CN112813083A - Application of OsCIPK31 gene and coding protein in regulation and control of rice sheath blight disease resistance - Google Patents
Application of OsCIPK31 gene and coding protein in regulation and control of rice sheath blight disease resistance Download PDFInfo
- Publication number
- CN112813083A CN112813083A CN202110207757.8A CN202110207757A CN112813083A CN 112813083 A CN112813083 A CN 112813083A CN 202110207757 A CN202110207757 A CN 202110207757A CN 112813083 A CN112813083 A CN 112813083A
- Authority
- CN
- China
- Prior art keywords
- oscipk31
- gene
- rice
- sheath blight
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/11—Protein-serine/threonine kinases (2.7.11)
- C12Y207/11001—Non-specific serine/threonine protein kinase (2.7.11.1), i.e. casein kinase or checkpoint kinase
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides an application of OsCIPK31 gene and coding protein in regulation and control of rice sheath blight disease resistance, and relates to the technical field of molecular biology. The invention inserts T-DNA into the exon of OsCIPK31 gene of rice to obtain transgenic rice with OsCIPK31 gene knockout, and simultaneously obtains over-expression plants by expressing OsCIPK31cDNA sequence through non-specific promoter Ubiquitin. The invention discovers that oscipk31 mutant rice is more susceptible than wild rice by utilizing the identification of sheath blight resistance; OsCIPK31 overexpression (OsCIPK31OX) transgenic rice is more disease-resistant, and shows that OsCIPK31 positively regulates the resistance of rice to sheath blight.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to an OsCIPK31 gene and application of an encoding protein in regulation and control of rice sheath blight disease resistance.
Background
Sheath blight disease caused by infection of Rhizoctonia solani (Rhizoctonia solani) is one of three major diseases of rice, and seriously threatens rice yield. The incidence of banded sclerotial blight is increased rapidly due to the increase of the nitrogen fertilizer dosage, the introduction of short-stalk multi-tillering varieties and the popularization of the close-planting high-yield cultivation technology. Rhizoctonia solani can survive in soil for decades and has a wide host range, which makes it difficult to control Rhizoctonia solani. At present, a large number of new disease-resistant high-yield varieties are cultivated by improving rice genes through a transgenic technology. The rice transgenic breeding technology has wide application, short period and high efficiency, provides a target for genetic research and improvement of rice sheath blight resistance, can be directly applied to improvement and cultivation of new rice varieties with excellent sheath blight resistance, and provides an effective way for rice disease-resistant breeding.
Plants are stressed by various stresses during growth and development: high salt, low potassium, low temperature, drought, plant diseases and insect pests, etc., which affect the germination rate, photosynthesis, mineral element absorption, etc. of plants. Plants create special systems-transmitting signals to avoid danger from being forced. Ca2+Is a second messenger recognized in plant cells, and when the plants are stressed by adversity, intracellular Ca2+Instantaneous change in concentration by Ca2+The sensor receives and decodes, thereby causing a series of biochemical reactions within the cell. Calcineurin-like B subunit proteins (CBLs) are one of plant calcium sensors, which respond to external stress by interacting with protein kinases downstream thereof to form a CBL-CIPK complex. CBL-interacting protein kinase CIPK (CBL-interacting protein kinase) is a plant specific serine-threonine protein kinase, and can phosphorylate downstream interacting protein with intracellular Ca by means of CBL-sensed signal2+The signal is converted into cell physiological reaction to regulate the plant response to the stress. Expression of OsCIPK31 is affected by a variety of signals, such as cold, salt, light, cytokinin, and the like. The cold resistance of the rice can be improved by over-expressing OsCIPK 31; the research finds that OsCIPK 31: the Ds insertion mutant shows a highly sensitive phenotype to ABA, salt, mannitol and glucose in rice seed germination and seedling stage, but the relation between the OsCIPK31 encoding gene and rice sheath blight resistance is not reported.
Disclosure of Invention
In view of the above, the invention aims to provide an application of an OsCIPK31 gene and an encoding protein in regulation and control of rice sheath blight resistance, a mutant obtained by knocking out the OsCIPK31 gene is more susceptible to diseases, and a mutant obtained by over-expressing the OsCIPK31 gene is more resistant to diseases, so that the OsCIPK31 gene can positively regulate and control the resistance of rice to sheath blight.
In order to achieve the above object, the present invention provides the following technical solutions:
the invention provides application of an OsCIPK31 gene in regulation and control of rice sheath blight disease resistance, wherein the nucleotide sequence of the OsCIPK31 gene is shown as SEQ ID No. 1.
Preferably, the amino acid sequence of the protein encoded by the OsCIPK31 gene is shown as SEQ ID NO. 2.
The invention also provides application of protein coded by the OsCIPK31 gene in regulation and control of rice sheath blight resistance, wherein the nucleotide sequence of the OsCIPK31 gene is shown as SEQ ID No. 1.
The invention also provides application of a reagent for over-expressing the OsCIPK31 gene in enhancing the rice sheath blight resistance, wherein the nucleotide sequence of the OsCIPK31 gene is shown as SEQ ID No. 1.
Preferably, the method for over-expressing the OsCIPK31 gene comprises the step of expressing a cDNA sequence of the OsCIPK31 gene by using a non-specific promoter Ubiquitin.
The invention provides application of an OsCIPK31 gene in regulation and control of rice sheath blight resistance, wherein transgenic rice with oscIPK31 gene knockout is obtained by inserting T-DNA into an exon of a rice OsCIPK31 gene. The identification of sheath blight resistance shows that the oscipk31 mutant rice is more susceptible than the wild type rice; an over-expression plant is obtained by expressing an OsCIPK31cDNA sequence through a non-specific promoter Ubiquitin, and the identification of banded sclerotial blight resistance shows that compared with a wild type, OsCIPK31 over-expression (OsCIPK31OX) transgenic rice is more resistant to diseases, which indicates that OsCIPK31 positively regulates the resistance of the rice to banded sclerotial blight.
Drawings
FIG. 1 is a graph showing the difference between Wild Type (WT) and knockout plant (OsCIPK31), wherein A represents the chromosome morphology in a mutant knockout OsCIPK31 gene and B represents the difference in gene expression between Wild Type (WT) and knockout plant (OsCIPK 31); c represents the phenotype of Wild Type (WT) and knockout plants (oscipk31) after inoculation with Rhizoctonia solani; d represents the ratio of the lesion area to the area of the leaf sheath after inoculation of Rhizoctonia solani on Wild Type (WT) and knockout plants (oscipk 31);
FIG. 2 is a graph showing the difference between Wild Type (WT) and overexpressed plants (OsCIPK31OX), wherein A represents the vector structure of the overexpressed OsCIPK31 gene, B represents the difference in gene expression between OsCIPK31 in the Wild Type (WT) and overexpressed plants (OsCIPK31OX), C represents the phenotype of the Wild Type (WT) and overexpressed plants (OsCIPK31OX) inoculated with Rhizoctonia solani, and D represents the ratio of lesion area to sheath area after inoculation of the Wild Type (WT) and overexpressed plants (OsCIPK31OX) with Rhizoctonia solani.
Detailed Description
The invention provides application of an OsCIPK31 gene in regulation and control of rice sheath blight resistance, wherein the nucleotide sequence of the OsCIPK31 gene is shown as SEQ ID NO. 1: ATGTATAAGGCTAAAAGGACTGCTGCCCAGAAAGTAAGGCGCTGCCTTGGAAAATATGAGCTTGGACGCGCAATTGGTCAAGGAACTTTTGCAAAGGTTAGGTTTGCAAAGAACATGGAGACCGGTGATCATGTTGCTATTAAGATCCTTGACAAAGCGAAGGTTCAGAAGCACAGATTAGTCGAACAGATTAGACGGGAAATTTGTACAATGAAGTTGATACAACACCCCAATGTTGTTCACCTGCATGAGGTGATGGGAAGTAAAACAAGGATTTTCATTGTTCTAGAATATGTGATGGGAGGAGAGCTCCATGATATTATTGCCACAAGTGGAAGGTTGAAGGAGGATGAAGCACGGAAATACTTTCAGCAACTGATCAACGCCGTAGATTACTGCCACAGTAGGGGTGTATACCACAGAGACCTGAAGTTAGAGAATTTGTTGCTTGATACTGCCGGGAACATCAAAGTCTCGGACTTTGGCCTAAGTGCTATATCTGAGCAAGTGAAGGCTGATGGATTACTACATACTACATGTGGAACACCTAATTATGTTGCTCCTGAGGTTATTGAAGATAAGGGCTACGATGGTGCTCTTGCAGACCTTTGGTCATGTGGAGTAATTCTTTTTGTGCTGCTTGCAGGATATCTTCCTTTTGAGGATGAAAATATTGTCTCCCTTTATAACAAGATTTCTGGAGCTCAGTTTACTTGTCCCTCTTGGTTTTCTGCTGAAGCTAAGAGGCTCATTGCTAGAATTCTGGATCCAAATCCTGCTACTCGGATAACTACTTCTCAAGTGCTACAAGATCAATGGTTCAAAAAAGGCTATGAGTCCCCTGTTTTCGATGACAAATATTACCCTTATTTCCACGATGTTTATGATGCTTTTGGAGACTCAGAAGAAAAACATGTGAAAGAGGCTATGGAAGAGCAGCCAACCTTGATGAATGCCTTTGAGTTGATTTCACTAAATAAGGGTCTGAATCTAGACAATTTTTTTGAGTCTGATAAGAAGTACAAGAGAGAGACAAGATTTACATCGCAGTGCCCTCCGAAAGAAATCATCAATAGGATCGAAGAAGCTGCTAACTTACTAGGATTTAATATTCAGAAGAGAAACTACAGGATGAGAATGGAGAATATAAAGGAAGGAAGAAAAGGACATCTAAACATTGCAACTGAGGTTTTCCAAGTGGCACCATCCTTACATGTGGTTGAGCTCAAAAAGGCCAAGGGAGATACCCTGGAGTTTCAAAAGTTCTACCAAACGCTCTCGACGCAACTAAAAGATGTTGTTTGGGAATTAGAAGATGCGGCTGAGGATATGAGCTAA are provided.
The amino acid sequence of the protein encoded by the OsCIPK31 gene is preferably shown as SEQ ID NO. 2: MYKAKRTAAQKVRRCLGKYELGRAIGQGTFAKVRFAKNMETGDHVAIKILDKAKVQKHRLVEQIRREICTMKLIQHPNVVHLHEVMGSKTRIFIVLEYVMGGELHDIIATSGRLKEDEARKYFQQLINAVDYCHSRGVYHRDLKLENLLLDTAGNIKVSDFGLSAISEQVKADGLLHTTCGTPNYVAPEVIEDKGYDGALADLWSCGVILFVLLAGYLPFEDENIVSLYNKISGAQFTCPSWFSAEAKRLIARILDPNPATRITTSQVLQDQWFKKGYESPVFDDKYYPYFHDVYDAFGDSEEKHVKEAMEEQPTLMNAFELISLNKGLNLDNFFESDKKYKRETRFTSQCPPKEIINRIEEAANLLGFNIQKRNYRMRMENIKEGRKGHLNIATEVFQVAPSLHVVELKKAKGDTLEFQKFYQTLSTQLKDVVWELEDAAEDMS are provided.
In the invention, a mutant plant (OsCIPK31) obtained by knocking out the OsCIPK31 gene is more susceptible to rice sheath blight compared with a wild plant; compared with wild plants, mutant plants (OsCIPK31OX) obtained by over-expressing the OsCIPK31 gene are more resistant to rice sheath blight, so that the OsCIPK31 gene positively regulates the resistance of rice to sheath blight.
The invention also provides application of protein coded by the OsCIPK31 gene in regulation and control of rice sheath blight resistance, wherein the nucleotide sequence of the OsCIPK31 gene is shown as SEQ ID No. 1.
In the application of the invention, the amino acid sequence of the protein coded by the OsCIPK31 gene is preferably shown as SEQ ID NO. 2.
The invention also provides application of a reagent for over-expressing the OsCIPK31 gene in enhancing the rice sheath blight resistance, wherein the nucleotide sequence of the OsCIPK31 gene is shown as SEQ ID No. 1. The method for overexpressing the OsCIPK31 gene is not particularly limited in the present invention, and conventional overexpression methods in the art may be used. In the embodiment of the invention, the overexpression plant is preferably obtained by expressing the OsCIPK31cDNA sequence through a non-specific promoter Ubiquitin.
The following examples are provided to illustrate the application of the OsCIPK31 gene and the encoded protein in the regulation of rice sheath blight disease resistance, but they should not be construed as limiting the scope of the present invention.
Example 1
1. Construction of OsCIPK31 gene knockout mutant
T-DNA (T-DNA induced mutation for functional genes in rice, Plant J, 2000.06) consisting of a fragment of pGA1633 vector containing GUS coding sequence and hygromycin gene fragment and hph gene fragment expression initiated by 35S strong promoter was selected from a pool of rice T-DNA mutants (http:// signal. salk. edu/cgi-bin/Rice) and inserted into exon of OsCIPK31 gene (see A in FIG. 1) using the method of J S Jeon et al (T-DNA induced mutation for functional genes in rice, Plant J, 2000.06) to obtain OsCIPK31 knock-out OsCIPK31 mutant.
2. The OsCIPK31 gene knockout mutant OsCIPK31 is subjected to molecular identification, total RNA extracted from rice roots is subjected to reverse transcription, and then RT-PCR is performed by using the following primers.
The OsCIPK31 primers are as follows:
OsCIPK31-F(SEQ ID NO.3)：TGCCACAGTAGGGGTGTGTA；
OsCIPK31-R(SEQ ID NO.4)：CAATCACCTCTGGAGCAACA；
the internal reference gene is Ubiquitin, and the internal reference primer is as follows:
Ubiquitin-F(SEQ ID NO.5)：CACGGTTCAACAACATCCAG；
Ubiquitin-R(SEQ ID NO.6)：TGAAGACCCTGACTGGGAAG。
the RT-PCR products of the present inventionIs prepared according to SYBR Premix Ex Taq instructions and comprises the following components: SYBR Green1 dye 10. mu.L, dNTP (10mM) 1. mu.L, upstream primer 1. mu.L, downstream primer 1. mu.L, cDNA template 5. mu.L, Taq polymerase 2. mu.L, ddH2And O is supplemented to 50 mu L.
The RT-PCR program was: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 20s, extension at 72 ℃ for 20s, and circulating for 35 times; extension at 72 ℃ for 10 min. As shown in FIG. 1B, the relative expression level of OsCIPK31 in OsCIPK31 knock-out mutant OsCIPK31 was significantly lower than that in wild-type rice Dongjin (WT).
3. Phenotypical observations after inoculation of Rhizoctonia solani in Wild Type (WT) and knock-out plants (oscipk 31): the resistance identification is carried out by adopting a method of inoculating sheath bacteria of live leaves of rice by using rhizoctonia solani.
Live leaf sheath inoculation method:
the Wild Type (WT) and knockout plant (oscipk31) rice were planted in buckets, three plants were planted in each bucket, 3 buckets of each variety were used as replicates, and inoculation was performed at the tillering stage of rice. The surface of PDA medium plate is covered with 1 × 0.5cm sterilized bark, then the 4 deg.C stored sheath blight strain R.solaniAG1-IA (Shenyang agriculture university plant protection institute Xuanyuan Hu professor laboratory storage (disclosed in RAVL1 actives breakdown and ethylene signalling to fresh disease informance. phytopathology.2018,108(9):1104 and 1113)) is inoculated on the bark medium in clean bench, and placed in 28 deg.C incubator for continuous culture for 2-3 days, and the hypha is covered with bark and can be used for inoculation. And (5) wetting the rice leaf sheath part to be inoculated with the bacteria by using a watering can. Gently clamping wood bark full of hyphae from the culture dish by using sterilized tweezers, and inserting the wood bark into leaf sheaths of the third leaves below the rice plants. And spraying the leaf sheath part with the veneer by using a spraying pot. Then, a preservative film is used for winding the bacterium receiving part to fully preserve moisture, and the culture is continued under the normal growth condition. The disease starts to be developed in about 3 days, and the preservative film is taken down. Three replicates were used.
And taking a picture 10-15 days after inoculation to record the morbidity, and as shown in C and D in figure 1, the oscipk31 mutant plant is more susceptible to diseases and is expressed as more yellowish green speckles compared with the wild morbidity, and the morbidity area of the leaf sheath part accounts for about 30% and 60% of the area of the stem respectively.
Example 2
1. Construction of OsCIPK31 gene overexpression plant OsCIPK31OX
RNA of a rice variety Nipponbare is extracted and is reversely transcribed into cDNA. Using the cDNA as a template, and using SEQ ID NO. 7: 5'-CCATGGATGTATAAGGCTAAAAGGACTG-3' and SEQ ID NO. 8: 5'-ACTAGT CGGCTGAGGATATGAGCTAA-3' is used as primer to amplify to obtain 1338bp PCR product with nucleotides 1 to 1338 of the sequence shown in SEQ ID NO. 1. The PCR product was digested with NcoI and SpeI, and the resulting digested product was ligated to 13094bp pCAMBIA1302 vector backbone, which was similarly digested, so that the PCR product was inserted between the NcoI and SpeI sites of the pCAMBIA1302 vector, to obtain the final vector.
After sequencing, the recombinant vector is an OsCIPK31 overexpression vector, which is formed by inserting nucleotides 1 to 1338 from the 5' end of the sequence shown in SEQ ID NO.1 into the NcoI and SpeI enzyme cutting sites of the pCAMBIA1302 vector (the structural schematic diagram is shown as A in FIG. 2). The overexpression vector has a promoter of the Ubiquitin gene for the recombinant expression vector with the inverted repeat.
2. The OsCIPK31OX molecular identification of the OsCIPK31 gene overexpression plant is carried out, total RNA extracted from rice leaves is subjected to reverse transcription, the same RT-PCR in the embodiment 1 is carried out by using primers shown by SEQ ID NO.3 and SEQ ID NO.4, and the primers shown by SEQ ID NO.5 and SEQ ID NO.6 are used as reference genes.
As shown in B in FIG. 2, the mean relative expression level of OsCIPK31 in OsCIPK31OX, which is an OsCIPK31 over-expressed plant, was significantly higher than that of OsCIPK31 in wild-type rice Dongjin (WT).
3. The resistance identification is carried out by adopting a method of inoculating sheath of living rice leaves by using rhizoctonia solani.
Wild Type (WT) and over-expressed plant (CIPK31 OX # 1, #3) rice were planted in buckets, three plants were planted in each bucket, 3 buckets of each seed were used as a repeat, and the rice was inoculated at the tillering stage. And (3) paving 1 multiplied by 0.5cm of sterilized wood bark on the surface of a PDA culture medium flat plate, inoculating a sheath blight strain R.solani AG1-IA stored at 4 ℃ on a wood bark culture medium in an ultra-clean workbench, continuously culturing for 2-3 days in a 28 ℃ culture box, and allowing hyphae to be distributed on the wood bark for inoculation. And (5) wetting the rice leaf sheath part to be inoculated with the bacteria by using a watering can. Gently clamping wood bark full of hyphae from the culture dish by using sterilized tweezers, and inserting the wood bark into leaf sheaths of the third leaves below the rice plants. And spraying the leaf sheath part with the veneer by using a spraying pot. Then, a preservative film is used for winding the bacterium receiving part to fully preserve moisture, and the culture is continued under the normal growth condition. The disease starts to be developed in about 3 days, and the preservative film is taken down. Three replicates were used.
And (3) taking pictures after 10-15 days of inoculation, wherein the results are shown in C and D in figure 2, the area of wild type scabs accounts for about 60% of the area of leaf sheaths, the OsCIPK31OX transgenic rice is more disease-resistant, and the area of scabs accounts for about 30% of the area of leaf sheaths, which shows that OsCIPK31 positively regulates the resistance of the rice to sheath blight.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Shenyang agriculture university
<120> OsCIPK31 gene and application of coding protein in regulation and control of rice sheath blight disease resistance
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1338
<212> DNA
<213> Rice (Oryza sativa)
<400> 1
atgtataagg ctaaaaggac tgctgcccag aaagtaaggc gctgccttgg aaaatatgag 60
cttggacgcg caattggtca aggaactttt gcaaaggtta ggtttgcaaa gaacatggag 120
accggtgatc atgttgctat taagatcctt gacaaagcga aggttcagaa gcacagatta 180
gtcgaacaga ttagacggga aatttgtaca atgaagttga tacaacaccc caatgttgtt 240
cacctgcatg aggtgatggg aagtaaaaca aggattttca ttgttctaga atatgtgatg 300
ggaggagagc tccatgatat tattgccaca agtggaaggt tgaaggagga tgaagcacgg 360
aaatactttc agcaactgat caacgccgta gattactgcc acagtagggg tgtataccac 420
agagacctga agttagagaa tttgttgctt gatactgccg ggaacatcaa agtctcggac 480
tttggcctaa gtgctatatc tgagcaagtg aaggctgatg gattactaca tactacatgt 540
ggaacaccta attatgttgc tcctgaggtt attgaagata agggctacga tggtgctctt 600
gcagaccttt ggtcatgtgg agtaattctt tttgtgctgc ttgcaggata tcttcctttt 660
gaggatgaaa atattgtctc cctttataac aagatttctg gagctcagtt tacttgtccc 720
tcttggtttt ctgctgaagc taagaggctc attgctagaa ttctggatcc aaatcctgct 780
actcggataa ctacttctca agtgctacaa gatcaatggt tcaaaaaagg ctatgagtcc 840
cctgttttcg atgacaaata ttacccttat ttccacgatg tttatgatgc ttttggagac 900
tcagaagaaa aacatgtgaa agaggctatg gaagagcagc caaccttgat gaatgccttt 960
gagttgattt cactaaataa gggtctgaat ctagacaatt tttttgagtc tgataagaag 1020
tacaagagag agacaagatt tacatcgcag tgccctccga aagaaatcat caataggatc 1080
gaagaagctg ctaacttact aggatttaat attcagaaga gaaactacag gatgagaatg 1140
gagaatataa aggaaggaag aaaaggacat ctaaacattg caactgaggt tttccaagtg 1200
gcaccatcct tacatgtggt tgagctcaaa aaggccaagg gagataccct ggagtttcaa 1260
aagttctacc aaacgctctc gacgcaacta aaagatgttg tttgggaatt agaagatgcg 1320
gctgaggata tgagctaa 1338
<210> 2
<211> 445
<212> PRT
<213> Rice (Oryza sativa)
<400> 2
Met Tyr Lys Ala Lys Arg Thr Ala Ala Gln Lys Val Arg Arg Cys Leu
1 5 10 15
Gly Lys Tyr Glu Leu Gly Arg Ala Ile Gly Gln Gly Thr Phe Ala Lys
20 25 30
Val Arg Phe Ala Lys Asn Met Glu Thr Gly Asp His Val Ala Ile Lys
35 40 45
Ile Leu Asp Lys Ala Lys Val Gln Lys His Arg Leu Val Glu Gln Ile
50 55 60
Arg Arg Glu Ile Cys Thr Met Lys Leu Ile Gln His Pro Asn Val Val
65 70 75 80
His Leu His Glu Val Met Gly Ser Lys Thr Arg Ile Phe Ile Val Leu
85 90 95
Glu Tyr Val Met Gly Gly Glu Leu His Asp Ile Ile Ala Thr Ser Gly
100 105 110
Arg Leu Lys Glu Asp Glu Ala Arg Lys Tyr Phe Gln Gln Leu Ile Asn
115 120 125
Ala Val Asp Tyr Cys His Ser Arg Gly Val Tyr His Arg Asp Leu Lys
130 135 140
Leu Glu Asn Leu Leu Leu Asp Thr Ala Gly Asn Ile Lys Val Ser Asp
145 150 155 160
Phe Gly Leu Ser Ala Ile Ser Glu Gln Val Lys Ala Asp Gly Leu Leu
165 170 175
His Thr Thr Cys Gly Thr Pro Asn Tyr Val Ala Pro Glu Val Ile Glu
180 185 190
Asp Lys Gly Tyr Asp Gly Ala Leu Ala Asp Leu Trp Ser Cys Gly Val
195 200 205
Ile Leu Phe Val Leu Leu Ala Gly Tyr Leu Pro Phe Glu Asp Glu Asn
210 215 220
Ile Val Ser Leu Tyr Asn Lys Ile Ser Gly Ala Gln Phe Thr Cys Pro
225 230 235 240
Ser Trp Phe Ser Ala Glu Ala Lys Arg Leu Ile Ala Arg Ile Leu Asp
245 250 255
Pro Asn Pro Ala Thr Arg Ile Thr Thr Ser Gln Val Leu Gln Asp Gln
260 265 270
Trp Phe Lys Lys Gly Tyr Glu Ser Pro Val Phe Asp Asp Lys Tyr Tyr
275 280 285
Pro Tyr Phe His Asp Val Tyr Asp Ala Phe Gly Asp Ser Glu Glu Lys
290 295 300
His Val Lys Glu Ala Met Glu Glu Gln Pro Thr Leu Met Asn Ala Phe
305 310 315 320
Glu Leu Ile Ser Leu Asn Lys Gly Leu Asn Leu Asp Asn Phe Phe Glu
325 330 335
Ser Asp Lys Lys Tyr Lys Arg Glu Thr Arg Phe Thr Ser Gln Cys Pro
340 345 350
Pro Lys Glu Ile Ile Asn Arg Ile Glu Glu Ala Ala Asn Leu Leu Gly
355 360 365
Phe Asn Ile Gln Lys Arg Asn Tyr Arg Met Arg Met Glu Asn Ile Lys
370 375 380
Glu Gly Arg Lys Gly His Leu Asn Ile Ala Thr Glu Val Phe Gln Val
385 390 395 400
Ala Pro Ser Leu His Val Val Glu Leu Lys Lys Ala Lys Gly Asp Thr
405 410 415
Leu Glu Phe Gln Lys Phe Tyr Gln Thr Leu Ser Thr Gln Leu Lys Asp
420 425 430
Val Val Trp Glu Leu Glu Asp Ala Ala Glu Asp Met Ser
435 440 445
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
tgccacagta ggggtgtgta 20
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
caatcacctc tggagcaaca 20
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 6
<210> 7
<211> 28
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 7
ccatggatgt ataaggctaa aaggactg 28
<210> 8
<211> 26
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 8
actagtcggc tgaggatatg agctaa 26
Claims (5)
- The application of the OsCIPK31 gene in regulation and control of rice sheath blight disease resistance is characterized in that the nucleotide sequence of the OsCIPK31 gene is shown as SEQ ID No. 1.
- 2. The use according to claim 1, wherein the protein encoded by the OsCIPK31 gene has an amino acid sequence shown in SEQ ID No. 2.
- The application of the protein coded by the OsCIPK31 gene in regulation and control of rice sheath blight resistance is characterized in that the nucleotide sequence of the OsCIPK31 gene is shown as SEQ ID No. 1.
- 4. The application of a reagent for over-expressing OsCIPK31 gene in enhancing rice sheath blight resistance is characterized in that the nucleotide sequence of the OsCIPK31 gene is shown as SEQ ID No. 1.
- 5. The use of claim 4, wherein the method for over-expressing the OsCIPK31 gene comprises expressing the cDNA sequence of the OsCIPK31 gene by using a non-specific promoter Ubiquitin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110207757.8A CN112813083B (en) | 2021-02-24 | 2021-02-24 | Application of OsCIPK31 gene and coding protein in regulation and control of rice sheath blight disease resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110207757.8A CN112813083B (en) | 2021-02-24 | 2021-02-24 | Application of OsCIPK31 gene and coding protein in regulation and control of rice sheath blight disease resistance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112813083A true CN112813083A (en) | 2021-05-18 |
| CN112813083B CN112813083B (en) | 2022-04-12 |
Family
ID=75865390
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110207757.8A Active CN112813083B (en) | 2021-02-24 | 2021-02-24 | Application of OsCIPK31 gene and coding protein in regulation and control of rice sheath blight disease resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112813083B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114015706A (en) * | 2021-12-17 | 2022-02-08 | 沈阳农业大学 | Application of OsCIPK9 gene and protein in improving herbicide resistance of rice and preparation of high herbicide resistance rice germplasm |
| CN114989283A (en) * | 2022-06-15 | 2022-09-02 | 沈阳农业大学 | Application of TCP19 protein in regulation and control of rice sheath blight resistance |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101906429A (en) * | 2010-03-26 | 2010-12-08 | 武汉大学 | Serine-tryptophan protein kinase gene and preparation method and application thereof |
| CN103555740A (en) * | 2013-10-25 | 2014-02-05 | 山东省农业科学院生物技术研究中心 | Wheat CBL-CIPK (CBL-interacting protein kinase) stress tolerance regulatory factor as well as encoding gene and application thereof |
| CN111286510A (en) * | 2019-05-25 | 2020-06-16 | 华中农业大学 | Application of protein kinase gene PMF1 in regulation and control of heading stage and yield of rice |
-
2021
- 2021-02-24 CN CN202110207757.8A patent/CN112813083B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101906429A (en) * | 2010-03-26 | 2010-12-08 | 武汉大学 | Serine-tryptophan protein kinase gene and preparation method and application thereof |
| CN103555740A (en) * | 2013-10-25 | 2014-02-05 | 山东省农业科学院生物技术研究中心 | Wheat CBL-CIPK (CBL-interacting protein kinase) stress tolerance regulatory factor as well as encoding gene and application thereof |
| CN111286510A (en) * | 2019-05-25 | 2020-06-16 | 华中农业大学 | Application of protein kinase gene PMF1 in regulation and control of heading stage and yield of rice |
Non-Patent Citations (2)
| Title |
|---|
| 无: "XM_015791262", 《GENBANK》 * |
| 无: "XP_015646748", 《GENBANK》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114015706A (en) * | 2021-12-17 | 2022-02-08 | 沈阳农业大学 | Application of OsCIPK9 gene and protein in improving herbicide resistance of rice and preparation of high herbicide resistance rice germplasm |
| CN114015706B (en) * | 2021-12-17 | 2023-01-31 | 沈阳农业大学 | Application of OsCIPK9 gene and protein in improving herbicide resistance of rice and preparation of high herbicide resistance rice germplasm |
| CN114989283A (en) * | 2022-06-15 | 2022-09-02 | 沈阳农业大学 | Application of TCP19 protein in regulation and control of rice sheath blight resistance |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112813083B (en) | 2022-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104869808A (en) | Genes controlling photoperiod sensitivity in maize and sorghum and uses thereof | |
| CN112813083B (en) | Application of OsCIPK31 gene and coding protein in regulation and control of rice sheath blight disease resistance | |
| CN112876551B (en) | Transcription factor SpbHLH89 for regulating and controlling drought tolerance of tomato and application thereof | |
| CN106282201B (en) | maize transcription factor ZmbHLH2 and its application | |
| WO2023065966A1 (en) | Application of bfne gene in tomato plant type improvement and biological yield increase | |
| CN111349634B (en) | Betula platyphylla BpNAC100 gene and amino acid sequence and application thereof | |
| CN111235165A (en) | Lily susceptible fungal gene LrWRKY-S1 and application thereof | |
| CN109879947B (en) | Phyllostachys pubescens transcription factor PheDof2 gene and application thereof | |
| CN113621625B (en) | Application of sesame SiERF103 gene in enhancing plant resistance | |
| CN112250745B (en) | MYB21 gene for regulating and controlling bacterial leaf blight resistance of rice and application thereof | |
| CN101589147A (en) | The maize ERECTA genes for improving plant growth, transpiration efficiency and drought tolerance in crop plants | |
| CN100419080C (en) | Soyabean thermal excited transcryption factor, its coding gene and application | |
| CN110885842A (en) | Application of tomato TGase gene in improvement of abiotic stress resistance of tomato | |
| CN108034662B (en) | Application of wheat stripe rust PSTG _06025 gene in stripe rust prevention and treatment and cultivation method of stripe rust resistant wheat | |
| CN108251435B (en) | Wild downy grape Shang-24 disease-resistant gene VqJAZ4 and application thereof | |
| CN108559753B (en) | Application of wheat stripe rust PSTG _17694 gene in stripe rust prevention and treatment and stripe rust resistant wheat cultivation method | |
| CN114134157B (en) | Application of IbSAP15 gene in regulation and control of leaf type and flower type of sweet potato | |
| CN102471779A (en) | The use of dimerization domain component stacks to modulate plant architecture | |
| CN105175522B (en) | Crowtoe AP2/ERF transcription factors and its encoding gene and application | |
| CN115305252A (en) | Receptor kinase gene OsIFBR1 for regulating and controlling rice resistance | |
| CN101883572A (en) | Sorghum aluminum tolerance gene, sbmate | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN109722441B (en) | Cucumber small heat shock protein Cu-sHSP gene and application thereof | |
| CN110468138B (en) | Gene TSG2 for controlling cold resistance of rice and application thereof | |
| CN112725358A (en) | Application of OsBZR1 gene and encoded protein in regulation and control of rice sheath blight disease resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |