
| CN109517919A (en) | The exploitation of Wheat-Thinopyrum intermedium wide spectrum Rust resistance T4DL.4DS-3Ai translocation line and SCAR mark | |
| CN108148920A (en) | The functional form molecular labeling of capsicum nuclear male sterility related gene and its application | |
| CN111100946B (en) | Molecular marker primer of rape grain weight character major gene locus and application | |
| CN103725675A (en) | Molecular tagging method for paddy rice | |
| CN111004857A (en) | Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer | |
| CN105524994A (en) | Molecular marker HRM7 of barley grain length gene LkI2 and application of molecular marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200814 Address after: 430062 No. two, 2 Dong Lu, Wuchang District, Hubei, Wuhan Patentee after: Wuhan Zhongyou Seed Technology Co., Ltd Address before: 430062 No. two, 2 Xu Dong Road, Wuhan, Hubei, Wuchang Patentee before: OILCROPS Research Institute OF CHINESE ACADEMY OF AGRICULTURE SCIENCES |
|
| TR01 | Transfer of patent right |