CN105671060B - Wheat ear germinating resistance related gene and its application - Google Patents
Wheat ear germinating resistance related gene and its application Download PDFInfo
- Publication number
- CN105671060B CN105671060B CN201610265113.3A CN201610265113A CN105671060B CN 105671060 B CN105671060 B CN 105671060B CN 201610265113 A CN201610265113 A CN 201610265113A CN 105671060 B CN105671060 B CN 105671060B
- Authority
- CN
- China
- Prior art keywords
- wheat
- sequence
- taafp
- dna
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses wheat ear germinating resistance related gene and its applications.The wheat ear germinating resistance related gene, one of with following nucleotide sequence: 1) in sequence table in SEQ ID №: 1 or sequence table SEQ ID №: 2 nucleotide sequence；2) there is 90% or more homology with the DNA of SEQ ID №: 2 in the DNA of SEQ ID №: 1 in sequence table or sequence table, and encodes the DNA sequence dna of identical function protein；3) nucleotide sequence that the DNA sequence dna that can be limited with the DNA sequence dna of SEQ ID №: 1 or SEQ ID №: 2 under high high stringency conditions hybridizes.Using the gene assisting sifting ear germinating resistance or sensibility wheat, its implementation method can be used for the early generation selection of wheat ear germinating resistance breeding, greatly shorten breeding cycle, accelerate breeding speed, reduces breeding cost, it is easy to operate, it is low in cost, it is suitable for popularization and application, provides technical support for wheat anti growing out breeding, provide a kind of efficiently selection method for breeding ear germinating resistance wheat germplasm.
Description
Technical field
The present invention relates to wheat ear germinating resistance related gene and its applications.
Background technique
When wheat encounters overcast and rainy or wet environment before harvest, seed will be in head sprouting, that is, wheat ear germinating.Wheat
The phenomenon that Spike sprouting is major issue existing for Major Wheat producing country, the world.Spike sprouting causes wheat quality seriously to reduce
Even completely lose.In countries such as France, the U.S., Canada, Australia, by the harm of wheat ear germinating, wherein plus taking
Big and Australia is particularly acute.China middle and lower reach of Yangtze River, southwestern Winter Wheat Area and Northeasten Spring Wheat Area of China are harvest season easy rainfalls
Area, Northern Winter area major part white wheat kind is highly sensitive to Spike sprouting, and harvest time meets rain and easily causes Spike sprouting.
Wheat ear germinating causes that a series of biochemical reaction, especially some carbohydrate degradations occur inside seed
Enzyme, proteolytic enzyme (such as alpha-amylase) enzymatic activity increase, and the storage reserve degradation in embryo and endosperm makes wheat seed egg
White matter content is successively decreased, gluten strength decline, so that the grain yield of wheat and the processing quality of bulk density decline, flour deteriorate.
It is the stickness such as bread made of germinated wheat powder, noodles, easily broken, and bite is poor, mouthfeel is bad, so Spike sprouting has seriously affected wheat
Quality, edible and Seed practical value, cause serious economic loss to crop production.So how to control wheat aging time fringe
Germination, and then the excellent anti growing out kind of acquired character has become the important topic of world wheat breed improvement, domestic explant
Object breeder and physiologist its identification method, resistance mechanism, Genetic Mechanisms and in terms of grind extensively
Study carefully.
Developing molecular labeling relevant to ear germinating resistance and seed hibernation feature is the effective means for improving detection efficiency.
It has been carried out using the labels such as SSR, STS, RFLP and conventional genetic assays method in relation to seed dormancy and anti growing out gene
Positioning, discovery from the 1st to the 7th genome have QTL relevant to ear germinating resistance, wherein the 3rd and the 4th chromosome
Group is the frequent report region of major gene resistance.Using molecular mark, anti growing out germ plasm resource and product can be accelerated
The incubation of kind.The common location on 1AS, 2AS, 2AL, 5DL, 4AL, 5DL, 6BL chromosome such as Anderson has gone out 10 and has sent out with fringe
The related RFLP label of bud resistance, such asXcn1.bcd1434、Xcn1.cdo431、Xcn1.cdo64、Xcn1.Wg996aDeng.
Roy etc. utilizes STMS(Sequence-tagged Microsatellites) and STS(Sequence-tagged site) label
Located on 6BS and 7DL chromosome respectively control Spike sprouting major gene resistance, respectively withCwmc104WithXmst101Label is tight
It is close chain.The ear germinating resistance of kernel seed coat colour and wheat that R gene is controlled is closely related, can be used as an ear germinating resistance
Label apply.Yang Yan etc. is according to the transcription factor of the control seed dormancy reported in cornVP1In Chinese Wheat Cultivars
It has developedVp1B3WithVp1A3STS label, and be located on 3BL that (Yang Yan, Zhang Chunli, Chen Xinmin wait
Spike sprouting rate and germination index and STS labelVp1B3Application [J] wheat crops in wheat anti growing out genotype identification
Journal, 2007,27 (4): 577-582.).Control Grain Dormancy and marquis relevant to ear germinating resistance have been identified at present
Gene is selected to haveVp-1、ABI3、FUS3AndLECIDeng, these genes all have double effects, not only Inhibiting germination but also promote and embryo
Mature related process.
Vp-1Be adjust embryonic development, the synthesis that promotes embryo mature and inhibit alpha-amylase so promote the transcription of suspend mode because
Son.It is obtained in arabidopsisVp-1Homologous geneABI3Also withABI5Homologous gene each other.ABI3WithABI5In ABA signal
Regulate and control the maturation and sprouting of seed in the approach of regulation by interaction, and related to the dehydration resistance of embryo in the seed afterripening stage
Expression (MCKIBBIN R S, WILKINSON M D, BAILEY P C, the et al. Transcripts of of gene
Vp-1 homologues are misspliced in modern wheat and ancestral species[J].
Proceedings of the National Academy of Science USA, 2002, 99: 10203-10208.)。ABI5Expression inhibiting byABI3To the insensitivity of ABA in caused seed germination, andABI3Overexpression promote
IntoABI5Expression, soABI5It is epistatic gene, andABI3It is hypostatic gene.ABI5WithABRE(ABA response original part,
ACGTGG/TC) regulate and control the promoter sequence of ABA response gene jointly.ABA is by improving transcriptional activity and increasing protein
Stability induces the accumulation of ABI5 albumen, and the stability and activity of ABI5 albumen is related to its phosphorylation.AFPAs
The negative regulatory factor of ABA response, withABI5Interaction simultaneously acts onABI5Upstream, and take part in the degradation of ABI5 albumen, preventABI5Excess accumulation, regulate and control ABI5 protein level by promoting the degradation of ABI5 albumen, and then weaken ABA signals-modulating,
It may inhibit the regulatory mechanism of seed dormancy closely related (Naruhito Ohnishi1, Eiko with promotion embryo germination
Himi1, Yoshiki Yamasaki1, et al. Differential expression of three ABA-
insensitive five binding protein (AFP)-like genes in wheat . Genes Genet
Syst, 2008, 83: 167-177)。
In wheatAtAFPThree homologous genesTaAFP- A、TaAFP-BWithTaAFP- DBe located at wheat 2A,
On 2B and 2D chromosome, the genetic fragment length obtained at present is respectively 3289 bp, 3922 bp and 3128bp.TaAFPsPacket
Include an introne, two exon (Lopez-Molina L, Mongrand S, Kinoshita N, Chua NH..
AFP is a novel negative regulator of ABA signaling that promotes ABI5 protein
degradation [J]. Genes Devel 2003, 17: 410-418.) 。TaAFPsThe initiation codon ATG's of gene
The sequence of 800 bp in the region of upstream -5 ' is conservative, wherein containing ABA response element, center original part G-box and dehydration
Element etc..
Compare arabidopsisAtAFPAnd wheatTaAFPThe sequence of gene is found:AtAFPWithTaAFPStructure it is similar, all wrap
The centralized positioning domain of the sequence containing speculating acid and positioned at C-terminal regionABI5Binding domain, stillAtAFPIn seed development and hair
Bud early stage is more active, andTaAFPIn s especiallyTaAFP-BIt is expressed in many tissues, such as dead leaf, root, in seedling and development
Seed, and in addition to ABA, salt and desiccation stress are all raisedTaAFPExpression.Wu's etc. research shows that: as bZIP type
Transcription factor GCN4 element (5 '-A/GTGAC/GTCAT-3 '), in endosperm specificity expression be one it is key because
Son.In arabidopsisAtAFPGene has a GCN4 element in 5 ' regions, andTaAFPThere is no GCN4 element in s gene, thus it is speculated thatTaAFPThe missing of GCN4 binding site, Ke Nenghe in s gene 5 ' regionTaAFPWide expression is related in each tissue。WithTaAFP-AWithTaAFP-DABA response and some Stress responses (such as salt and be dehydrated) are participated in compare,TaAFP-BIn each tissue
Significant expression.TaAFP-AWithTaAFP-DRAV1(and ABI3/VP1, B3 domain-type relevant CAACA, CACCTG)
Element is complete, andTaAFP-BOnly 5 '-CACCTG-3 ' element, andTaAFP-B5 ' regions have one it is distinctive with it is single
The element Dof, Dof (5 '-AAAG-3 ') of the transcription factor effect of zinc fingers identify the DNA sequence dna containing AAAG or CTTT,
Speculate that Dof element may be withTaAFP-BDominant expression is related in each tissue.DOF class transcription factor have now been found that there is only with
It in plant, is expressed in unifacial leaf and dicots, stem, leaf, and participates in plant growth, development.These threeTaAFPsSmall
It may serve in ABA acknowledgement mechanism in wheat evolutionary process different.
Summary of the invention
It is an object of the present invention to provide wheat ear germinating resistance related genes.
Wheat ear germinating resistance related gene provided by the present invention, title are respectivelyTaAFP-Ba(SEQ ID №: 1)
WithTaAFP-Bb(SEQ ID №: 2) has one of following nucleotide sequence:
1) in sequence table in SEQ ID №: 1 or sequence table SEQ ID №: 2 nucleotide sequence；
2) same with 90% or more with the DNA of SEQ ID №: 2 in the DNA of SEQ ID №: 1 in sequence table or sequence table
Source property, and encode the DNA sequence dna of identical function protein；
3) DNA sequence dna that can be limited with the DNA sequence dna of SEQ ID №: 1 or SEQ ID №: 2 under high high stringency conditions is miscellaneous
The nucleotide sequence of friendship.
Wheat ear germinating resistance related gene provided by the present invention, title are respectivelyTaAFP-Ba(SEQ ID №: 1)
WithTaAFP-Bb(SEQ ID №: 2),WithTaAFP-BGene (SEQ ID №: 3) is compared, and homology is all up to 90% or more,
And the amino acid sequence (SEQ ID №: 5) of its coded sequence (SEQ ID №: 4) coding identical function protein.
TaAFP-BaWithTaAFP-BbGene isTaAFP-BThe allelic variation of gene,TaAFP-BThe 5 ' of geneUTRArea
It is inserted into the nucleotide sequence of 2bp in domain, isTaAFP-BaGene,?TaAFP-BThe 5 ' of geneUTRThe core of 2bp is lacked in region
Nucleotide sequence isTaAFP-BbGene.
TaAFP-BThe nucleotide sequence overall length of gene is 3992bp (AB360912).TaAFP-BGene is by 2 exons
It is formed with 1 introne, is First Exon from 5 ' the 2082nd to 2583, end deoxynucleotides of full length sequence, from overall length
5 ' the 2584th to 3311, end deoxynucleotides of sequence are introne, hold the 3312nd to 3760 from the 5 ' of full length sequence
Deoxynucleotide is Second Exon.TaAFP-BaWithTaAFP-BbGene is from the 5 ' of full length sequence ends the in 5 ' UTR regions
2bp is inserted into and has lacked respectively at 2054 deoxynucleotides.
Contain the present inventionTaAFP-Ba(SEQ ID №: 1) orTaAFP-BbThe recombinant expression of (SEQ ID №: 2) gene
Carrier, transgenic cell line and engineering bacteria all belong to the scope of protection of the present invention.
It is that detection is to be measured small a second object of the present invention is to provide a kind of method of assisting sifting ear germinating resistance wheat
WheatTaAFP-BThe nucleotide sequence that 2bp whether has been lacked in 5 ' UTR regions of gene, such as the TaAFP-B gene of the wheat to be measured
5 ' UTR regions in lack 2bp nucleotide sequence then ear germinating resistance is relatively high.
Wheat to be measured can be detected with PCR methodTaAFP-BWhether the nucleosides of 2bp has been lacked in 5 ' UTR regions of gene
Acid sequence.
The PCR method is using the genomic DNA of wheat to be measured as template, by the nucleotide of sequence 6 and sequence 7 in sequence table
Sequence composition pair of primers TaAFP-BF4/R4 carry out PCR amplification, amplified production with 10% PAGE glue, 60W power, electricity
Swimming is detected for 2.0 hours, described to be measured small if it is the band of 203bp that detection, which has size, in obtained pcr amplification product
Wheat is that ear germinating resistance is relatively high.
Sequence designations by primer TaAFP-B F4/R4 areTaAFP-BF,It is basisTaAFPGene is in 1 B gene group
The STS label relevant with ear germinating resistance of one of difference design between ear germinating resistance and sensitive material.
It is that detection is to be measured third object of the present invention is to provide a kind of method of assisting sifting Sprouting susceptibility wheat
WheatTaAFP-BThe nucleotide sequence that 2bp whether is inserted in 5 ' UTR regions of gene, such as the wheat to be measuredTaAFP-B
2bp is inserted into 5 ' UTR regions of gene, and then Sprouting susceptibility is relatively high.
Wheat to be measured can be detected with PCR methodTaAFP-BWhether the nucleosides of 2bp is inserted in 5 ' UTR regions of gene
Acid sequence.
The PCR method is using the genomic DNA of wheat to be measured as template, by the nucleotide of sequence 6 and sequence 7 in sequence table
Sequence composition pair of primers TaAFP-BF4/R4 carry out PCR amplification, amplified production with 10% PAGE glue, 60W power, electricity
Swimming is detected for 2.0 hours, if it is the band of 207bp that detection, which has size, in obtained pcr amplification product, i.e., described to be measured small
Wheat is that Sprouting susceptibility is relatively high.
The method of assisting sifting ear germinating resistance or sensibility wheat of the invention is more suitable for white wheat kind.
The technology of the present invention advantage is the good effect obtained:
1, it has found for the first timeTaAFP-BaWithTaAFP-Bb, resist further to study the different Spike sproutings of white wheat kind
The functional study of property and its exploitation of molecular labeling are laid a good foundation.TaAFPsABA acknowledgement mechanism during Wheat Evolution
It is middle may serve it is different,AndTaAFP-BaWithTaAFP-BbForTaAFP-A、DWithBResearch mechanism provide fundamental basis.
2, the method for assisting sifting ear germinating resistance of the invention or sensibility wheat can be used for wheat ear germinating resistance and educate
The early generation selection of kind, substantially reduces breeding cycle, accelerates breeding speed, greatly reduce breeding cost, special with operation
Not simple, cost is very cheap, and period short advantage is suitable for popularization and application, provides technology branch for wheat anti growing out breeding
It holds, provides a kind of efficiently selection method for breeding ear germinating resistance wheat germplasm.
Detailed description of the invention
Fig. 1TaAFP-BWithTaAFP-BaWithTaAFP-Bb5 ' UTR region comparing results；In figure: all 8425B are representedTaAFP-BaSequence, Wan County Bai Maizi representTaAFP-BbSequence.
Fig. 2 TaAFP-BF4/R4 polypropylene segment acrylamide gel electrophoresis detection is as a result, in figure: 1. Pseudomonas Jinanensis Cell Walls；2. ocean is small
Wheat；3. week 8425B；4. high yield 3；5. Mount Taishan 008；6. Shijiazhuang 8；7. the white wheat in Langzhong；8. the white wheat in Wan County；9 Yongchuan
Bai Maizi；10. small white jade flower.
Specific embodiment
Wheat lines are purchased from national germ plasm resource gene pool in following embodiments.
The present invention utilizes Chinese springTaAFPThe conserved sequence of gene devises primer, respectively to A, B and D genome
'sTaAFPGene is expanded, and is not found differences on A genome and D genome；And it is had found in 1 B gene group and fringe
The relevant allelic variation of germinating resistance, there are the insertions or missing of a 2bp in 5 ' UTR regions, and it is most of to be inserted into type
Be present in the material of ear germinating resistance rdativery sensitive, and deletion type to be then mostly present in ear germinating resistance relatively high
Material in.According toTaAFPDifference of the gene in 1 B gene group between the different material of ear germinating resistance devises one and fringe
The relevant STS label of germinating resistanceTaAFP-BF, the results showed that this label shows polymorphism, amplify respectively 207bp and
203bp banding pattern, is respectively designated asTaAFP-Ba(SEQ ID №: 1) andTaAFP-Bb(SEQ ID №: 2).
1, allelic variationTaAFP-BaWithTaAFP-BbDiscovery
With the different wheat week 8425B(GI:56.0 of ear germinating resistance), the white wheat in Yongchuan (GI:23.2), the white wheat in Langzhong
(GI:8.4), the white wheat in Wan County (GI:7.6) is material, to itTaAFPGene carries out segmentation amplification in A, B and D genome, so
After be sequenced, the results showed thatTaAFPGene does not find differences on A genome and D genome；And 5 ' the UTR in 1 B gene group
There are the insertion of 2bp or missings in region, will be inserted into 2bp'sTaAFP-BAllele be named asTaAFP-Ba,Lack 2bp
Be named asTaAFP-Bb.Fig. 1 isTaAFP-B、TaAFP-BaWithTaAFP-BbPartial sequence compares in 5 ' UTR regions of gene
As a result.
2, allelic variationTaAFP-BaWithTaAFP-BbAcquisition
TaAFP-BaAcquisition: using the genomic DNA of all 8425B as template, formed with sequence 6 in sequence table and sequence 7
Primer TaAFP-BF4/R4 carry out PCR amplification, wherein PCR amplification condition be first 94 DEG C initial denaturation 5 minutes；Then 35 are carried out
A circulation, it is each circulation 94 DEG C be denaturalized 45 seconds, 61 DEG C renaturation 45 seconds, 72 DEG C extend 1 minute；Last 72 DEG C extend 10 minutes.
TaAFP-BbAcquisition: using the genomic DNA of the white wheat in Wan County as template, with sequence 6 in sequence table and 7 groups of sequence
At primer TaAFP-BF4/R4 carry out PCR amplification, wherein PCR amplification condition be first 94 DEG C initial denaturation 5 minutes；Then it carries out
35 circulation, it is each circulation 94 DEG C be denaturalized 45 seconds, 61 DEG C renaturation 45 seconds, 72 DEG C extend 1 minute；Last 72 DEG C extend 10 minutes.
3. the different assisting sifting of wheat ear germinating resistance
(1) basisTaAFP-BAllelic variation sequence design STS labelTaAFP-BF, with 6 He of sequence in sequence table
The primer TaAFP-BF4/R4 that sequence 7 forms carries out PCR amplification, amplified reaction to the white grain kind of 10 different ear germinating resistances
For total volume by taking 15 μ l as an example, reaction solution group becomes 7.95 μ L of ddH2O；10 × LA PCR Buffer, 1.5 μ L；dNTP
(2.5mm), 1.2 μ L；Each 0.3 μ L of Primers；LA Taq (5U/ul), 0.15 μ L；0.6 μ L of Wheat volatiles DNA.
Response procedures be first 94 DEG C initial denaturation 5 minutes；Then it carries out 35 to recycle, the denaturation 45 seconds of 94 DEG C of each circulation, 61
DEG C renaturation 45 seconds, 72 DEG C extended 1 minute；Last 72 DEG C extend 10 minutes.PCR product is stored in 4 DEG C.
Then with 10% PAGE glue under the power of 60W 2.0 hours electrophoresis detection PCR products of electrophoresis.
As a result as shown in Fig. 2, there are two kinds of banding patterns: the segment of 203bp occur in the relatively high kind of resistance, in fringe
There is the segment of 207bp in the relatively high kind of Sprouting Susceptibility.
(2) choose the white grain kind of 91 different ear germinating resistances detect assisting sifting ear germinating resistance of the invention or
The feasibility of sensitive wheat.
Respectively using the genomic DNA of the white grain kind of 91 different ear germinating resistances as template, according to step 1 method into
Row amplification and electrophoresis, the results showed that share 23 kinds and amplify the segment of 207bp, wherein having 3 kinds is ear germinating resistance
Material (Spike sprouting index GI be 0-30%), 11 kinds are anti-material (Spike sprouting index GI is 30-50%) in Spike sprouting, 9
A kind is Spike sprouting sensitive material (Spike sprouting index GI is > 50%)；The segment that 68 kinds amplify 203bp is shared, wherein
Having 31 kinds is ear germinating resistance material (Spike sprouting index GI is 0-30%), and 29 kinds are anti-material (fringe in Spike sprouting
Germination index GI is 30-50%), 8 kinds are Spike sprouting sensitive material (Spike sprouting index GI is > 50%).
The white wheat of 91 different ear germinating resistances and useTaAFP-BFThe relationship of the two kinds of segments amplified such as table
1, shown in table 2.
The polymorphism of the GI value of 1 91 parts of table different ear germinating resistance white wheats and STS label
The polymorphism (No. 81-91) of the GI value of 2 91 parts of table different ear germinating resistance white wheats and STS label
Sequence table
<110>Yang Yan
<120>wheat ear germinating resistance related gene and its application
<160> 7
<210> 1
<211> 1937
<212> DNA
<213>Triticum common wheat week 8425B(Triticum aestivum zhou 8425B)
<400> 1
gattctgctg gctctgcttc cccggcgctc gtcgattgtt cgttcctccc tgggcgctgt 1
gatgttcttc cctctgggtt tgaagaccga gaattgcccg gcgcgggacg gattcgcggc 61
aatggcgagg tcttcctgag aatttggccg tccttggagg ttggggggag gagggattgg 121
cgtctgcttc gcggcgggga attgcttgct ctctctctct ctctctgccg gacggacatg 181
gcgtcgaggg acttcttggg caggttcggc ggcgagaagg gctcgtcgtc ggacaaggcg 241
gggggcggcg ccggcgagcc cgacgaggtg gtcgagctca gcctgggcct gtccctgggc 301
ggctgcttcg gcgccaactc cggccgggac gccaagaagc cgcggctggt gcgctcctcc 361
tccctcgccg ccatgtgctc gctcccgggc accagcgacg acctcgccgc cgccacgccc 421
ccgccggcgc cgctgatgcg caccagctcg ctccccaccg agacggagga ggagcggtgg 481
cgccgccgcg agatgcagag cctcaagcgc ctccaggcca agcgcaagcg cctcgagcgc 541
cgcacctcca tgaactccgg caagtccggc ggcagcagca gccgggacga cgcccaggag 601
ccgctctacc ccagcgcgtt ccagctccgc cgctccgtcg tcgaccaggg gaacacctcc 661
tcaagcatgc cggagcaagg tatacacatg ctttcatcag cttccctacc actcgaactg 721
tttgctacaa taagcttgca attcccactg ttctattgcg ttcccttgct tgaattattc 781
attcagctgc ctgttctggt tgccaagctc tcggcgatcc atgcaggtcg gtgtcatgcc 841
gagcttaccg tggttctttt ggtaggagat gcatgggcag aggggggatc tagcaagtcg 901
agtgttcttt gccatggatc ttgctttggt cttgtgattt actgggatcg attcgttaga 961
acgctagctg agccgatgct tttctttttc gccaaattca ttagaaatgg ggaattcttt 1021
tctgcacaac ctgatgatac ttctacgtac gcatgggatt tgttgtgttc ttttcggggc 1081
gtttgttttg ggtgatgtca tttctgggat tatttcgagc cgtgctgttg ctcctagggt 1141
ctcaagagat gccttctacg gcatgtgtct aagcagtttc taagctttta gtcactacta 1201
acagttacgt agcgtcaggg tatgattatt caggctaatc attatccgag cagctactac 1261
taaatataag tatatgattt gaattgtcta cctgaaaact ggaaagcact gacgattagt 1321
aaacggaaaa gaacacattg ggatatgaat ctttattgac atgttagaat atgaaaatgt 1381
gacatcttct cccctgcatt ggtgcaggta gcgctgatgg cgctgaggcg aagagcacat 1441
cgagcatgga gatatcttct gataataata ataataacaa tgccagcaac cagaacaagt 1501
ccctcccgcc gccggcacca tctccggccg ggaagctgcc gaacggcatc gtcaaggagc 1561
aaccgccgtt gcggaccctc cggtcgctga cgatgcgcac gactagcacc ggcgacctgc 1621
ggaagagcat gatggaggac atgccgatgg tctcgtccaa ggtggacggc cccaacggca 1681
agaagatcga cggcttcctc tacaagtaca ggaaagggga ggaggtgagg atagtgtgcg 1741
tctgccatgg caacttcctc acgccggcgg agttcgtgaa gcacgctggc ggcggcgacg 1801
tcacgaaccc gctcaggcac atcgtcgtca accccgcgcc gtcggtcttc ttgtaatgtc 1861
ggaatgtacc taggggg 1921
<210> 2
<211> 1933
<212> DNA
<213>the white wheat in Triticum common wheat Wan County (Triticum aestivum wanxianbaimaizi)
<400> 2
gattctgctg gctctgcttc cccggcgctc gtcgattgtt cgttcctccc tgggcgctgt 1
gatgttcttc cctctgggtt tggagaccga gaattgcccg gcgcgggacg gattcgcggc 61
aatggcgagg tcttcctgag aatttggccg tccttggagg ttggggggag gagggattgg 121
cgtctgcttc gcggcgggga attgcttgct ctctctctct ctgccggacg gacatggcgt 181
cgagggactt cttgggcagg ttcggcggcg agaagggctc gtcgtcggac aaggcggggg 241
gcggcgccgg cgagcccgac gaggtggtcg agctcagcct gggcctgtcc ctgggcggct 301
gcttcggcgc caactccggc cgggacgcca agaagccgcg gctggtgcgc tcctcctccc 361
tcgccgccat gtactcgctc ccgggcacca gcgacgacct cgccgccgcc acgcccccgc 421
cggcgccgct gatgcgcacc agctcgctcc ccaccgagac ggaggaggag cggtggcgcc 481
gccgcgagat gcagagcctc aagcgcctcc aggccaagcg caagcgcctc gagcgccgca 541
cctccatgaa ctccggcaag tccggcggca gcagcagccg ggacgacgcc caggagccgc 601
tctaccccag cgcgttccag ctccgccgct ccgtcgtcga ccaggggaac acctcctcaa 661
gcatgccgga gcaaggtata cacatgcttt catcagcttc cctaccactc gaactgtttg 721
ctacaataag cttgcaattc ccactgttct attgcgttcc cttgcttgaa ttattcattc 781
agctgcctgt tctggttgcc aagctctcgg cgatccatgc aggtcggtgt catgccgagc 841
ttaccgtggt tcttttggta ggagatgcat gggcagaggg gggatctagc aagtcgagtg 901
ttctttgcca tggatcttgc tttggtcttg tgatttactg ggatcgattc gttagaacgc 961
tagctgagcc gatgcttttc tttttcgcca aattcattag aaatggggaa ttcttttctg 1021
cacaacctga tgatacttct acgtacgcat gggatttgtt gtgttctttt cggggcgttt 1081
gttttgggtg atgtcatttc tgggattatt tcgagccgtg ctgttgctcc tagggtctca 1141
agagatgcct tctacggcat gtgtctaagc agtttctaag cttttagtca ctactaacag 1201
ttacgtagcg tcagggtatg attattcagg ctaatcatta tccgagcagc tactactaaa 1261
tataagtata tgatttgaat tgtctacctg aaaactggaa agcactgacg attagtaaac 1321
ggaaaagaac acattgggat atgaatcttt attgacatgt tggaatatga aaatgtgaca 1381
tcttctcccc tgcattggtg caggtagtgc tgatggcgct ggggcgaaga gcacatcgag 1441
catggagata tcttctgata ataataataa taacaatgcc agcaaccaga acaagtccct 1501
cccgccgccg gcaccatctc cggccgggaa gctgccgaac ggcatcgtca aggagcaacc 1561
gccgttgcgg accctccggt cgctgacgat gcgcacgact agcaccggcg acctgcggaa 1621
gagcatgatg gaggacatgc cgatggtctc gtccaaggtg gacggcccca acggcaagaa 1681
gatcgacggc ttcctctaca agtacaggaa aggggaggag gtgaggatag tgtgcgtctg 1741
ccatggcaac ttcctcacgc cggcggagtt cgtgaagcac gctggcggcg gcgacgtcac 1801
gaacccgctc aggcacatcg tcgtcaaccc cgcgccgtcg gtcttcttgt aatgtcggaa 1861
tgtacctagg ggg 1921
<210> 3
<211> 1934
<212> DNA
<213>Triticum common wheat China spring (Triticum aestivum zhongguochun)
<400> 3
gattctgctg gctctgcttc cccggcgctc gtcgactgtt cgttcctccc tgggcgctgt 1
gatgttcttc cctctgggtt tggagaccga gaattgcccg gcgcgggacg gattcgcggc 61
aatggcgagg tcttcctgag aatttggccg tccttggagg ttggggggag gagggattgg 121
cgtctgcttc cggcggggaa ttgcttgctt gctctctctc tctgccggac ggacatggcg 181
tcgagggact tcttgggcag gttcggcggc gagaagggct cgtcgtcgga caaggcgggg 241
ggcggcgccg gcgagcccga cgaggtggtc gagctcagcc tgggcctgtc cctgggcggc 301
tgcttcggcg ccaactccgg ccgggacgcc aagaagccgc ggctggtgcg ctcctcctcc 361
ctcgccgcca tgtactcgct cccgggcacc agcgacgacc tcgccgccgc cacgcccccg 421
ccggcgccgc tgatgcgcac cagctcgctc cccaccgaga cggaggagga gcggtggcgc 481
cgccgcgaga tgcagagcct caagcgcctc caggccaagc gcaagcgcct cgagcgccgc 541
acctccatga actccggcaa gtccggcggc agcagcagcc gggacgacgc ccaggagccg 601
ctctacccca gcgcgttcca gctccgccgc tccgtcgtcg accaggggaa cacctcctca 661
agcatgccgg agcaaggtat acacatgctt tcatcagctt ccctaccact cgaactgttt 721
gctacaataa gcttgcaatt cccattgttc tattgcgttc ccttgcttga attattcatt 781
cagctgcctg ttctggttgc caagctctcg gcgatccatg caggtcggtg tcatgccgag 841
cttaccgtgg ttcttttggt aggagatgca tgggcagagg ggggatctag caagtcgagt 901
gttctttgcc atggatcttg ctttggtctt gtgatttact gggatcgatt cgttagaacg 961
ctagctgagc cgatgctttt ctttttcgcc aaattcatta gaaatgggga attcttttct 1021
gcacaacctg atgatacttc tacgtacgca tgggatttgt tgtgttcttt tcggggcgtt 1081
tgttttgggt gatgtcattt ctgggattat ttcgagccgt gctgttgctc ctagggtctc 1141
aagagatgcc ttctacggca tgtgtctaag cagtttctaa gcttttagtc actactaaca 1201
gttacgtagc gtcagggtat gattattcag gctaatcatt atccgagcag ctactactaa 1261
atataagtat atgatttgaa ttgtctacct gaaaactgga aagcactgac gattagtaaa 1321
cggaaaagaa cacattggga tatgaatctt tattgacatg ttggaatatg aaaatgtgac 1381
atcttctccc ctgcattggt gcaggtagtg ctgatggcgc tgaggcgaag agcacatcga 1441
gcatggagat atcttctgat aataataata ataacaatgc cagcaaccag aacaagtccc 1501
tcccgccgcc ggcaccatct ccggccggga agctgccgaa cggcatcgtc aaggagcaac 1561
cgccgttgcg gaccctccgg tcgctgacga tgcgcacgac tagcaccggc gacctgcgga 1621
agagcatgat ggaggacatg ccgatggtct cgtccaaggt ggacggcccc aacggcaaga 1681
agatcgacgg cttcctctac aagtacagga aaggggagga ggtgaggata gtgtgcgtct 1741
gccatggcaa cttcctcacg ccggcggagt tcgtgaagca cgctggcggc ggcgacgtca 1801
cgaacccgct caggcacatc gtcgtcaacc ccgcgccgtc ggtcttcttg taatgtcgga 1861
atgtacctag gggg 1921
<210> 4
<211> 951
<212> DNA
<213>Triticum common wheat China spring (Triticum aestivum zhongguochun)
<400> 4
atggcgtcga gggacttctt gggcaggttc ggcggcgaga agggctcgtc gtcggacaag 1
gcggggggcg gcgccggcga gcccgacgag gtggtcgagc tcagcctggg cctgtccctg 61
ggcggctgct tcggcgccaa ctccggccgg gacgccaaga agccgcggct ggtgcgctcc 121
tcctccctcg ccgccatgta ctcgctcccg ggcaccagcg acgacctcgc cgccgccacg 181
cccccgccgg cgccgctgat gcgcaccagc tcgctcccca ccgagacgga ggaggagcgg 241
tggcgccgcc gcgagatgca gagcctcaag cgcctccagg ccaagcgcaa gcgcctcgag 301
cgccgcacct ccatgaactc cggcaagtcc ggcggcagca gcagccggga cgacgcccag 361
gagccgctct accccagcgc gttccagctc cgccgctccg tcgtcgacca ggggaacacc 421
tcctcaagca tgccggagca aggtagtgct gatggcgctg aggcgaagag cacatcgagc 481
atggagatat cttctgataa taataataat aacaatgcca gcaaccagaa caagtccctc 541
ccgccgccgg caccatctcc ggccgggaag ctgccgaacg gcatcgtcaa ggagcaaccg 601
ccgttgcgga ccctccggtc gctgacgatg cgcacgacta gcaccggcga cctgcggaag 661
agcatgatgg aggacatgcc gatggtctcg tccaaggtgg acggccccaa cggcaagaag 721
atcgacggct tcctctacaa gtacaggaaa ggggaggagg tgaggatagt gtgcgtctgc 781
catggcaact tcctcacgcc ggcggagttc gtgaagcacg ctggcggcgg cgacgtcacg 841
aacccgctca ggcacatcgt cgtcaacccc gcgccgtcgg tcttcttgta a 901
<210> 5
<211> 316
<212> PRT
<213>Triticum common wheat China spring (Triticum aestivum zhongguochun)
<400> 5
Met Ala Ser Arg Asp Phe Leu Gly Arg Phe Gly Gly Glu Lys Gly Ser
1 5 10 15
Ser Ser Asp Lys Ala Gly Gly Gly Ala Gly Glu Pro Asp Glu Val Val
20 25 30
Glu Leu Ser Leu Gly Leu Ser Leu Gly Gly Cys Phe Gly Ala Asn Ser
35 40 45
Gly Arg Asp Ala Lys Lys Pro Arg Leu Val Arg Ser Ser Ser Leu Ala
50 55 60
Ala Met Tyr Ser Leu Pro Gly Thr Ser Asp Asp Leu Ala Ala Ala Thr
65 70 75 80
Pro Pro Pro Ala Pro Leu Met Arg Thr Ser Ser Leu Pro Thr Glu Thr
85 90 95
Glu Glu Glu Arg Trp Arg Arg Arg Glu Met Gln Ser Leu Lys Arg Leu
100 105 110
Gln Ala Lys Arg Lys Arg Leu Glu Arg Arg Thr Ser Met Asn Ser Gly
115 120 125
Lys Ser Gly Gly Ser Ser Ser Arg Asp Asp Ala Gln Glu Pro Leu Tyr
130 135 140
Pro Ser Ala Phe Gln Leu Arg Arg Ser Val Val Asp Gln Gly Asn Thr
145 150 155 160
Ser Ser Ser Met Pro Glu Gln Gly Ser Ala Asp Gly Ala Glu Ala Lys
165 170 175
Ser Thr Ser Ser Met Glu Ile Ser Ser Asp Asn Asn Asn Asn Asn Asn
180 185 190
Ala Ser Asn Gln Asn Lys Ser Leu Pro Pro Pro Ala Pro Ser Pro Ala
195 200 205
Gly Lys Leu Pro Asn Gly Ile Val Lys Glu Gln Pro Pro Leu Arg Thr
210 215 220
Leu Arg Ser Leu Thr Met Arg Thr Thr Ser Thr Gly Asp Leu Arg Lys
225 230 235 240
Ser Met Met Glu Asp Met Pro Met Val Ser Ser Lys Val Asp Gly Pro
245 250 255
Asn Gly Lys Lys Ile Asp Gly Phe Leu Tyr Lys Tyr Arg Lys Gly Glu
260 265 270
Glu Val Arg Ile Val Cys Val Cys His Gly Asn Phe Leu Thr Pro Ala
275 280 285
Glu Phe Val Lys His Ala Gly Gly Gly Asp Val Thr Asn Pro Leu Arg
290 295 300
His Ile Val Val Asn Pro Ala Pro Ser Val Phe Leu***
305 310 315
<210> 6
<211> 20
<212> DNA
<213>artificial sequence
<400> 6
cttcctgagaatttggccgt 20
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 7
tgagctcgaccacctcgtcg 20
Claims (2)
1. wheat ear germinating resistance related gene, sequence is following nucleotide sequence:
1) in sequence table in SEQ ID №: 1 or sequence table SEQ ID №: 2 nucleotide sequence.
2. containing the recombinant expression carrier of wheat ear germinating resistance related gene described in claim 1, transgenic cell line or
Engineering bacteria.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610265113.3A CN105671060B (en) | 2016-04-26 | 2016-04-26 | Wheat ear germinating resistance related gene and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610265113.3A CN105671060B (en) | 2016-04-26 | 2016-04-26 | Wheat ear germinating resistance related gene and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105671060A CN105671060A (en) | 2016-06-15 |
| CN105671060B true CN105671060B (en) | 2019-07-23 |
Family
ID=56215725
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610265113.3A Expired - Fee Related CN105671060B (en) | 2016-04-26 | 2016-04-26 | Wheat ear germinating resistance related gene and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105671060B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699362B (en) * | 2019-11-15 | 2023-03-24 | 兰州理工大学 | AFP5 gene and application thereof |
| CN111139244B (en) * | 2019-12-30 | 2022-11-18 | 中国科学院遗传与发育生物学研究所 | Populus tomentosa MODD1 gene and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999015667A1 (en) * | 1997-09-19 | 1999-04-01 | Plant Bioscience Limited | Pre-harvest sprouting |
| WO2000018926A1 (en) * | 1998-09-25 | 2000-04-06 | The University Of Queensland | USE OF BIFUNCTIONAL α-AMYLASE SUBTILISIN INHIBITOR PROMOTER SEQUENCE OF BARLEY TO CONFER EXPRESSION IN SEEDS |
| CN1904050A (en) * | 2006-08-08 | 2007-01-31 | 中国农业科学院作物科学研究所 | Wheat ear germinating resistance related gene and its application |
| CN1904049A (en) * | 2006-08-08 | 2007-01-31 | 中国农业科学院作物科学研究所 | Wheat ear germinating resistance related gene and its application |
| CN103160584A (en) * | 2013-03-29 | 2013-06-19 | 中国农业科学院作物科学研究所 | Method and special primer for screening or auxiliary screening of wheat with high pre-harvest sprouting resistance |
| CN105483136A (en) * | 2016-01-04 | 2016-04-13 | 安徽农业大学 | wheat pre-harvest sprouting tolerance gene TaZFP18 and application thereof |
-
2016
- 2016-04-26 CN CN201610265113.3A patent/CN105671060B/en not_active Expired - Fee Related
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999015667A1 (en) * | 1997-09-19 | 1999-04-01 | Plant Bioscience Limited | Pre-harvest sprouting |
| WO2000018926A1 (en) * | 1998-09-25 | 2000-04-06 | The University Of Queensland | USE OF BIFUNCTIONAL α-AMYLASE SUBTILISIN INHIBITOR PROMOTER SEQUENCE OF BARLEY TO CONFER EXPRESSION IN SEEDS |
| CN1904050A (en) * | 2006-08-08 | 2007-01-31 | 中国农业科学院作物科学研究所 | Wheat ear germinating resistance related gene and its application |
| CN1904049A (en) * | 2006-08-08 | 2007-01-31 | 中国农业科学院作物科学研究所 | Wheat ear germinating resistance related gene and its application |
| CN103160584A (en) * | 2013-03-29 | 2013-06-19 | 中国农业科学院作物科学研究所 | Method and special primer for screening or auxiliary screening of wheat with high pre-harvest sprouting resistance |
| CN105483136A (en) * | 2016-01-04 | 2016-04-13 | 安徽农业大学 | wheat pre-harvest sprouting tolerance gene TaZFP18 and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Identification of seed dormancy on chromosome 2BS from wheat cv. Chinese Spring;Xiu-Jin Lan等;《African Journal of Agricultural Research》;20121201;第7卷(第46期);6191-6196 |
| Isolationand characterization of Viviparous-1 genes in wheat cultivars with distinct ABA sensitivity and PHS tolerance;Yang Y;《J Exp Bot》;20071231;第58卷(第11期);2863-2871 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105671060A (en) | 2016-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kahn et al. | Characterization of expression of drought-and abscisic acid-regulated tomato genes in the drought-resistant species Lycopersicon pennellii | |
| DK2602325T3 (en) | The corn plant MON87460 Event and compositions and methods for the detection thereof | |
| CN101508726B (en) | Drought tolerant associated protein for plant, encoding gene and uses thereof | |
| CN102634522B (en) | Gene for controlling rice fertility, encoded protein and application thereof | |
| CN102057045A (en) | Transgenic sugar beet plants | |
| CN109652423B (en) | Rice flowering phase regulating protein and application thereof in breeding | |
| CN112626080B (en) | R gene for controlling soybean-rhizobium matching property, protein and application thereof | |
| CN101265293B (en) | Flowering time correlated albumen from arabidopsis, and coding gene and application thereof | |
| CN101412751B (en) | Protein related to cold resistance of plant, coding genes and application thereof | |
| CN110066774A (en) | Corn receptoroid kinase gene ZmRLK7 and its application | |
| CN105671060B (en) | Wheat ear germinating resistance related gene and its application | |
| CN104558128A (en) | Protein relating to resistance to fusarium graminearum schw stem rot and encoding gene and application thereof | |
| CN117088957B (en) | Application of tomato SlMYB13 protein and encoding gene thereof in regulation and control of salt tolerance and drought tolerance of plants | |
| CN109748959B (en) | Anthocyanin synthesis related protein SlANT1L, and coding gene and application thereof | |
| CN102094021A (en) | Corn callus specific promoter and cloning method and application thereof | |
| CN101736012A (en) | Stress resistance ERF transcription factor gene derived from Brassica napus | |
| CN108341858A (en) | Applications of the paddy gene OsNAR2.1 in terms of drought resisting | |
| CN112813083A (en) | Application of OsCIPK31 gene and coding protein in regulation and control of rice sheath blight disease resistance | |
| CN101560251B (en) | Associated protein for plant root growth and encoding gene and application thereof | |
| CN102899333A (en) | Rice salt stress related gene SIDP364 and coding protein and application thereof | |
| CN111926035B (en) | Application of two WRKY transcription factor genes in rice and coding protein thereof | |
| CN109722441B (en) | Cucumber small heat shock protein Cu-sHSP gene and application thereof | |
| CN102533756B (en) | Promoter and application thereof | |
| CN103320463B (en) | Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene | |
| CN115215930A (en) | Protein PTOX1 for controlling content of total protein and carotenoid in corn seeds as well as encoding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200306 Address after: 010018 No. 306, Wuda Road, Saihan District, the Inner Mongolia Autonomous Region, Hohhot Patentee after: Inner Mongolia Agricultural University Address before: 010018 Erdos Avenue, Saihan District, Hohhot, Inner Mongolia Agricultural University, room 1009, College of life science, the Inner Mongolia Autonomous Region Patentee before: Yang Yan |
|
| TR01 | Transfer of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190723 Termination date: 20210426 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |