CN107304425A - Rape splits angle related gene and molecular labeling and application - Google Patents
Rape splits angle related gene and molecular labeling and application Download PDFInfo
- Publication number
- CN107304425A CN107304425A CN201610257664.5A CN201610257664A CN107304425A CN 107304425 A CN107304425 A CN 107304425A CN 201610257664 A CN201610257664 A CN 201610257664A CN 107304425 A CN107304425 A CN 107304425A
- Authority
- CN
- China
- Prior art keywords
- rape
- cracking resistance
- gene
- resistance angle
- angle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Botany (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Angle related gene and molecular labeling and application are split the invention provides rape, applicant located the negative-effect QTL site at control cracking resistance angle on rape A09 first, 11.26% ~ 12.07% phenotypic variance can be explained, further a pair of InDel marks are developed using the difference on R1 and R2 genomes（IF4/IR4）, by gene function mark detection silique cracking resistance angle different Q TL sites, can be eliminated in seedling stage, not only save production cost but also greatly improve efficiency of selection.The negative effect QTL point functional gene locality specifics in cracking resistance angle in the present invention, detection method fast and easy is not affected by environment.By detecting cracking resistance angle character Functional marker, you can the cracking resistance angle property of prediction breeding material, and then accurate quick screening cracking resistance angle rape strain.
Description
Technical field
The present invention relates to genetic engineering field, and in particular to rape splits angle related gene and molecular labeling and in crop genetic
Breeding and physiologically apply.
Background technology
Rape is the important oil crops of China, and rape machine receives shattering problem and seriously limits rape production mechanization life at this stage
The raising of production level, the cracking resistance angle property for improving rape cultivation kind is one of important breeding objective at this stage.With quantitative inheritance
Learn and molecular biology method, positioned and cloned by cracking resistance angle related gene, only rape cracking resistance angle molecular mechanism is not ground
Offer theoretical foundation is provided, and cracking resistance angle kind is cultivated for molecular marker assisted selection and establishes solid foundation.At present in rape
The cracking resistance angle gene that can be utilized, mainly comes from through the genetic improvement material of transgenosis acquisition, and related material is in product
In the authorization and popularization planted, because it is difficult really to be applied to production to be limited by many regulations.
Rape and arabidopsis belong to Cruciferae together, there is identical evolutionary source, control arabidopsis Rape pod development and cracking
Gene studies obtains very deep.Control the gene of silique cracking mainly to have in arabidopsis has with fruit lobe marginal layer (i.e. absciss layer) development
The FRUITFULL (FUL) (Gu et al.1998) of pass, SHATTERPROOF1 (SHP1), SHATTERPROOF2 (SHP2)
(Liljegren et al.2000), INDEHISCENT (IND) (Liljegren et al.2004), ALCATRAZ (ALC)
(Rajani et al.2001),REPLUMLESS(RPL)(Roeder et al.2003).And there is complexity between each gene
Network regulation mechanism (Dinneny and Yanofsky 2005).FUL genes be first identify with it is relevant from area's extension
Gene, FUL genes can promote the differentiation and extension of silique chrotoplast as transcription factor, and Liljegren etc. (2000) is proved
SHP1, SHP2 can control the differentiation from area, and cytoproximal lignifying is faced in promotion, but this two genoids homology is higher, and it
There is the activity of functional redundancy, i.e., the mutant being individually mutated does not show mutant character, only when shp1shp2 is mutated,
The silique of mutant does not just ftracture.FUL gene negative regulation SHP genes are expressed from area simultaneously, the FUL genetic transformation mustard of arabidopsis
Dish rape can strengthen silique cracking resistance angle property (et al.2006).Although rape and arabidopsis silique structure phase
Seemingly, but there is also obvious difference, siliqua of oilseed rape tire sits frame and protrudes fruit lobe and have longer fruit beak, and arabidopsis silique top flat
Sliding baldness.Based on the difference between them in structure, to deserved cracking resistance angle gene mechanism, whether homogeneity value is obtained further explores.
In recent years, developing rapidly with rape molecular biology, many QTL for controlling to split angle have been positioned, but correspondingly
The report that key gene and Functional marker under the QTL site of cracking resistance angle are not utilized also, analysis and the existing silique of research are opened
The natural hereditary variation of related gene is split, studying its mechanism and adjusting rape cracking resistance angle property by molecular biology method turns into oil
The important breakthrough mouthful of dish genetic improvement.
The content of the invention
In view of the above-mentioned problems, splitting angle related gene B nSHP1-A9-R2 the invention provides rape, its sequence is SEQ ID
Shown in NO.2.
It is another object of the present invention to provide the InDel sequences that rape splits angle related gene B nSHP1-A9-R2,
The sequence is shown in SEQ ID NO.3.
Split it is another object of the present invention to provide a kind of based on rape in the related gene B nSHP1-A9-R2 of angle
The molecular labeling primer of InDel sequences Designs, can be screened to the rape for possessing cracking resistance angle character using the primer, be beneficial to
The genetic improvement of rape, the primer is preferably
IF4：ACTTG GGACA TAGCC TAATG ATG
IR4：TCGTA CCACT TTGAT TTCAG ACA.
Angle related gene B nSHP1-A9-R2 is split it is also an object of the present invention to provide rape or rape splits angle phase
Application of the InDel sequences in cracking resistance angle transgene rape is prepared in correlation gene BnSHP1-A9.
Last purpose of the invention is the provision of the InDel split based on rape in the related gene B nSHP1-A9-R2 of angle
Application of the molecular labeling primer of sequences Design in the genetic breeding of rape.
In order to achieve the above object, the present invention takes following technical measures：
Rape splits angle related gene B nSHP1-A9 acquisition：
(1) using napus lines R1 and R2 hybridization, F-1 hybrids generate DH segregating populations by microspores culture.
(2) molecular marker analysis is carried out to DH segregating populations using polymorphism primer, obtains genotype data.
(3) genotype data of DH segregating populations is inputted Joinmap4.0 softwares, carries out the structure of genetic linkage mapses；
(4) genotype data (being only limitted to navigate to the mark on genetic map) and the cracking resistance angle property of 2 years of DH colonies
Shape data input WinQTLcart2.5 softwares carry out QTL positioning, wherein, two in A9 linkage groups are adjacent but effect phase
Anti- QTL can repeat to detect in 2 years in DH colonies, and effect value and contribution rate are stable.
Using abovementioned technology, the QTL site qSRI.A9.1 of rape cracking resistance angle index (SRI) character is finally obtained,
It is 11.67%, additive effect to obtain its average contribution rate to rape cracking resistance angle index using WinQTLCart2.5 software analysis
For -0.07~-0.15.Using the method for Standard PCR and inverse PCR, total length sequences of the BnSHP1-A9 in R1 and R2 is obtained respectively
BnSHP1-A9 in R1 is referred to as BnSHP1-A9-R1 by row, the present invention, and its sequence is shown in SEQ ID NO.1, by R2
BnSHP1-A9 is referred to as BnSHP1-A9-R2, and its sequence is shown in SEQ ID NO.2.For InDel marks in R2, (primer is
IF4/IR4 247bp) can be amplified in R1 respectively, 270bp band is amplified in R2.
A kind of molecular labeling primer for the InDel sequences Designs split based on rape in the related gene B nSHP1-A9-R2 of angle,
As long as being protection scope of the present invention based on the SEQ ID NO.3 primers designed, it is preferred that described primer is as follows：
IF4：ACTTG GGACA TAGCC TAATG ATG
IR4：TCGTA CCACT TTGAT TTCAG ACA.
Rape splits angle related gene B nSHP1-A9-R2 or rape splits InDel sequences in the related gene B nSHP1-A9-R2 of angle
It is listed in the application prepared in the transgene rape of cracking resistance angle, because the rape with BnSHP1-A9-R2 genes, BnSHP1-A9 genes
Expression quantity is relatively low, so as to improve the cracking resistance angle property of siliqua of oilseed rape.Therefore it can be pressed down by antisense gene or RNAi experiments
The expression of BnSHP1-A9 genes processed, can also reach that identical is acted on.
The molecular labeling primer of InDel sequences Designs in the related gene B nSHP1-A9-R2 of angle is split in rape based on rape
Genetic breeding in application, using described primer, unknown rape strain is screened, can accelerate rape cracking resistance angle strain
The screening progress of system, is conducive to rapeseed breeding to work.
The present invention passes through experimental study, it was found that an influence rape cracking resistance angle property, but does not influence other property of siliqua of oilseed rape
The QTL site of shape, further developed the gene specific InDel primer pairs for identifying the site.Using the InDel sites of the present invention
And primer pair can identify rape cracking resistance angle property in advance in rape early stage, and without being reflected after rape is ripe by field phenotype
Determine cracking resistance angle property.InDel sites of the present invention and primer pair accelerate rapeseed breeding process, have extensively in the selection and use field of rape
Wealthy application prospect.
Compared with prior art, the advantage of the invention is that：
The negative-effect QTL site of the invention for navigating to control cracking resistance angle on rape A09 first, soluble 11.26%~
12.07% phenotypic variance.The RNAi experiments of correspondence BnSHP1-A9-R1 genes also further demonstrate that the gene is negative-effect,
That is expression by inhibitation system, the enhancing of cracking resistance angle property.In conventional breeding methods, property identification in silique cracking resistance angle will be waited until after maturity period harvest
Indoor identification, wastes time and energy and efficiency of selection is low (cracking resistance angle property can be influenceed by the maturity period to a certain degree).It is further sharp
A pair of InDel marks (IF4/IR4) are developed with the difference on R1 and R2 genomes, pass through gene function mark detection silique cracking resistance
Angle different Q TL sites, can be eliminated in seedling stage, are not only saved production cost but also are greatly improved efficiency of selection.The present invention
The negative effect QTL point functional gene locality specifics in middle cracking resistance angle, detection method fast and easy is not affected by environment.By detecting cracking resistance
Angle character Functional marker, you can the cracking resistance angle property of prediction breeding material, and then accurate quick screening cracking resistance angle rape strain.
Brief description of the drawings
When the DH colonies that Fig. 1 is a kind of rape cracking resistance angle strain R1 and not anti-strain R2 is built plant in Wuhan, 2013-
2014 two years silique cracking resistance ascent (SRI) histogram.
As a result it is in inclined normal distribution, silique cracking resistance ascent phenotype in 2014 to show silique cracking resistance ascent phenotype in 2013
In normal distribution and range of variation is very wide, it was demonstrated that silique cracking resistance angle property is by quantitative character control.
Fig. 2 is a cracking resistance ascent QTL site LOD curve synoptic diagram in A9 linkage groups.
Abscissa represents linkage group in upper coordinate diagram, and ordinate represents LOD value.
Abscissa represents linkage group in lower coordinate diagram, and ordinate represents additive effect value.
Fig. 3 is R1, and R2 splits angle related gene B nSHP1-A09 gene structure differences.
Fig. 4 BnSHP1-A9Indel mark IF4-F/R testing results in DH colonies (a) and natural population (b).
Fig. 5 is a kind of rape R1 × R2_DH colonies A9 linkage groups local molecular mark genetic linkage mapses.
Fig. 6 is R1, the testing result of R2 different development stage BnSHP1-A09 expression quantity.
(a) 1 be bud (<0.3cm), 2 be bud (>0.3cm), 3-5 is respectively the flower just opened, and blooming flower and is withered
Flower, 6-8 is 1cm, 1.5cm and 2cm gynoecium, and (b) is respectively Rape pod development after 10 days, 16 days, 18 days, 20 days and 22 days
BnSHP1-A09 expression pattern.
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.Wherein R1,
R2 and DH colonies are in document " king's meeting, Sang Shifei, the genetic analysis of Brassica napus DHs colony's cracking resistance angle property such as Mei Desheng.China
Oil crops journal, 2014,36 (4):437-442 " is disclosed, and the public can obtain from oil crops research institute of the Chinese Academy of Agricultural Sciences
.
Embodiment 1：Rape splits angle related gene B nSHP1-A9 acquisition：
First, qSRI.A9.1 positioning and clone
(1) field experiment and cracking resistance angle index phenotype test：
Field test patrolled experiment centre (Wuhan) respectively at 2013 to 2014 autumns in oil plant institute of the Chinese Academy of Agricultural Sciences sun, into
The cracking resistance angle index (SRI) of strain or individual plant, authentication method referenced patent 201310226680.4 are examined in ripe end-of-term examination.Specially by oil
Dish silique dries 30min at 80 DEG C, after room temperature Seal and preservation is overnight, is put into 8 steel balls of placement in cylindrical chamber, cylindrical chamber；
Using model HQ45Z shaking tables, concussion processing is carried out to cylindrical chamber with 280rpm rotating speeds, observation in every two minutes once, is seen altogether
Examine 5 times, every part of material is repeated 3 times, and utilizes formula：Angle index=∑ Xi × (6-i)/silique number × total degree calculating is split to split angle and refer to
Number, Xi is the damaged silique number of ith, and 1≤i≤5, cracking resistance angle index=1- splits angle index.The cracking resistance angle exponential distribution of 2 years
See Fig. 1.
(2) genotype identification
R1 × R2DH colonies and parent, take blade to extract DNA in 5 leaf phase respectively, and mark each individual plant respectively, for
DH colonies strain, then carried out hybrid blade sampling by 3 individual plants with same gene type, be marked with cell id, in field
Between quick freeze preserve.Each sample DNA is diluted to 10ng/ μ l or so, and design object interval primer enters performing PCR amplification, with poly-
Acrylamide gel electrophoresis or agarose gel electrophoresis carry out genotype identification.Target genome area source of sequence information in
Darmor-bzh sequencing data of whole genome, the SSR sites in target gene group sequence are scanned with SSRHunter, are recycled
Primer5.0 (www.Premier5BioSoft.com) designs primer, polymorphism mark is developed, for target genome area
The screening of favourable restructuring individual plant.
(3) QTL positioning analysises
Utilize Windows QTL Cartographer (http://statgen.ncsu.edu/qtlcart/
WQTLCart.htm compound interval QTL mapping positioning analysises (1000 permutation, P=) are carried out to colony of DH colonies
0.05 level).Preliminary positioning analysis (Fig. 2) is carried out to qSRI-A9.1.Molecular markers development is carried out to qSRI-A9.1, is used to
Molecular mark.
Experiment conclusion：An influence rape cracking resistance angle property QTL, wherein negative effect QTL site are navigated to using DH colonies
QSRI.A9.1 (cracking resistance angle property gene source is in R2), the QTL at influence cracking resistance angle LOD value is 4.76-4.91, can be explained
11.26-12.07% phenotypic variation (table 1).
Table 1：The cracking resistance angle property QTL positioning in 2 years of R1 × R2DH colonies
2nd, sequence analysis
According to finely positioning result, using bioinformatics means, BnSHP1-A9 gene orders are finally obtained,
BnSHP1-A9 genes are made up of 7 extrons and 6 intrones, wherein, the 2-6 extron length is shorter, aobvious outside the 1st
Sub longer, length is more than 800bp (Fig. 3).The amplimer of covering whole gene is designed using primer5.0, to parent R2 and
Two BnSHP1-A9 amplified alleles in R1 simultaneously carry out sequence alignment analysis, as a result show：In genomic level, R1
And there is many difference in R2, include insertion, missing and some SNP sites of different length；In mRNA level in-site, compared with R2,
There are a 12bp missing (the 7th extron) and 9 SNP sites being distributed on whole mRNA in R1.
In the present invention, the BnSHP1-A9 genes in R2 are referred to as BnSHP1-A9-R2, its sequence is SEQ ID NO.2
It is shown；Genes of the BnSHP1-A9 in R1 is referred to as BnSHP1-A9-R1, its sequence is shown in SEQ ID NO.1.
Table 2：BnSHP1-A9 total lengths are expanded and RT-PCR primer
Embodiment 2：R1 and R2 Rape pod development tissue corresponding site sampling to different development stage carries out BnSHP1-A9 tables
Up to variance analysis.
First with different buds to blooming, until formation Rape pod development different times, the initial stage bloomed using rape as standard,
Pod formation was sampled after 10 days every 2 days after pollination, according to Rape pod development period, and each period each material parallel chooses silique
Consistent 5 plants of size is developed to repeat as 5 biology, ensure as far as possible the silique cut contain same ratio from district's groups
Knit.Total serum IgE is extracted using RNAprep pure Plant Kit (TIANGEN), Hiscript is then used@II 1st strand
RNA reverse transcriptions into the first chain cDNA, are used 2 × Es Taq MasterMix (CWBIO), BIO- by cDNA synthesis kit
RAD S1000TMThermal Cycler instrument carries out RT-PCR reactions.RT-PCR primer BnSHP1.A9-orf is designed at gene volume
Code frame both sides, amplification length is 906-908bp, using Actin as internal standard, gene-specific primer sequence and interior label primer sequence
Row are referring to table 2.
Result as shown in Figure 6：R1 is identical in flower bud phase BnSHP1-A09 expression quantity with R2, does not all almost express.But R2 is in flower
Phase expression quantity is substantially more much lower than R1.10 days and 16 days developed in Pod formation, express, angle not notable in two storeroom differences
R1 and R2 the expression difference in magnitude in 18,20 and 22 days three periods of fruit development later stage are different and notable, and P values are respectively 0.669,
The expression difference of 0.290 and 0.337, i.e. two materials Pod formation gene after 18 days after flower development significantly, in R1 with
The development of the silique gene expression amount slowly to reduce, but to after 18 days in R2, the gene stops expression, therefore cracking resistance angle substantially
Property difference mainly by target gene expression quantity change cause.
Embodiment 3：Rape BnSHP1-A9-R1 suppresses the structure of expression vector and the conversion in rape
According to the BnSHP1-A9 coding region sequences of R1 materials, design primer amplification partial coding region fragment (143bp) primer
Sequence is：TTCTTTTCGGTGGTTTATTC and TGACGATTTGTTGTGTTCTCT.It is reversely connected on topo carriers simultaneously
Recombinate in pEarleyGate100.Carrier is transformed into LBA4404 and prepares conversion rape.
The Agrobacterium LBA4404 conversion of rape
A. the preparation of aseptic seedling：Seed washes 5 through 70% ethanol 1min, mercury chloride (HgCl2) immersion 13-15min, ddH2O
After secondary, it is laid in MS culture mediums (PH 5.8), agar concentration 0.8%.Rape aseptic seedling is standby.
B. coleseed petiole is converted：Agrobacterium tumefaciens lba4404 is inoculated with solid medium LB, two days later picking single bacterium
Fall within culture in 50ml YEP fluid nutrient mediums (tryptone 10g+ yeast extract 10g+NaCl5g+MgSO4 0.5g).Take
4-5 days aseptic seedling cotyledon petioles, soak 5-8min, therebetween jog in bacterium solution, then go bacterium solution, explant is sucked with aseptic filter paper
Bacterium solution is remained on body.It is placed in co-cultivation base (MS+0.2mg/L 6-benzyladenines (6-BA)+1mg/L 2,4- Dichlorophenoxy second
Acid (2,4-D)+200um acetosyringones (AS), PH5.8), upper culture 2-3 days.
C. the explant after co-cultivation is transferred in the differential medium that Kan is free of containing only penicillin (Car), dark condition
Greenhouse in carry out de- bacterium and differentiation culture 5-7 days.Selective agar medium (the MS+3mg/L6-B pressed followed by generation in addition Kan screenings
A+0.1mg/L α-naphthylacetic acids (NAA)+5mg/L silver nitrates (AgNO3)+400mg/L Car+15mg/L K an；PH5.8 in), enter
Row screening, regenerated green bud to be differentiated.
D. bud length to be regenerated to 1cm when cut budlet and move to root media (MS+0.2mg/L NAA+10mg/L Kan+
400mg/L Car；PH5.8 on), screened with Car and Kan solidified MS media is added.
E. after seedling rooting, it is transplanted into outdoor.Lower native alms bowl is transplanted after 10 days.
The identification of transformed plant
(1) it is used for the extraction of PCR transformed plant STb gene
A.70% ethanol cleans blade, weighs about 100mg
B. 600ul extraction buffers (0.2M Tris-Cl, 0.25 NaCl, 25mM EDTA, 0.5%SDS, pH are added
7.5), room temperature is quickly ground.
C.1.5ml Ependorff pipes mesoscale eddies mixes 5-10s.
D.12000rpm, 25min, room temperature.Take supernatant, plus isometric isopropanol, -20 degrees Celsius of precipitates overnights.
E.12000rpm, 15min, room temperature.Add 70% ethanol 200ul foam washings DNA precipitations.
F.12000rpm, 15min, room temperature.Remove ethanol.It is inverted on paper handkerchief, treats that ethanol volatilization is clean.
Plus sterilized water 100ul dissolvings are thick puies forward DNA precipitations G..Estimate its concentration with spectrophotometric determination or electrophoresis.
H. using STb gene as template, performing PCR is entered.
(2) PCR programs
The cumulative volume of PCR reaction systems is 20 μ l, genomic DNA template 1ul (about 50ng), 1 × Taq enzyme reaction buffering
Liquid, 25mM MgCL2 1.2ul, each 0.2ul of 2mM dNTP 1.5ul, 10uM primers, 50% glycerine 2ul, 0.3 unit rTaq enzymes
(Takara companies), plus ddH2O to 20 μ l.The P CR across introne are designed and synthesized according to target gene in plant expression vector
Primer.(forward primer：TTCTTTTCGGTGGTTTATTC and reverse primer TGACGATTTGTTGTGTT CTCT, reaction when
Between and temperature make it is as follows：94 DEG C of 3min, 94 DEG C of 45s, 59 DEG C of 45s, 72 DEG C of 2min 30s, 30 cycles, 72 DEG C of 5min.
Testing result shows that positive control and most of transformed plants can amplify the electrophoretic band of expected size,
And negative control does not have then, show to contain foreign gene DNA fragmentation in transgene rape genome.
Phenotypic analysis is carried out for transgenic line to T1
Harvested after rape BnSHP1-A9 transgenic lines and control full maturity, rape takes main inflorescence silique and fully dried
Identification cracking resistance angle index after dry.Final result is shown, compared with non-transgenic strain, and partial transgenic strain cracking resistance angle property increases
Plus, maximum amplification is more than 15%.
Therefore BnSHP1-A9-R1 is that InDel sequences in negativity controlling gene, R2 cause BnSHP1-A9-R2 bases
Because possessing cracking resistance angle property.
Embodiment 4：
The molecular labeling primer of InDel sequences Designs in the related gene B nSHP1-A9-R2 of angle is split in rape based on rape
Genetic breeding in application：
The molecular labeling primer designed based on InDel sequences (shown in SEQ ID NO.3) is as follows：
IF4：ACTTG GGACA TAGCC TAATG ATG
IR4：TCGTA CCACT TTGAT TTCAG ACA.
Gene InDel Molecular mappings are in the cracking resistance angle range (Fig. 5)
(1) F3 that the selfing of R1 × R2 F2 individual plant baggings is obtained is selected in field planting for seed.
(2) to the listed sampling of F3 individual plants before final singling, and blade STb gene is extracted, it is entered using molecular labeling IF4/IR4
The judgement of row qSRI.A9.1 genotype, only retains banding pattern and R2 identical individual plants, remaining banding pattern list identical and heterozygosis with R1
Strain is all pulled out and (because IF4/IR4 is codominant marker, retains banding pattern and pull out the individual plant that banding pattern is R1 and H with R2).
Banding pattern obtains the individual plant of the bands of 270bp mono- with R2 identicals for only amplification.
(3) F3 individual plants are harvested in the maturity period, and the identification of cracking resistance angle is carried out to it.As a result show, molecular labeling IF4/IR4 bases
Because of type and R2 identical individual plants, the ratio that its cracking resistance angle property exceedes R2 is up to 93.4%.It can be seen that being eliminated in seedling stage, not only save
About production cost and greatly improving efficiency of selection, and then can quickly filter out cracking resistance angle property rape strain is used to improve rape
Genetic improvement.
Embodiment 5：
The InDel sequences that rape is split in the related gene B nSHP1-A9-R2 of angle are general in genetic breeding as molecular labeling
Adaptive：
First, experiment material is as follows：
(1) oil 821 in, in double No. 4, in double No. 9, Zhejiang oil 50, Skipton, Anhui oil 12, OC3237；Shanghai oil 21, China
Double No. 5, P10, Trigold, AV-SAP, GSL2, Zhejiang are double No. 6, Westar, peaceful oil 7, Matador, Nilla, Cibrabra,
Apomix。
(2) two parent materials used are positioned at the beginning of：R1 and R2 and its DH colonies.
2nd, genotype detection primer：
Primer I F4 and IR4.
3rd, genotype detection method
The amplification system and detection program of InDel marks
Respectively in 5 leaves, leaf DNA is extracted, the working solution for being diluted to 10ng/ μ l concentration enters performing PCR amplification.InDel
(IF4-F/R) is marked to be based on allele PCR amplification principle exploitations.Specific practice is：It is special according to the design of known InDel sites
Forward primer (IF4-F:ACTTGGGACATAGCCTAATGATG), reverse primer (IF4-R:
TCGTACCACTTTGATTTCAGACA), 3% Ago-Gel, voltage 5V/cm electrophoresis detection PCR primers.
PCR amplification system is：2×Taq Mix 5ul,Forward Primer(10uM/ul)1μl,Reverse
primer(10uM/ul)1μl,gDNA 1μl,ddH2O 2μl,Total 10μl。
PCR reaction conditions：94 DEG C, 3min；94 DEG C, 30s；58 DEG C, 30s, 72 DEG C, 45s；35 circulations；72 DEG C, 10min；
4 DEG C, till use.
It is 270bp that amplification, which obtains BnSHP1-A9-R2 clip sizes, respectively, and BnSHP1-A9-R1 sizes are 237bp, are used
Agarose electrophoresis detection can distinguish band difference, show InDel results.
Can with it is seen from figure 4 that, middle oily 821, in double No. 4, in double No. 9, Zhejiang oil 50, Skipton, Anhui oil 12,
OC3237 is the 7 parts of self-mating systems marked with R1Indel；Shanghai oil 21, China is double No. 5, P10, Trigold, AV-SAP, GSL2, Zhejiang
Double No. 6, Westar, peaceful oil 7, Matador, Nilla, Cibrabra, Apomix be then mark with R2Indel 13 parts from
Hand over system：Therefore the molecular labeling that the present invention is provided has universality in existing napus lines, it is adaptable to which cracking resistance angle rape is sieved
Choosing.
SEQUENCE LISTING
<110>Inst. of Oil Crops, Chinese Academy of Agriculture
<120>Rape splits angle related gene and molecular labeling and application
<130>Rape splits angle related gene and molecular labeling and application
<160> 5
<170> PatentIn version 3.1
<210> 1
<211> 2737
<212> DNA
<213>Cabbage type rape
<400> 1
atggatgaag gtgggagtag tcactatgca gagagtagca agaagatagg tagagggaag 60
atagagataa agaggataga gaacacaaca aatcgtcaag taaccttctg caaacgacgc 120
aatggtcttc tcaagaaagc ttatgagctc tctgtcttgt gtgatgcgga agttgccctc 180
gttatctttt ccactcgtgg ccgtctttat gagtacgcca gcaacaggta tgcttctcct 240
acctacacct tgatctagct ttcttgatta atttactact acaatcctag ttaaaatgag 300
ccaagattag ggttttgttt agattacaat ccttgatttt ctatttttat ataaaaatta 360
gatctcaata gagctaccat tgtctctcta gatctgtgta tatccaaata atgaagacgg 420
gagaaagctg tcttgtcttc tcaacttctc gttagtctga tcttagttag tttcactctt 480
tttctgcaga tcattagaac ctgtttcatg tcatgtcagc ttctataaaa tacttttatc 540
tcgacgaccc atactatgtc tttctttaaa tattattagg gtttcgtcag taaaaaaaaa 600
ctgggtactt cttgacacgc aatagcatgc atatatgtaa atatgcaaga catatgtaac 660
cctcctgtct tgtgaaactt gggacataac ctaatgatgg ttgtcactat ggatcccttt 720
aatttttttc ctaacccaag aaaacaaatg cccaccgata aaactttagt tatatattat 780
atctatctat ctggagttcg tatgttgaga atatatatat gtgactattt aaaaatctag 840
gcccttaaaa tatgtgtatc cattaatata ttaatgagag ggagataact cagagagaag 900
tgtctgaaat caaagtggta cgagccaatg ggaatctata gcactctgag ctccatttat 960
atgtgctgtt gtatttgaaa aaaaaacagt taatcatcct taaagcatac tttgatgaca 1020
ttaaaccata taatatgcat ggaccttgtt ctgtattcct cctcaaaccg taagtaatta 1080
ccagtttgaa tccatatatt aattaattgc tgcatcagcc atttttaaat atgtacattg 1140
aaaaagtaat ttactcgagc acaatgtgtg tcattgaagt ttctcctcgt actggtcaaa 1200
aaactggtcc aaacctcaaa gccatcacat tcctttcttg tcgattttaa ggttttgccc 1260
ccaaaataaa cattccaaaa ccttaatcaa gaaatgtcgt cccaattatc tctgttttaa 1320
gagtatatta attaaattaa atataatggt ttctttaact ttctagtgtg aagggtacaa 1380
ttgaaaggta caagaaagct tgttccgatg ccgttaaccc tcctactgtc actgaagcta 1440
ataccaaggt accattcttg tatagttttt tttttttact agccctctct tttttcttat 1500
ttttatgatc aattattaac gtttagaaag tgaaatcttt ttaaaatgtg tatatatata 1560
tgtggtttct tgtttctatg atgatcaatt atgtattcgt gtcaaaagaa cgttactaac 1620
aaaattctta acatttacac ccaaaagtaa aaacattatt aacaaaaaga gtggattcct 1680
gaaatgcatt gagacggttg tatttgtatg catggaaccc ttcagtacta tcagcaagaa 1740
gcctctaagc ttcggaggca gattcgggac attcagaatt cgaacaggta agtaactata 1800
gctcttcatg aggtttcttg ttttgatcac tactttccta ttatatagct gatcttttcg 1860
attagtttaa ctgaaaaaat tacagaacct gagtcaagta agttataatt cattcaaaat 1920
cgttcattcc aaataatttt ttttcttttt tggtaggatt gttaggttgg ttaacttact 1980
tggaattgct tgaatctctg cttggtttgg tgatatatgg tatatggaac cataaataaa 2040
aacttgggtt taattttcgt gtttttttgc caaatagttt acttttagtt acgtttgaac 2100
gagtgcaaat gtttattaat gttcatgttt atgaatcgaa ggcatattgt tggggaatca 2160
cttggttcct tgaacttcaa ggaactcaaa aacctagaag gacggcttga aaaaggaatc 2220
agccgcgtcc gatccaagaa ggtacgtact gataaaccta tacgtctatg tctctctata 2280
gtttatatat agtttcatcg ctcttatatg aatcttttcc agagtgaact tttagtggca 2340
gagatagagt atatgcagaa gagggtaagt aacgtttctt cccaatcttt catcgttctt 2400
ttacatgggt tttgagtttt gccataaacc atgtaggaaa tggagttgca gcacgataac 2460
atgtacctaa gagctaaggt tagtcacgtc ttcatcctct aaccgagata atgaacgtgt 2520
atcacaacca aactttgatg ttcggtttgt gcagatagaa caaggcgcga gattgaatcc 2580
ggaacagcat ggatccggtg taatacaagg gacggcggtt tatgagtccg gtctgtcttc 2640
ttctcatgat cagtcgcagc attatattcc ggttaacctt cttgaaccga atcaacaatt 2700
ctccggtcaa gaccaacctc ctcttcaact tgtttaa 2737
<210> 2
<211> 2757
<212> DNA
<213>Cabbage type rape
<400> 2
atggatgaag gtgggagtag tcacgatgca gagagtagca agaagatagg tagagggaag 60
atagagataa agaggataga gaacacaaca aatcgtcaag taaccttctg caaacgacgc 120
aatggtcttc tcaagaaagc ttatgagctc tctgtcttgt gtgatgctga agttgccctc 180
gttatcttct ccactcgtgg ccttctttat gagtacgcca gcaacaggta tgcttctcct 240
acccacacct tgatctagct ttcttgatta atttactact acaatcctag ttaatatgag 300
ccaagattag ggttttgttt aaattacaat cctgaatttt ctatttttta tataaaaatt 360
agatctcaat agggctacca ttgtctctct agatctgtgt atatccaaat aatgaagacg 420
gaagaaatct gtcttgtctt ctcaacttct cgttagtctg atctttgtta gtttcactct 480
ttttctgcag atcactagaa cctgtttcat gtcatgtcag cttctataaa atgcttttat 540
cttgacgacc catactatgt ctttctttaa atattattag ggtttcgtca gtaaaaaaaa 600
actgggtagt acgcaatagc atgcatatat gtaaatatgc aagacttatg taaccctcct 660
gtcttgtgaa acttgggaca tagcctaatg atggttgtca ctatgacact atggatcccc 720
tttaattttt ttcctaaccc aagaaaacaa atgccgaccg ataaaacttt agttatatat 780
aaaatatata acatctatct ggagttcgta tgttgagaat atatatatgt gactatttaa 840
aatctaggcc ctttaaggat gtaaaatatg tgtattccat taatatatta atgagaggga 900
gataactcag agagaagtgt ctgaaatcaa agtggtacga gccaatggga atctatagca 960
ctctgagctc catttatatg tgctgttgta tttgaaaaaa aacagttaat catccttaaa 1020
gcatactttg atgacattaa accatataat atgcatggac cttgttctgt attcctcctc 1080
aaaccgtaag taattaccag tttgaatcca tatattaatt aattgctgca tcagccattt 1140
ttaaatatgt acattgaaaa agtagtttac tcgagcacaa tgtgtgtcat tgaagtttct 1200
cctcgtagtg gtcaaaaaac tggtccaaac ctcaaagcca tcacattcct tgtcgatttt 1260
aaggttttgc ccccaaaata aacattccaa aaccttaatc aagaaatgtc gtcccaatta 1320
tctctgtttt aagagtatat taattaaatt aaatataatg gtttctttaa ctttctagtg 1380
tgaagggtac aattgaaagg tacaagaaag cttgttccga tgccgttaac cctcctactg 1440
tcactgaagc taataccaag gtaccattct tgtatagttt tttttttact agccctctct 1500
tttttcttat ttttatgatc aattattaac gtttagaaag tgaaatcttt ttaaaatgtg 1560
tatatatatg tggtttcttg tttctatgat gatcaattat gtattcgtgt caaaagaaca 1620
ttactaacaa aattcttaac atttacaccc aaaagtaaaa acattattaa caaaaagagt 1680
ggattcctga aatgcattga gacggttgta tttgtatgca tggaaccctt cagcactatc 1740
agcaagaagc ctctaagctt cggaggcaga ttcgggacat tcagaattcg aacaggtaag 1800
taactatagc tcttcatgag gtttcttgtt ttgatcacta ctttcctatt atatagctga 1860
tcatttcgat tagtttaact gaaaaaatta cagaacctga gtcacgtaag ttataattca 1920
ttcaaaatcg ttcattccaa ataatttttt ttcttttttg gtaggattgt taggttggtt 1980
aacttacttg gaattgcttg aatctctgct tggttttgtg atatatggta tatggaacca 2040
taaataaaaa cttgggttta attttcgtgt ttttttgcca aatagtttac ttttagttac 2100
gtttgaacga gtgcaaatgt ttattaatgt tcatgtttat gaattgaagg catattgttg 2160
gagaatcact tggttcattg aacttcaagg aactcaaaaa cctagaagga cggcttgaaa 2220
aaggaatcag ccgcgtccga tccaagaagg tacgtactga taaacctata cgtctatgtc 2280
tctctatagt ttatatatag tttcctcgct cttatatgaa tcttttccag agtgaacttt 2340
tagtggcaga gatagagtat atgcagaaga gggtaagtaa cgtttcttcc caatctttca 2400
tcgttctttt acatgggttt tgagttttgc cataaaccat gtaggaaatg gagttgcagc 2460
acgttaacat gtacctaaga gctaaggtta gtcacgtctt catcctctaa ccgagataat 2520
gaacgtgtat cacaaccaaa ctttgatgtt cggtttgtgc agatagaaca aggcgcgaga 2580
ttgaatccgg aacaacatgg atccggtgta atacaaggga cggcggttta tgagtccggt 2640
ctgtcttctt ctcatgatca gtcgcagcat tataaccgga attatattcc ggttaacctt 2700
cttgaaccga atcaacaatt ctccggtcaa gaccaacctc ctcttcaact tgtttaa 2757
<210> 3
<211> 270
<212> DNA
<213>Artificial sequence
<400> 3
acttgggaca tagcctaatg atggttgtca ctatgacact atggatcccc tttaattttt 60
ttcctaaccc aagaaaacaa atgccgaccg ataaaacttt agttatatat aaaatatata 120
acatctatct ggagttcgta tgttgagaat atatatatgt gactatttaa aatctaggcc 180
ctttaaggat gtaaaatatg tgtattccat taatatatta atgagaggga gataactcag 240
agagaagtgt ctgaaatcaa agtggtacga 270
<210> 4
<211> 23
<212> DNA
<213>Artificial sequence
<400> 4
acttgggaca tagcctaatg atg 23
<210> 5
<211> 23
<212> DNA
<213>Artificial sequence
<400> 5
tcgtaccact ttgatttcag aca 23
Claims (8)
1. rape splits angle related gene, the nucleotides sequence of the gene is classified as shown in SEQ ID NO.2.
2. application of the gene described in claim 1 in cracking resistance angle rape is prepared.
3. the allele of gene described in claim 1, the nucleotides sequence of the gene is classified as shown in SEQ ID NO.1.
4. application of the gene described in claim 3 in cracking resistance angle rape is prepared.
5. rape splits angle related gene Indel sequences, its sequence is shown in SEQ ID NO.3.
6. the primer of sequences Design according to claim 5.
7. primer according to claim 6：
IF4：ACTTG GGACA TAGCC TAATG ATG
IR4：TCGTA CCACT TTGAT TTCAG ACA.
8. application of the primer in the genetic breeding of rape described in claim 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610257664.5A CN107304425B (en) | 2016-04-23 | 2016-04-23 | Rape pod shattering related gene, molecular marker and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610257664.5A CN107304425B (en) | 2016-04-23 | 2016-04-23 | Rape pod shattering related gene, molecular marker and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107304425A true CN107304425A (en) | 2017-10-31 |
| CN107304425B CN107304425B (en) | 2020-06-19 |
Family
ID=60150729
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610257664.5A Active CN107304425B (en) | 2016-04-23 | 2016-04-23 | Rape pod shattering related gene, molecular marker and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107304425B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109234288A (en) * | 2018-11-19 | 2019-01-18 | 中国农业科学院油料作物研究所 | Rape BnA9-2 gene is improving the application in siliqua of oilseed rape crack resistance |
| CN110760525A (en) * | 2019-10-25 | 2020-02-07 | 中国农业科学院油料作物研究所 | Nucleotide sequence related to pod shattering resistance of rape and application thereof |
| CN111819285A (en) * | 2018-01-09 | 2020-10-23 | 希博斯美国有限公司 | Breakage-proof genes and mutations |
| CN117385093A (en) * | 2023-11-29 | 2024-01-12 | 湖南农业大学 | SNP molecular marker closely linked with brassica napus anti-cracking gene BnMAN7A07 and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102206635A (en) * | 2011-05-17 | 2011-10-05 | 中国农业科学院油料作物研究所 | Structure and major gene locus Psr9 of pod shattering resistance character of rape and application thereof |
| CN102342245A (en) * | 2010-08-06 | 2012-02-08 | 河南省农业科学院经济作物研究所 | Breeding method for pod dehiscence-resistant cytoplasmic sterile line and pod dehiscence-resistant cytoplasmic maintainer line of brassica napus |
-
2016
- 2016-04-23 CN CN201610257664.5A patent/CN107304425B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102342245A (en) * | 2010-08-06 | 2012-02-08 | 河南省农业科学院经济作物研究所 | Breeding method for pod dehiscence-resistant cytoplasmic sterile line and pod dehiscence-resistant cytoplasmic maintainer line of brassica napus |
| CN102206635A (en) * | 2011-05-17 | 2011-10-05 | 中国农业科学院油料作物研究所 | Structure and major gene locus Psr9 of pod shattering resistance character of rape and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| HARSH RAMAN: "Genome-wide delineation of natural variation for pod shatter resistance in brassica napus"", 《PLOS ONE》 * |
| 崔嘉成: "甘蓝型油菜裂角相关形状的遗传与相关分析", 《作物学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111819285A (en) * | 2018-01-09 | 2020-10-23 | 希博斯美国有限公司 | Breakage-proof genes and mutations |
| CN109234288A (en) * | 2018-11-19 | 2019-01-18 | 中国农业科学院油料作物研究所 | Rape BnA9-2 gene is improving the application in siliqua of oilseed rape crack resistance |
| CN109234288B (en) * | 2018-11-19 | 2021-03-16 | 中国农业科学院油料作物研究所 | Application of rape BnA9-2 gene in improving pod shatter resistance of rape |
| CN110760525A (en) * | 2019-10-25 | 2020-02-07 | 中国农业科学院油料作物研究所 | Nucleotide sequence related to pod shattering resistance of rape and application thereof |
| CN117385093A (en) * | 2023-11-29 | 2024-01-12 | 湖南农业大学 | SNP molecular marker closely linked with brassica napus anti-cracking gene BnMAN7A07 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107304425B (en) | 2020-06-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101736018B (en) | Aroma gene in rice and functional marker thereof | |
| CN107304425A (en) | Rape splits angle related gene and molecular labeling and application | |
| CN110903368B (en) | Gene for controlling female character of corn, kit for creating female sterile line of corn, mutant genotype and method | |
| CN111518941B (en) | Nucleic acid sequence for detecting corn plant AN1 and detection method thereof | |
| CN110331145A (en) | The application of miR156 and its relevant biological material in regulation disease resistance of plant | |
| CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
| CN101857633B (en) | Leaf-shaped control gene SRNL1 of rice and application thereof | |
| CN116064566A (en) | Poplar bark rot-resistant bacterium gene PtoCXE06 and application thereof | |
| CN103443292A (en) | QTLs associated with and methods for identifying whole plant field resistance to sclerotinia | |
| CN108003227A (en) | GAP-associated protein GAP and its encoding gene during a kind of rice early blossoming | |
| CN101849023A (en) | Give the main QTLS of corn Fijivirus resistance | |
| CN113046467B (en) | SNP locus obviously associated with wheat stripe rust resistance and application thereof in genetic breeding | |
| CN116286851A (en) | Corn recessive genic male sterile ms13-6060 mutant sequence and molecular identification method and application thereof | |
| CN110951751B (en) | Epidermal hair specific accumulation anthocyanin regulatory gene, cloning method and application | |
| CN101883572A (en) | Sorghum aluminum tolerance gene, sbmate | |
| CN114032323A (en) | Co-dominant SSR marker closely linked with black shank resistance gene of cigar and application thereof | |
| CN108165555B (en) | Eggplant cultivation SmHQT gene core fragment, RNAi expression vector and application thereof | |
| CN107641152B (en) | Rice mTERF transcription termination factor geneV14And uses thereof | |
| CN116121435B (en) | Method for regulating and controlling length of wheat root hair, molecular marker and application thereof | |
| CN113005214B (en) | Molecular marker for screening new drought-resistant Chinese white poplar variety, and combination, method and application thereof | |
| CN115725603B (en) | Anthurium stress-resistance related transcription factor and application thereof | |
| CN107988216B (en) | Rice genome recombinant nucleic acid fragment RecCR012620 and detection method thereof | |
| CN106480060B (en) | Recombinant nucleic acid fragment RecCR01BC06 and detection method thereof | |
| CN118185956A (en) | OsUGE3 gene mutant and application thereof in cultivation of dual-purpose sterile line of rice | |
| CN114032324A (en) | SSR marker linked with tobacco black shank No. 1 physiological race resistance gene qBS1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |