Background technology
When Semen Tritici aestivi runs into wet weather or wet environment before results, seed will at head sprouting and wheat ear germinating. The phenomenon of wheat ear germinating is the major issue that world's Major Wheat manufacturing country exists. Spike sprouting causes that wheat quality seriously reduces and even completely loses. In countries such as France, the U.S., Canada, Australia, all by the harm of wheat ear germinating, wherein Canada and Australia are particularly acute. China middle and lower reach of Yangtze River, Winter Wheat Area, southwest and Northeasten Spring Wheat Area of China are the areas of harvest season easy rainfall, and Northern Winter district major part white wheat kind is extremely sensitive to Spike sprouting, meets rain harvest time and very easily causes Spike sprouting.
Wheat ear germinating causes the seed a series of biochemical reaction of internal generation, particularly the enzymatic activity such as some carbohydrate degrading enzymes, proteolytic enzyme (such as α-amylase) raises, storage reserve degradation in embryo and endosperm, Protein Content of Wheat Kernel is made to successively decrease, gluten strength declines, and then the grain yield of Semen Tritici aestivi and the processing quality of unit weight decline, flour are deteriorated. The stickness such as bread that germinated wheat powder is made, noodles, easily broken, and bite is poor, mouthfeel is bad, so Spike sprouting has had a strong impact on the quality of Semen Tritici aestivi, edible and Seed practical value, causes serious economic loss to crop production. So how control wheat aging time Spike sprouting, and then the excellent anti growing out kind of acquired character has become the important topic of world wheat breed improvement, domestic and international plant breeder and physiologist have carried out widely studied in its authentication method, resistance mechanism, Genetic Mechanisms and molecular marker etc.
Developing the molecular marker relevant to ear germinating resistance and seed hibernation feature is the effective means improving detection efficiency. The labellings such as SSR, STS, RFLP and conventional genetic assays method has been utilized to carry out the location about seed dormancy and anti growing out gene, find all have the QTL relevant to ear germinating resistance from the 1st to the 7th chromosome set, wherein the 3rd and the 4th chromosome set be major gene resistance frequently report region.Utilize molecular mark, it is possible to accelerate the incubation of anti growing out germ plasm resource and kind. Anderson etc. have oriented 10 RFLP labellings relevant with ear germinating resistance altogether on 1AS, 2AS, 2AL, 5DL, 4AL, 5DL, 6BL chromosome, for instance Xcn1.bcd1434, Xcn1.cdo431, Xcn1.cdo64, Xcn1.Wg996a etc. Roy etc. utilize STMS(Sequence-taggedMicrosatellites) and STS(Sequence-taggedsite) labelling respectively located on 6BS and 7DL chromosome control Spike sprouting major gene resistance, respectively with Cwmc104 and Xmst101 labelling close linkage. The kernel seed coat colour that R gene controls is closely related with the ear germinating resistance of Semen Tritici aestivi, it is possible to the labelling as an ear germinating resistance is applied. Yang Yan etc. have developed the STS labelling of Vp1B3 and Vp1A3 according to the seed dormant transcription factor VP1 that controls of report in Semen Maydis in Chinese Wheat Cultivars, and it is located on 3BL (Yang Yan, Zhang Chunli, Chen new people, Deng. the application [J] in Semen Tritici aestivi anti growing out genotype identification of Spike sprouting rate and germination index and STS labelling Vp1B3. wheat crops journal, 2007,27 (4): 577-582.). At present having identified control Grain Dormancy and the candidate gene relevant to ear germinating resistance has Vp-1, ABI3, FUS3 and LECI etc., these genes all have double effects, not only Inhibiting germination but also promote the process relevant with embryo maturation.
Vp-1 regulates embryonic development, promotion embryo maturation and suppresses the synthesis of α-amylase and then promote the transcription factor of dormancy. in arabidopsis obtain Vp-1 homologous genes ABI3 also with ABI5 homologous genes each other. ABI3 and ABI5 regulates and controls the maturation of seed and sprouting by making mutually in the approach of ABA signals-modulating, and at the expression (MCKIBBINRS in seed afterripening stage Yu the dehydration resistance related gene of embryo, WILKINSONMD, BAILEYPC, etal.TranscriptsofVp-1homologuesaremissplicedinmodernwhe atandancestralspecies [J] .ProceedingsoftheNationalAcademyofScienceUSA, 2002,99:10203-10208.). insensitivity to ABA in the seed germination that caused by ABI3 of the expression inhibiting of ABI5, and the process LAN of ABI3 promoted the expression of ABI5, and so ABI5 is epistatic gene, and ABI3 is hypostatic gene. ABI5 and ABRE (ABA response original paper, ACGTGG/TC) regulates and controls the promoter sequence of ABA response gene jointly. ABA induces the accumulation of ABI5 albumen by improving the stability of transcriptional activity and increase protein, and the stability of ABI5 albumen is relevant to its phosphorylation with activity. AFP is as the negative regulatory factor of ABA response, make and act on the upstream of ABI5 mutually with ABI5, and take part in the degraded of ABI5 albumen, stop the excess accumulation of ABI5, by promoting that the degraded of ABI5 albumen regulates and controls ABI5 protein level, and then weaken ABA signals-modulating, it is likely to and promotes embryo germination, suppress the closely related (NaruhitoOhnishi1 of seed dormant regulatory mechanism, EikoHimi1, YoshikiYamasaki1, etal.DifferentialexpressionofthreeABA-insensitivefivebin dingprotein (AFP)-likegenesinwheat.GenesGenetSyst, 2008, 83:167-177).
In Semen Tritici aestivi, three homologous genes TaAFP-A, TaAFP-B and the TaAFP-D of AtAFP lay respectively on 2A, 2B and the 2D chromosome of Semen Tritici aestivi, currently acquired genetic fragment length respectively 3289bp, 3922bp and 3128bp.TaAFPs includes an intron, two exon (Lopez-MolinaL, MongrandS, KinoshitaN, ChuaNH..AFPisanovelnegativeregulatorofABAsignalingthatpr omotesABI5proteindegradation [J] .GenesDevel2003,17:410-418.). The upstream-5 of the start codon ATG of TaAFPs gene ' sequence of 800bp in region is conservative, wherein contains ABA response element, center original paper G-box and dehydration element etc.
Relatively arabidopsis AtAFP finds with the sequence of Semen Tritici aestivi TaAFP gene: the structure of AtAFP and TaAFP is similar, all comprise the centralized positioning territory of speculating acid sequence and be positioned at the ABI5 binding domain of C end regions, but AtAFP is more active in seed development and early stage of germinateing, and especially TaAFP-B expresses in many tissues in TaAFPs, such as dead leaf, root, seedling and developmental seed, and except ABA, salt and desiccation stress all raise the expression of TaAFP. The research of Wu etc. shows: as the GCN4 element (5 '-A/GTGAC/GTCAT-3 ') of the transcription factor of bZIP type, be a key factor in endosperm specificity expression. In arabidopsis, AtAFP gene has a GCN4 element in 5 ' regions, and does not have GCN4 element in TaAFPs gene, thus it is speculated that the disappearance of GCN4 binding site in TaAFPs gene 5 ' region, it is possible to relevant with TaAFP wide expression in each tissue. Participating in TaAFP-A and TaAFP-D compared with ABA response and some Stress responses (such as salt and dehydration etc.), TaAFP-B significantly expresses in each tissue. RAV1(and the ABI3/VP1 of TaAFP-A and TaAFP-D, the CAACA that B3domain-type is relevant, CACCTG) element is complete, and TaAFP-B only has 5 '-CACCTG-3 ' element, and TaAFP-B has in 5 ' regions, and one distinctive and the element Dof of the transcription factor effect of single zinc fingers, Dof (5 '-AAAG-3 ') identify the DNA sequence containing AAAG or CTTT, thus it is speculated that and Dof element is likely to relevant with TaAFP-B dominant expression in each tissue. DOF class transcription factor has now been found that and only exists and in plant, express in unifacial leaf and dicots, stem, leaf, and involved in plant growth, grows. These three TaAFPs has been likely to different effects in the ABA acknowledgement mechanism in Wheat Evolution process.
Summary of the invention
It is an object of the present invention to provide wheat ear germinating resistance related gene.
Wheat ear germinating resistance related gene provided by the present invention, title is TaAFP-Ba(SEQID №: 1 respectively) and TaAFP-Bb(SEQID №: 2) there is one of following nucleotide sequence:
1) nucleotide sequence of SEQ ID №: 1 or SEQ ID №: 2;
2) there is more than 90% homology with the DNA of the DNA or SEQ ID №: 2 of SEQ ID №: 1, and coding identical function protein DNA sequence;
3) nucleotide sequence of the DNA sequence hybridization that can limit with the DNA sequence of SEQID №: 1 or SEQID №: 2 under high high stringency conditions.
Wheat ear germinating resistance related gene provided by the present invention, title is TaAFP-Ba(SEQID №: 1 respectively) and TaAFP-Bb (SEQID №: 2), compared with TaAFP-B gene (SEQID №: 3), homology is all up to more than 90%, and the aminoacid sequence (SEQID №: 5) of its coded sequence (SEQID №: 4) coding identical function protein.
TaAFP-Ba and TaAFP-Bb gene is the allelic variation of TaAFP-B gene, 5 ' UTR region of TaAFP-B gene are inserted the nucleotide sequence of 2bp, for TaAFP-Ba gene, 5 ' UTR region of TaAFP-B gene lack the nucleotide sequence of 2bp, for TaAFP-Bb gene.
The nucleotide sequence total length of TaAFP-B gene is 3992bp (AB360912). TaAFP-B gene is made up of 2 exons and 1 intron, it is First Exon from the 5 ' of full length sequence the 2082nd to 2583 Deoxydization nucleotides of end, it is intron from the 5 ' of full length sequence the 2584th to 3311 Deoxydization nucleotides of end, is Second Exon from the 5 ' of full length sequence the 3312nd to 3760 Deoxydization nucleotides of end. Namely TaAFP-Ba and TaAFP-Bb gene holds the 2054th Deoxydization nucleotide place insert respectively and lacked 2bp from the 5 ' of full length sequence in 5 ' UTR region.
Containing TaAFP-Ba(SEQID №: 1 of the present invention) or TaAFP-Bb(SEQID №: 2) recombinant expression carrier of gene, transgenic cell line and engineering bacteria belong to protection scope of the present invention.
Second purpose of the present invention is to provide a kind of method of assisting sifting ear germinating resistance Semen Tritici aestivi, being the nucleotide sequence detecting and whether having lacked 2bp in 5 ' UTR region of Semen Tritici aestivi TaAFP-B gene to be measured, the nucleotide sequence then ear germinating resistance lacking 2bp in 5 ' UTR region of the TaAFP-B gene of Semen Tritici aestivi as to be measured in this is relatively high.
Whether 5 ' UTR region of the TaAFP-B gene of available PCR method detection Semen Tritici aestivi to be measured have lacked the nucleotide sequence of 2bp.
Described PCR method is with the genomic DNA of Semen Tritici aestivi to be measured for template, the pair of primers TaAFP-BF4/R4 being made up of the nucleotide sequence of sequence in sequence table 6 and sequence 7 carries out pcr amplification, amplified production detects with PAGE glue, the power of 60W, the electrophoresis of 10% for 2.0 hours, if detection has the band being sized to 203bp in the pcr amplification product obtained, then described Semen Tritici aestivi to be measured is that ear germinating resistance is relatively high.
Be TaAFP-BF by the sequence designations of primer TaAFP-BF4/R4, it be according to TaAFP gene in 1 B gene group between ear germinating resistance to sensitive material difference design a STS labelling relevant with ear germinating resistance.
A kind of method that 3rd purpose of the present invention is to provide assisting sifting Sprouting susceptibility Semen Tritici aestivi, it is the nucleotide sequence whether inserting 2bp in 5 ' UTR region of the TaAFP-B gene detecting Semen Tritici aestivi to be measured, 5 ' UTR region of the TaAFP-B gene of Semen Tritici aestivi as to be measured in this is inserted 2bp then Sprouting susceptibility relatively high.
Whether 5 ' UTR region of the TaAFP-B gene of available PCR method detection Semen Tritici aestivi to be measured insert the nucleotide sequence of 2bp.
Described PCR method is with the genomic DNA of Semen Tritici aestivi to be measured for template, the pair of primers TaAFP-BF4/R4 being made up of the nucleotide sequence of sequence in sequence table 6 and sequence 7 carries out pcr amplification, amplified production detects with PAGE glue, the power of 60W, the electrophoresis of 10% for 2.0 hours, if detection has the band being sized to 207bp in the pcr amplification product obtained, namely described Semen Tritici aestivi to be measured is that Sprouting susceptibility is relatively high.
The assisting sifting ear germinating resistance of the present invention or the method for sensitivity Semen Tritici aestivi are more suitable for white wheat kind.
The good effect that namely the technology of the present invention advantage obtains:
1, it is found that TaAFP-Ba and TaAFP-Bb first, lays a good foundation for the functional study of different ear germinating resistances and the exploitation of molecular marker thereof studying white wheat kind further.TaAFPs has been likely to different effects in the ABA acknowledgement mechanism in Wheat Evolution process, and TaAFP-Ba and TaAFP-Bb be TaAFP-A, D and B research mechanism provide fundamental basis.
2, the assisting sifting ear germinating resistance of the present invention or the method for sensitivity Semen Tritici aestivi can be used for the generation morning selection of wheat ear germinating resistance breeding, substantially reduce breeding cycle, accelerate breeding speed, greatly reducing breeding cost, have operation extremely simple, cost is very cheap, the advantage that cycle is short, be suitable to popularization and application, provide technical support for Semen Tritici aestivi anti growing out breeding, provide one system of selection efficiently for selection-breeding ear germinating resistance wheat germplasm.
Detailed description of the invention
In following embodiment, wheat lines is all purchased from country's germ plasm resource gene bank.
The present invention utilizes the conserved sequence of Chinese spring TaAFP gene to devise primer, respectively the genomic TaAFP gene of A, B and D is expanded, does not find differences on A genome and D genome; And in 1 B gene group, it is found that the allelic variation relevant to ear germinating resistance, insertion or the disappearance of a 2bp is there is in it in 5 ' UTR region, insert type and be mostly present in the material of ear germinating resistance rdativery sensitive, being then mostly present in the material that ear germinating resistance is of a relatively high of deletion type. A STS labelling TaAFP-BF relevant to ear germinating resistance is devised according to the difference between the TaAFP gene material that ear germinating resistance is different in 1 B gene group, result shows that this labelling presents polymorphism, amplify 207bp and 203bp banding pattern respectively, be respectively designated as TaAFP-Ba(SEQID №: 1) and TaAFP-Bb(SEQID №: 2).
1, the discovery of allelic variation TaAFP-Ba and TaAFP-Bb
With the Semen Tritici aestivi week 8425B(GI:56.0 that ear germinating resistance is different), the white Semen Tritici aestivi in Yongchuan (GI:23.2), the white Semen Tritici aestivi in Langzhong (GI:8.4), Wan County white Semen Tritici aestivi (GI:7.6) is for material, its TaAFP gene is carried out segmentation amplification at A, B and D genome, then checking order, result shows that TaAFP gene does not find differences on A genome and D genome; And 5 ' UTR region in 1 B gene group exist insertion or the disappearance of 2bp, the allele called after TaAFP-Ba of the TaAFP-B of 2bp, the called after TaAFP-Bb of disappearance 2bp will be inserted. Fig. 1 be TaAFP-B, TaAFP-Ba and TaAFP-Bb gene 5 ' UTR region in partial sequence comparing result.
2, the acquisition of allelic variation TaAFP-Ba and TaAFP-Bb
The acquisition of TaAFP-Ba: with the genomic DNA in week 8425B for template, carries out pcr amplification with the primer TaAFP-BF4/R4 that sequence in sequence table 6 and sequence 7 form, and wherein, pcr amplification condition is first 94 DEG C of denaturations 5 minutes; Then 35 circulations are carried out, 94 DEG C of degeneration of each circulation 45 seconds, 61 DEG C of renaturation 45 seconds, 72 DEG C extend 1 minute; Last 72 DEG C extend 10 minutes.
The acquisition of TaAFP-Bb: the genomic DNA of white Semen Tritici aestivi is template with Wan County, carries out pcr amplification with the primer TaAFP-BF4/R4 that sequence in sequence table 6 and sequence 7 form, and wherein, pcr amplification condition is first 94 DEG C of denaturations 5 minutes;Then 35 circulations are carried out, 94 DEG C of degeneration of each circulation 45 seconds, 61 DEG C of renaturation 45 seconds, 72 DEG C extend 1 minute; Last 72 DEG C extend 10 minutes.
3. the assisting sifting that wheat ear germinating resistance is different
(1) the STS labelling TaAFP-BF according to the sequential design of the allelic variation of TaAFP-B, with the primer TaAFP-BF4/R4 that sequence in sequence table 6 forms with sequence 7, the white grain kind of 10 different ear germinating resistances is carried out pcr amplification, amplified reaction cumulative volume is for 15 μ l, and reactant liquor consists of ddH2O7.95 μ L; 10 × LAPCRBuffer, 1.5 μ L; DNTP (2.5mm), 1.2 μ L; The each 0.3 μ L of Primers; LATaq(5U/ul), 0.15 μ L; Wheat volatiles DNA0.6 μ L.
Response procedures is first 94 DEG C of denaturations 5 minutes; Then 35 circulations are carried out, 94 DEG C of degeneration of each circulation 45 seconds, 61 DEG C of renaturation 45 seconds, 72 DEG C extend 1 minute; Last 72 DEG C extend 10 minutes. PCR primer is stored in 4 DEG C.
Then by the PAGE glue of 10% 2.0 hours electrophoresis detection PCR primer of electrophoresis under the power of 60W.
Result is as in figure 2 it is shown, there are two kinds of banding patterns: occurs the fragment of 203bp in the kind that resistance is of a relatively high, occurs the fragment of 207bp in the kind that Sprouting susceptibility is of a relatively high.
(2) feasibility of the white grain kind of 91 the different ear germinating resistances assisting sifting ear germinating resistance or sensitive wheat to detect the present invention is chosen.
Respectively with the genomic DNA of the white grain kind of 91 different ear germinating resistances for template, carry out expanding and electrophoresis according to the method for step 1, result shows: has 23 kinds and amplifies the fragment of 207bp, wherein having 3 kinds is ear germinating resistance material (Spike sprouting index GI is 0-30%), 11 kinds are anti-material in Spike sprouting (Spike sprouting index GI is 30-50%), and 9 kinds are Spike sprouting sensitive material (Spike sprouting index GI for > 50%); Have 68 kinds and amplify the fragment of 203bp, wherein having 31 kinds is ear germinating resistance material (Spike sprouting index GI is 0-30%), 29 kinds are anti-material in Spike sprouting (Spike sprouting index GI is 30-50%), and 8 kinds are Spike sprouting sensitive material (Spike sprouting index GI for > 50%).
The white wheat of 91 different ear germinating resistances with by the relation of the TaAFP-BF two kinds of fragments amplified such as shown in table 1, table 2.
The GI value of the different ear germinating resistance white wheat of 191 parts of table and the polymorphism of STS labelling
The polymorphism (No. 81-91) of the GI value of the different ear germinating resistance white wheat of 291 parts of table and STS labelling
Sequence table
<110>Yang Yan
<120>wheat ear germinating resistance related gene and application thereof
<160>7
<210>1
<211>1937
<212>DNA
<213>Triticum common wheat week 8425B(Triticumaestivumzhou8425B)
<400>1
gattctgctggctctgcttccccggcgctcgtcgattgttcgttcctccctgggcgctgt1
gatgttcttccctctgggtttgaagaccgagaattgcccggcgcgggacggattcgcggc61
aatggcgaggtcttcctgagaatttggccgtccttggaggttggggggaggagggattgg121
cgtctgcttcgcggcggggaattgcttgctctctctctctctctctgccggacggacatg181
gcgtcgagggacttcttgggcaggttcggcggcgagaagggctcgtcgtcggacaaggcg241
gggggcggcgccggcgagcccgacgaggtggtcgagctcagcctgggcctgtccctgggc301
ggctgcttcggcgccaactccggccgggacgccaagaagccgcggctggtgcgctcctcc361
tccctcgccgccatgtgctcgctcccgggcaccagcgacgacctcgccgccgccacgccc421
ccgccggcgccgctgatgcgcaccagctcgctccccaccgagacggaggaggagcggtgg481
cgccgccgcgagatgcagagcctcaagcgcctccaggccaagcgcaagcgcctcgagcgc541
cgcacctccatgaactccggcaagtccggcggcagcagcagccgggacgacgcccaggag601
ccgctctaccccagcgcgttccagctccgccgctccgtcgtcgaccaggggaacacctcc661
tcaagcatgccggagcaaggtatacacatgctttcatcagcttccctaccactcgaactg721
tttgctacaataagcttgcaattcccactgttctattgcgttcccttgcttgaattattc781
attcagctgcctgttctggttgccaagctctcggcgatccatgcaggtcggtgtcatgcc841
gagcttaccgtggttcttttggtaggagatgcatgggcagaggggggatctagcaagtcg901
agtgttctttgccatggatcttgctttggtcttgtgatttactgggatcgattcgttaga961
acgctagctgagccgatgcttttctttttcgccaaattcattagaaatggggaattcttt1021
tctgcacaacctgatgatacttctacgtacgcatgggatttgttgtgttcttttcggggc1081
gtttgttttgggtgatgtcatttctgggattatttcgagccgtgctgttgctcctagggt1141
ctcaagagatgccttctacggcatgtgtctaagcagtttctaagcttttagtcactacta1201
acagttacgtagcgtcagggtatgattattcaggctaatcattatccgagcagctactac1261
taaatataagtatatgatttgaattgtctacctgaaaactggaaagcactgacgattagt1321
aaacggaaaagaacacattgggatatgaatctttattgacatgttagaatatgaaaatgt1381
gacatcttctcccctgcattggtgcaggtagcgctgatggcgctgaggcgaagagcacat1441
cgagcatggagatatcttctgataataataataataacaatgccagcaaccagaacaagt1501
ccctcccgccgccggcaccatctccggccgggaagctgccgaacggcatcgtcaaggagc1561
aaccgccgttgcggaccctccggtcgctgacgatgcgcacgactagcaccggcgacctgc1621
ggaagagcatgatggaggacatgccgatggtctcgtccaaggtggacggccccaacggca1681
agaagatcgacggcttcctctacaagtacaggaaaggggaggaggtgaggatagtgtgcg1741
tctgccatggcaacttcctcacgccggcggagttcgtgaagcacgctggcggcggcgacg1801
tcacgaacccgctcaggcacatcgtcgtcaaccccgcgccgtcggtcttcttgtaatgtc1861
ggaatgtacctaggggg1921
<210>2
<211>1933
<212>DNA
<213>the white Semen Tritici aestivi in Triticum common wheat Wan County (Triticumaestivumwanxianbaimaizi)
<400>2
gattctgctggctctgcttccccggcgctcgtcgattgttcgttcctccctgggcgctgt1
gatgttcttccctctgggtttggagaccgagaattgcccggcgcgggacggattcgcggc61
aatggcgaggtcttcctgagaatttggccgtccttggaggttggggggaggagggattgg121
cgtctgcttcgcggcggggaattgcttgctctctctctctctgccggacggacatggcgt181
cgagggacttcttgggcaggttcggcggcgagaagggctcgtcgtcggacaaggcggggg241
gcggcgccggcgagcccgacgaggtggtcgagctcagcctgggcctgtccctgggcggct301
gcttcggcgccaactccggccgggacgccaagaagccgcggctggtgcgctcctcctccc361
tcgccgccatgtactcgctcccgggcaccagcgacgacctcgccgccgccacgcccccgc421
cggcgccgctgatgcgcaccagctcgctccccaccgagacggaggaggagcggtggcgcc481
gccgcgagatgcagagcctcaagcgcctccaggccaagcgcaagcgcctcgagcgccgca541
cctccatgaactccggcaagtccggcggcagcagcagccgggacgacgcccaggagccgc601
tctaccccagcgcgttccagctccgccgctccgtcgtcgaccaggggaacacctcctcaa661
gcatgccggagcaaggtatacacatgctttcatcagcttccctaccactcgaactgtttg721
ctacaataagcttgcaattcccactgttctattgcgttcccttgcttgaattattcattc781
agctgcctgttctggttgccaagctctcggcgatccatgcaggtcggtgtcatgccgagc841
ttaccgtggttcttttggtaggagatgcatgggcagaggggggatctagcaagtcgagtg901
ttctttgccatggatcttgctttggtcttgtgatttactgggatcgattcgttagaacgc961
tagctgagccgatgcttttctttttcgccaaattcattagaaatggggaattcttttctg1021
cacaacctgatgatacttctacgtacgcatgggatttgttgtgttcttttcggggcgttt1081
gttttgggtgatgtcatttctgggattatttcgagccgtgctgttgctcctagggtctca1141
agagatgccttctacggcatgtgtctaagcagtttctaagcttttagtcactactaacag1201
ttacgtagcgtcagggtatgattattcaggctaatcattatccgagcagctactactaaa1261
tataagtatatgatttgaattgtctacctgaaaactggaaagcactgacgattagtaaac1321
ggaaaagaacacattgggatatgaatctttattgacatgttggaatatgaaaatgtgaca1381
tcttctcccctgcattggtgcaggtagtgctgatggcgctggggcgaagagcacatcgag1441
catggagatatcttctgataataataataataacaatgccagcaaccagaacaagtccct1501
cccgccgccggcaccatctccggccgggaagctgccgaacggcatcgtcaaggagcaacc1561
gccgttgcggaccctccggtcgctgacgatgcgcacgactagcaccggcgacctgcggaa1621
gagcatgatggaggacatgccgatggtctcgtccaaggtggacggccccaacggcaagaa1681
gatcgacggcttcctctacaagtacaggaaaggggaggaggtgaggatagtgtgcgtctg1741
ccatggcaacttcctcacgccggcggagttcgtgaagcacgctggcggcggcgacgtcac1801
gaacccgctcaggcacatcgtcgtcaaccccgcgccgtcggtcttcttgtaatgtcggaa1861
tgtacctaggggg1921
<210>3
<211>1934
<212>DNA
<213>Triticum common wheat China spring (Triticumaestivumzhongguochun)
<400>3
gattctgctggctctgcttccccggcgctcgtcgactgttcgttcctccctgggcgctgt1
gatgttcttccctctgggtttggagaccgagaattgcccggcgcgggacggattcgcggc61
aatggcgaggtcttcctgagaatttggccgtccttggaggttggggggaggagggattgg121
cgtctgcttccggcggggaattgcttgcttgctctctctctctgccggacggacatggcg181
tcgagggacttcttgggcaggttcggcggcgagaagggctcgtcgtcggacaaggcgggg241
ggcggcgccggcgagcccgacgaggtggtcgagctcagcctgggcctgtccctgggcggc301
tgcttcggcgccaactccggccgggacgccaagaagccgcggctggtgcgctcctcctcc361
ctcgccgccatgtactcgctcccgggcaccagcgacgacctcgccgccgccacgcccccg421
ccggcgccgctgatgcgcaccagctcgctccccaccgagacggaggaggagcggtggcgc481
cgccgcgagatgcagagcctcaagcgcctccaggccaagcgcaagcgcctcgagcgccgc541
acctccatgaactccggcaagtccggcggcagcagcagccgggacgacgcccaggagccg601
ctctaccccagcgcgttccagctccgccgctccgtcgtcgaccaggggaacacctcctca661
agcatgccggagcaaggtatacacatgctttcatcagcttccctaccactcgaactgttt721
gctacaataagcttgcaattcccattgttctattgcgttcccttgcttgaattattcatt781
cagctgcctgttctggttgccaagctctcggcgatccatgcaggtcggtgtcatgccgag841
cttaccgtggttcttttggtaggagatgcatgggcagaggggggatctagcaagtcgagt901
gttctttgccatggatcttgctttggtcttgtgatttactgggatcgattcgttagaacg961
ctagctgagccgatgcttttctttttcgccaaattcattagaaatggggaattcttttct1021
gcacaacctgatgatacttctacgtacgcatgggatttgttgtgttcttttcggggcgtt1081
tgttttgggtgatgtcatttctgggattatttcgagccgtgctgttgctcctagggtctc1141
aagagatgccttctacggcatgtgtctaagcagtttctaagcttttagtcactactaaca1201
gttacgtagcgtcagggtatgattattcaggctaatcattatccgagcagctactactaa1261
atataagtatatgatttgaattgtctacctgaaaactggaaagcactgacgattagtaaa1321
cggaaaagaacacattgggatatgaatctttattgacatgttggaatatgaaaatgtgac1381
atcttctcccctgcattggtgcaggtagtgctgatggcgctgaggcgaagagcacatcga1441
gcatggagatatcttctgataataataataataacaatgccagcaaccagaacaagtccc1501
tcccgccgccggcaccatctccggccgggaagctgccgaacggcatcgtcaaggagcaac1561
cgccgttgcggaccctccggtcgctgacgatgcgcacgactagcaccggcgacctgcgga1621
agagcatgatggaggacatgccgatggtctcgtccaaggtggacggccccaacggcaaga1681
agatcgacggcttcctctacaagtacaggaaaggggaggaggtgaggatagtgtgcgtct1741
gccatggcaacttcctcacgccggcggagttcgtgaagcacgctggcggcggcgacgtca1801
cgaacccgctcaggcacatcgtcgtcaaccccgcgccgtcggtcttcttgtaatgtcgga1861
atgtacctaggggg1921
<210>4
<211>951
<212>DNA
<213>Triticum common wheat China spring (Triticumaestivumzhongguochun)
<400>4
atggcgtcgagggacttcttgggcaggttcggcggcgagaagggctcgtcgtcggacaag1
gcggggggcggcgccggcgagcccgacgaggtggtcgagctcagcctgggcctgtccctg61
ggcggctgcttcggcgccaactccggccgggacgccaagaagccgcggctggtgcgctcc121
tcctccctcgccgccatgtactcgctcccgggcaccagcgacgacctcgccgccgccacg181
cccccgccggcgccgctgatgcgcaccagctcgctccccaccgagacggaggaggagcgg241
tggcgccgccgcgagatgcagagcctcaagcgcctccaggccaagcgcaagcgcctcgag301
cgccgcacctccatgaactccggcaagtccggcggcagcagcagccgggacgacgcccag361
gagccgctctaccccagcgcgttccagctccgccgctccgtcgtcgaccaggggaacacc421
tcctcaagcatgccggagcaaggtagtgctgatggcgctgaggcgaagagcacatcgagc481
atggagatatcttctgataataataataataacaatgccagcaaccagaacaagtccctc541
ccgccgccggcaccatctccggccgggaagctgccgaacggcatcgtcaaggagcaaccg601
ccgttgcggaccctccggtcgctgacgatgcgcacgactagcaccggcgacctgcggaag661
agcatgatggaggacatgccgatggtctcgtccaaggtggacggccccaacggcaagaag721
atcgacggcttcctctacaagtacaggaaaggggaggaggtgaggatagtgtgcgtctgc781
catggcaacttcctcacgccggcggagttcgtgaagcacgctggcggcggcgacgtcacg841
aacccgctcaggcacatcgtcgtcaaccccgcgccgtcggtcttcttgtaa901
<210>5
<211>316
<212>PRT
<213>Triticum common wheat China spring (Triticumaestivumzhongguochun)
<400>5
MetAlaSerArgAspPheLeuGlyArgPheGlyGlyGluLysGlySer
151015
SerSerAspLysAlaGlyGlyGlyAlaGlyGluProAspGluValVal
202530
GluLeuSerLeuGlyLeuSerLeuGlyGlyCysPheGlyAlaAsnSer
354045
GlyArgAspAlaLysLysProArgLeuValArgSerSerSerLeuAla
505560
AlaMetTyrSerLeuProGlyThrSerAspAspLeuAlaAlaAlaThr
65707580
ProProProAlaProLeuMetArgThrSerSerLeuProThrGluThr
859095
GluGluGluArgTrpArgArgArgGluMetGlnSerLeuLysArgLeu
100105110
GlnAlaLysArgLysArgLeuGluArgArgThrSerMetAsnSerGly
115120125
LysSerGlyGlySerSerSerArgAspAspAlaGlnGluProLeuTyr
130135140
ProSerAlaPheGlnLeuArgArgSerValValAspGlnGlyAsnThr
145150155160
SerSerSerMetProGluGlnGlySerAlaAspGlyAlaGluAlaLys
165170175
SerThrSerSerMetGluIleSerSerAspAsnAsnAsnAsnAsnAsn
180185190
AlaSerAsnGlnAsnLysSerLeuProProProAlaProSerProAla
195200205
GlyLysLeuProAsnGlyIleValLysGluGlnProProLeuArgThr
210215220
LeuArgSerLeuThrMetArgThrThrSerThrGlyAspLeuArgLys
225230235240
SerMetMetGluAspMetProMetValSerSerLysValAspGlyPro
245250255
AsnGlyLysLysIleAspGlyPheLeuTyrLysTyrArgLysGlyGlu
260265270
GluValArgIleValCysValCysHisGlyAsnPheLeuThrProAla
275280285
GluPheValLysHisAlaGlyGlyGlyAspValThrAsnProLeuArg
290295300
HisIleValValAsnProAlaProSerValPheLeu***
305310315
<210>6
<211>20
<212>DNA
<213>artificial sequence
<400>6
cttcctgagaatttggccgt20
<210>7
<211>20
<212>DNA
<213>artificial sequence
<400>7
tgagctcgaccacctcgtcg20