CN107304425B - Rape pod shattering related gene, molecular marker and application - Google Patents

Abstract

The invention provides a rape pod shattering related gene, a molecular marker and application, wherein an applicant positions a QTL site for controlling a negative effect of an anti-shattering angle on rape A09 for the first time, can explain 11.26-12.07% of phenotype variance, further develops a pair of InDel markers (IF4/IR4) by utilizing the difference between R1 genomes and R2 genomes, detects different QTL sites of the pod anti-shattering angle through a gene function marker, can eliminate the rape pod shattering angle in a seedling stage, saves production cost and greatly improves selection efficiency. The position of the functional gene of the anti-crack angle negative QTL point is clear, and the detection method is convenient and quick and is not influenced by the environment. The anti-dehiscence performance of the breeding material can be predicted by detecting the anti-dehiscence functional molecular marker, and then the anti-dehiscence rape strain can be accurately and rapidly screened.

Description

Rape pod shattering related gene, molecular marker and application

Technical Field

The invention relates to the field of genetic engineering, in particular to a rape pod shattering related gene and a molecular marker and application thereof in crop genetic breeding and physiology.

Background

The rape is an important oil crop in China, the mechanical grain-dropping problem of the rape at the present stage seriously limits the improvement of the mechanized production level of the rape, and the improvement of the pod shattering resistance of rape cultivars is one of the important breeding targets at the present stage. By means of quantitative genetics and molecular biology, the method not only provides theoretical basis for the research of the molecular mechanism of the rape anti-crack angle, but also lays a solid foundation for the molecular marker-assisted selection and cultivation of anti-crack angle varieties through the positioning and cloning of the anti-crack angle related genes. The anti-dehiscence gene which can be utilized in rape at present mainly comes from genetically improved materials obtained through transgenosis, and related materials are difficult to be really applied to production due to the restriction of a plurality of regulations in the process of variety approval and popularization.

Brassica napus and Arabidopsis thaliana belong to the same cruciferae, have the same evolutionary origin, and the gene research for controlling the development and the dehiscence of the pod of Arabidopsis thaliana is very deep. The genes controlling dehiscence of siliques in Arabidopsis are mainly FRUITFULL (FUL) (Gu et al 1998), SHATTERPROOF1(SHP1), SHATTERPROOF2(SHP2) (Liljegren et al 2000), INDEHISCENT(IND) (Liljegren et al 2004), ALCATRAZ (ALC) (Rajani et al 2001), REPLUMLESS (RPL) (Roeder et al 2003). And there are complex network regulatory mechanisms among the genes (Dinneny and Yannofsky 2005). FUL gene was the first to identify the gene related to the elongation of the abscissas, FUL gene as a transcription factor can promote the differentiation and elongation of the horny fruit pericytes, and Liljegren et al (2000) prove that SHP1 and SHP2 can control the differentiation of the abscissas and promote the lignification of the adjacent cells, but the two types of genes have high homology, and the mutants have the activity of functional redundancy, namely, the mutants which are mutated individually do not show the mutation character, and the horny fruit of the mutants does not crack only when both SHP1SHP2 are mutated. Meanwhile, the FUL gene negatively regulates the expression of SHP gene in an abscission region, and the FUL gene of arabidopsis thaliana can enhance the pod shatter resistance of brassica juncea when used for transforming brassica juncea (the)

et al.2006). Although the rape and Arabidopsis thaliana siliques are similar in structure, the rape and Arabidopsis thaliana siliques are also obviously different in that the rape silique embryo frame protrudes from a fruit flap and has a longer fruit beak, and the tip of the Arabidopsis thaliana silique is smooth and bald. Based on the structural difference between them, it is worth further exploring whether the mechanism of anti-keratosis gene is consistent.

In recent years, with the rapid development of rape molecular biology, a plurality of QTL controlling dehiscence angles are located, but no report is available for utilizing key genes and functional molecular markers under the corresponding dehiscence angle QTL sites, the natural genetic variation of existing silique dehiscence related genes is analyzed and researched, and the mechanism of the natural genetic variation is researched, and the adjustment of the dehiscence angle resistance of the rape by molecular biology is an important breakthrough for the genetic improvement of the rape.

Disclosure of Invention

Aiming at the problems, the invention provides a rape pod shattering related gene BnSHP1-A9-R2, the sequence of which is shown in SEQ ID NO. 2.

The invention also aims to provide an InDel sequence of the rape pod shattering related gene BnSHP1-A9-R2, which is shown in SEQ ID NO. 3.

Another objective of the invention is to provide a molecular marker primer designed based on the InDel sequence in the rape pod shatter related gene BnSHP1-A9-R2, the primer can be used for screening rape with pod shatter resistance and is beneficial to the genetic improvement of rape, and the primer is preferably

IF4：ACTTG GGACA TAGCC TAATG ATG

IR4：TCGTA CCACT TTGAT TTCAG ACA。

The invention also aims to provide the application of the InDel sequence in the rape pod shattering related gene BnSHP1-A9-R2 or rape pod shattering related gene BnSHP1-A9in preparing transgenic rape with pod shattering resistance.

The last aim of the invention is to provide the application of the molecular marker primer designed on the basis of the InDel sequence in the rape pod shattering related gene BnSHP1-A9-R2 in the genetic breeding of rape.

In order to achieve the purpose, the invention adopts the following technical measures:

obtaining rape pod shattering related gene BnSHP 1-A9:

(1) using the crosses of rape lines R1 and R2, the hybrid F1 generation produced DH isolate population by microspore culture.

(2) And (3) carrying out molecular marker analysis on the DH separation population by using the polymorphic primers to obtain genotype data.

(3) Inputting the genotype data of the DH separation population into Joinmap4.0 software to construct a genetic linkage map;

(4) genotype data (only markers located on genetic maps) of the DH population and two-year fracture resistance data were input into WinQTLctart 2.5 software for QTL mapping, wherein two adjacent but opposite-effect QTLs located on the A9 linkage group were repeatedly detected in the DH population for two years, and the effect values and contribution rates were stable.

By utilizing the technical measures, a QTL locus qSRI.A9.1 of the rape corner resistance index (SRI) character is finally obtained, the average contribution rate of the QTL locus qSRI.A9.1 to the rape corner resistance index is 11.67 percent by utilizing WinQTLCart2.5 software analysis, and the additive effect is-0.07 to-0.15 percent. The full-length sequences of BnSHP1-A9in R1 and R2 are respectively obtained by utilizing a conventional PCR method and an inverse PCR method, the BnSHP1-A9in R1 is named as BnSHP1-A9-R1, the sequence of the BnSHP1-A9in R1 is shown as SEQ ID NO.1, and the sequence of the BnSHP1-A9in R2 is named as BnSHP1-A9-R2, and the sequence of the BnSHP1-A9 is shown as SEQ ID NO. 2. Aiming at the InDel marker in R2 (the primer is IF4/IR4), 247bp of the primer can be amplified in R1, and 270bp of the primer can be amplified in R2.

A molecular marker primer designed based on InDel sequence in rape pod shattering related gene BnSHP1-A9-R2 is provided, as long as the primer designed based on SEQ ID NO.3 is the protection scope of the invention, preferably, the primer is as follows:

IF4：ACTTG GGACA TAGCC TAATG ATG

IR4：TCGTA CCACT TTGAT TTCAG ACA。

the application of the InDel sequence in rape pod shatter related gene BnSHP1-A9-R2 or rape pod shatter related gene BnSHP1-A9-R2 in preparing transgenic rape with shatter resistance is characterized in that the expression level of BnSHP1-A9 gene of the rape with the BnSHP1-A9-R2 gene is relatively low, so that the shatter resistance of rape pod is improved. Therefore, the expression of the BnSHP1-A9 gene can be inhibited through antisense gene transfer or RNAi experiments, and the same effect can be achieved.

The molecular marker primer designed based on the InDel sequence in the rape pod shattering related gene BnSHP1-A9-R2 is applied to the genetic breeding of the rape, and the primer is utilized to screen unknown rape strains, so that the screening progress of the rape pod shattering resistant strains can be accelerated, and the rape breeding work is facilitated.

According to the invention, through experimental research, a QTL site which influences the pod shattering resistance of rape but does not influence other characters of rape pod is discovered, and a gene specific InDel primer pair for identifying the site is further developed. The application of the InDel locus and the primer pair can identify the pod shattering resistance of the rape in advance at the early stage of the rape instead of identifying the pod shattering resistance through the field phenotype after the rape is mature. The InDel locus and the primer pair of the invention accelerate the breeding process of the rape and have wide application prospect in the field of selective breeding of the rape.

Compared with the prior art, the invention has the advantages that:

the invention is firstly positioned to the negative effect QTL site on the rape A09 for controlling the crack resistance angle, and can explain 11.26-12.07% of the phenotype variance. RNAi experiments corresponding to the BnSHP1-A9-R1 gene further prove that the gene has negative effects, namely, the expression is inhibited, and the crack resistance is enhanced. In the conventional breeding method, the identification of silique dehiscence resistance is performed indoors after harvest in the mature period, which is time-consuming and labor-consuming and has low selection efficiency (dehiscence resistance is influenced by the mature period to some extent). Further, a pair of InDel markers (IF4/IR4) is developed by utilizing the difference between the R1 and R2 genomes, different QTL sites of the silique anti-cracking angle are detected through gene function markers, elimination can be carried out in the seedling stage, the production cost is saved, and the selection efficiency is greatly improved. The position of the functional gene of the anti-crack angle negative QTL point is clear, and the detection method is convenient and quick and is not influenced by the environment. The anti-dehiscence performance of the breeding material can be predicted by detecting the anti-dehiscence functional molecular marker, and then the anti-dehiscence rape strain can be accurately and rapidly screened.

Drawings

FIG. 1 is a frequency distribution diagram of the pod shatter resistance coefficient (SRI) of two-year siliques of 2013-2014 when DH populations constructed by the rape pod shatter strain R1 and the non-shatter strain R2 are planted in Wuhan.

The result shows that the phenotype of the silique cracking angle coefficient in 2013 is distributed in a normal state, the phenotype of the silique cracking angle coefficient in 2014 is distributed in a normal state, the variation range is wide, and the silique cracking angle resistance is controlled by quantitative characters.

FIG. 2 is a LOD curve of a QTL site for the angle of rupture coefficient located on the A9 linkage group.

The abscissa in the upper graph represents the linkage group and the ordinate represents the LOD value.

The abscissa in the lower graph represents the linkage group and the ordinate represents the additive effect value.

FIG. 3 shows the structural difference between the R1 and R2 dehiscence related gene BnSHP 1-A09.

FIG. 4BnSHP1-A9Indel marker IF4-F/R results were detected in DH population (a) and natural population (b).

FIG. 5 is a partial molecular marker genetic linkage map of a rape R1 XR 2_ DH population A9 linkage population.

FIG. 6 shows the results of the detection of the expression levels of R1 and R2in BnSHP1-A09 at different developmental stages.

(a)1 is a flower bud (<0.3cm), 2 is a flower bud (>0.3cm), 3-5 are first-flowering, full-flowering and withered flowers, 6-8 are 1cm, 1.5cm and 2cm pistils, respectively, (b) expression patterns of BnSHP1-a09 after 10, 16, 18, 20 and 22 days of silique development, respectively.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. Wherein R1, R2 and DH groups are in the literature "Wang Hui, Sangshi Fei, Meidersu et al. The Chinese journal of oil crops 2014,36(4): 437-442' discloses that the public can obtain from the institute of oil crops of the Chinese academy of agricultural sciences.

Example 1: obtaining rape pod shattering related gene BnSHP 1-A9:

first, qSRI.A9.1 location and cloning

(I) field experiment and crack resistance angle index phenotype determination:

in the field test, the crack resistance angle index (SRI) of a strain or an individual plant is examined in the maturity period in a prowl laboratory station (wuhan) of the oil institute of the chinese academy of agricultural sciences in autumn from 2013 to 2014, and the identification method is referred to patent 201310226680.4. Drying the rape pod at 80 ℃ for 30min, sealing and storing at room temperature overnight, and then placing the rape pod into a cylindrical container in which 8 steel balls are placed; shaking the cylindrical container at 280rpm by using a shaking table HQ45Z, observing the cylindrical container once every two minutes for 5 times, repeating each material for 3 times, and utilizing a formula: calculating the crack angle index by the total times of the crack angle index ∑ Xi x (6-i)/silique number, wherein Xi is the number of the siliques damaged at the ith time, i is more than or equal to 1 and less than or equal to 5, and the crack angle index ═ 1-crack angle index. The index distribution of the crack angles for two years is shown in fig. 1.

(II) genotyping

The R1 XR 2DH group and the parent are respectively extracted from the leaves at the 5-leaf stage to extract DNA, and each individual plant is respectively marked, and for the DH group strain, 3 individual plants with the same genotype are mixed, sampled from the leaves, marked by the district number, and rapidly frozen and stored in the field. Diluting the DNA of each sample to about 10 ng/mul, designing a target interval primer for PCR amplification, and carrying out genotype identification by polyacrylamide gel electrophoresis or agarose gel electrophoresis. The sequence information of the target genome region is derived from Darmor-bzh whole genome sequencing data, an SSR locus in the target genome sequence is scanned by an SSR reader, and then a primer is designed by using Primer5.0(www.Premier5BioSoft.com) to develop a polymorphic marker for screening favorable recombinant single strains in the target genome region.

QTL localization analysis

Composite interval QTL mapping analysis (1000 times permatation, P0.05 level) was performed on DH population populations using Windows QTL Cartographer (http:// statgen. ncsu. edu/qtlcart/wqtlcart. htm). Preliminary localization analysis was performed for qSRI-a9.1 (fig. 2). And (3) developing a molecular marker for qSRI-A9.1, and using the molecular marker to assist breeding.

And (4) experimental conclusion: the DH colony is used for positioning a QTL affecting the pod shattering resistance of rape, wherein a negative effect QTL locus qSRI.A9.1 (pod shattering resistance gene is derived from R2), the LOD value of the QTL affecting the shattering resistance is 4.76-4.91, and 11.26-12.07 percent of phenotypic variation can be explained (Table 1).

Table 1: two-year dehiscence resistance QTL location for R1 XR 2DH population

Second, sequence analysis

According to the fine positioning result, the BnSHP1-A9 gene sequence is finally obtained by using bioinformatics means, wherein the BnSHP1-A9 gene consists of 7 exons and 6 introns, wherein the 2 nd to 6 th exons are shorter in length, the 1 st exon is longer and the length is more than 800bp (figure 3). The primer5.0 is used for designing an amplification primer covering the whole gene, two BnSHP1-A9 alleles in parents R2 and R1 are amplified and subjected to sequence alignment analysis, and the results show that: at the genome level, there are many differences in R1 and R2, including insertions of different lengths, deletions, and some SNP sites; at the mRNA level, compared to R2, R1 has a 12bp deletion (exon 7) and 9 SNP sites distributed throughout the mRNA.

In the invention, the gene BnSHP1-A9in R2 is called BnSHP1-A9-R2, and the sequence of the gene is shown in SEQ ID NO. 2; the gene of BnSHP1-A9in R1 is called BnSHP1-A9-R1, and the sequence of the gene is shown in SEQ ID NO. 1.

Table 2: BnSHP1-A9 full-length amplification and RT-PCR primer

Example 2: the expression difference analysis of BnSHP1-A9 is carried out on the samples of the corresponding parts of R1 and R2 pod development tissues at different development stages.

Firstly, different buds are bloomed until different periods of pod development are formed, the initial period of rape blooming is taken as a standard, the pods are sampled every 2 days after being pollinated for 10 days, and 5 plants with consistent pod development sizes are selected in parallel as 5 biological repeats according to the pod development period from each material in each period, so that the harvested pods are ensured to contain the same proportion of isolated tissues as much as possible. Total RNA was extracted using RNAprep pure Plant Kit (TIANGEN), followed by Hiscript^@II 1^stStrandcDNA Synthesis kit RNA was reverse transcribed into first-strand cDNA using 2 × Es Taq MasterMix (CWBIO), BIO-RAD S1000^TMRT-PCR reaction was performed in a Thermal Cycler. RT-PCR primers BnSHP1.A9-orf designed on both sides of gene coding frameThe amplification length is 906-908bp, Actin is used as an internal standard, and the gene specific primer sequence and the internal standard primer sequence are shown in Table 2.

The results shown in FIG. 6: r1 and R2 have the same expression level in bud stage BnSHP1-A09, and are hardly expressed. However, the expression level of R2in the flowering phase is obviously much lower than that of R1. The difference of expression between the two materials is not significant in 10 days and 16 days of the development of the silique, the difference of expression values of R1 and R2in three periods of 18 days, 20 days and 22 days at the later stage of the development of the silique is significant, the P values are respectively 0.669, 0.290 and 0.337, namely the difference of expression values of the gene is significant after the silique is formed for 18 days after the flower development of the two materials, the expression value of the gene is slowly reduced along with the development of the silique in R1, but the gene is basically stopped to be expressed after 18 days in R2, so the difference of the anti-keratosis is mainly caused by the change of the expression value of the target gene.

Example 3: construction of rape BnSHP1-A9-R1 suppression expression vector and transformation in rape

Based on the coding region sequence of BnSHP1-A9 of the R1 material, a primer amplification partial coding region fragment (143bp) is designed, and the primer sequence is as follows: TTCTTTTCGGTGGTTTATTC, and TGACGATTTGTTGTGTTCTCT. This was ligated in reverse orientation to the topo vector and recombined into pEarleyGate 100. The vector was transformed into LBA4404 in preparation for the transformation of canola.

Agrobacterium LBA4404 transformation of oilseed rape

A. Preparation of aseptic seedlings: the seeds are soaked in 70% ethanol for 1min, mercuric chloride (HgCl2) for 13-15min, and washed with ddH2O for 5 times, and then spread in MS culture medium (pH 5.8) with agar concentration of 0.8%. Sterile rape seedlings are reserved.

B. Rape seed petiole transformation: agrobacterium tumefaciens LBA4404 was inoculated onto the solid medium LB, and two days later, a single colony was picked up and cultured in 50ml of YEP liquid medium (tryptone 10g + yeast extract 10g + NaCl5g + MgSO40.5 g). Taking sterile seedling petiole for 4-5 days, soaking in the bacterial liquid for 5-8min, shaking gently, then pouring out the bacterial liquid, and absorbing residual bacterial liquid on the explant by using sterile filter paper. Placing in co-culture medium (MS +0.2 mg/L6-benzyladenine (6-BA) +1 mg/L2, 4-dichlorophenoxyacetic acid (2, 4-D) +200um Acetosyringone (AS), PH5.8), and culturing for 2-3 days.

C. Transferring the explants after co-culture into a differentiation medium only containing penicillin (Car) and not containing Kan, performing bacteria removal and differentiation culture in a dark greenhouse for 5-7 days, subculturing in a selection medium (MS +3mg/L6-BA +0.1mg/L α -naphthylacetic acid (NAA) +5mg/L silver nitrate (AgNO3) +400mg/L Car +15mg/L Kan; pH5.8) added with Kan screening pressure, and screening until regenerated green buds are differentiated.

D. When the regenerated bud grows to 1cm, cutting the bud, transferring to rooting culture medium (MS +0.2mg/L NAA +10mg/L Kan +400mg/L Car; pH5.8), and screening with solid MS culture medium containing Car and Kan.

E. Transplanting the seedlings into the outdoor after the seedlings take roots. After 10 days, the soil pot is transplanted.

Identification of transformed plants

(1) Extraction of total DNA of transformed plants for PCR

A.70% ethanol scrub the leaf, weigh about 100mg

B. 600ul of extraction buffer (0.2M Tris-Cl, 0.25 NaCl, 25mM EDTA, 0.5% SDS, pH7.5) was added and the mixture was rapidly triturated at room temperature.

C.1.5ml Ependorff tubes were vortexed and mixed for 5-10 s.

D.12000rpm, 25min, room temperature. The supernatant was taken and precipitated overnight at-20 ℃ with an equal volume of isopropanol.

E.12000rpm, 15min, room temperature. The DNA precipitate was washed with 200ul of 70% ethanol.

F.12000rpm, 15min, room temperature. And (4) removing ethanol. Placing on paper towel upside down until ethanol is completely volatilized.

G. Sterile water (100 ul) was added to dissolve the crude DNA precipitate. The concentration is estimated by spectrophotometric measurement or electrophoresis.

H. PCR was performed using the total DNA as a template.

(2) PCR procedure

The total volume of the PCR reaction system was 20. mu.l, 1ul (about 50ng) of genomic DNA template, 1 XTaq enzyme reaction buffer, 25mM MgCL21.2ul, 2mM dNTP 1.5ul, 0.2ul each of 10uM primers, 50% glycerol 2ul, 0.3 unit rTaq enzyme (Takara Co., Ltd.), and ddH2O to 20. mu.l. And designing and synthesizing a P CR primer spanning the intron according to a target gene in the plant expression vector. (forward primer: TTCTTTTCGGTGGTTTATTC and reverse primer TGACGATTTGTTGTGTT CTCT, the reaction time and temperature were 94 ℃ for 3min, 94 ℃ for 45s, 59 ℃ for 45s, 72 ℃ for 2min for 30s, 30 cycles, 72 ℃ for 5 min.

The detection result shows that the positive control and most of the transformed plants can amplify an electrophoretic band with the expected size, and the negative control does not, which indicates that the genome of the transgenic rape already contains the exogenous gene DNA fragment.

Phenotypic analysis of T1 transgenic lines

The rape BnSHP1-A9 transgenic line and the control are harvested after being completely mature, and the pod shattering resistance index is identified after the rape is taken and fully dried. The final results show that part of the transgenic lines have increased crack resistance compared to the non-transgenic lines, with the maximum increase exceeding 15%.

Therefore, the BnSHP1-A9-R1 is a negative regulatory gene, and the InDel sequence in the R2 ensures that the BnSHP1-A9-R2 gene has crack resistance.

Example 4:

the application of the molecular marker primer designed based on the InDel sequence in the rape pod shattering related gene BnSHP1-A9-R2 in the genetic breeding of rape:

the molecular marker primers designed based on the InDel sequence (shown in SEQ ID NO. 3) are as follows:

IF4：ACTTG GGACA TAGCC TAATG ATG

IR4：TCGTA CCACT TTGAT TTCAG ACA。

the gene InDel molecular marker is positioned in the anti-crack angle interval (figure 5)

(1) In the field planting, R1 XR 2F 2 single plants are selected, bagged and selfed to obtain F3 seeds.

(2) F3 single plants are subjected to plate sampling before final singling, total DNA of leaves is extracted, qSRI.A9.1 genotype judgment is carried out on the F3 single plants by using molecular markers IF4/IR4, only the single plants with the same band types as R2 are reserved, and the other single plants with the same band types as R1 and heterozygous single plants are completely pulled out (the single plants with the band types of R1 and H are pulled out by reserving the band types as R2 because IF4/IR4 are co-dominant markers).

The same band pattern as R2 was obtained from a single strain in which only one band of 270bp was amplified.

(3) F3 individuals were harvested at maturity and subjected to dehiscence angle identification. The results show that the single strain with the same molecular marker IF4/IR4 genotype and R2 has the angular crack resistance exceeding that of R2 by 93.4 percent. Therefore, the elimination in the seedling stage not only saves the production cost but also greatly improves the selection efficiency, and then the pod shattering resistant rape strains can be quickly screened out for improving the genetic improvement of the rape.

Example 5:

the universality of the InDel sequence in rape pod shattering related gene BnSHP1-A9-R2 as a molecular marker in genetic breeding:

the experimental materials are as follows:

(1) medium oil 821, medium double No. 4, medium double No. 9, zhejiang oil 50, Skipton, wan oil No. 12, OC 3237; huyou oil 21, Huashuang No. 5, P10, Trigold, AV-SAP, GSL2, Zheshuang No. 6, Westar, Ningyou No. 7, Matador, Nilla, Cibradra, Apomix.

(2) Two parent materials used in primary localization: r1 and R2 and their DH populations.

Secondly, genotype detection primers:

primers IF4 and IR 4.

Third, genotype detection method

InDel-labeled amplification system and detection program

For 5 leaves, the DNA of each leaf was extracted and diluted to 10 ng/. mu.l of working solution for PCR amplification. The InDel marker (IF4-F/R) was developed based on the allele PCR amplification principle. The specific method comprises the following steps: specific forward primers (IF4-F: ACTTGGGACATAGCCTAATGATG), reverse primers (IF4-R: TCGTACCACTTTGATTTCAGACA), 3% agarose gel, and electrophoresis at 5V/cm voltage were designed based on the known InDel site to detect PCR products.

The PCR amplification system is as follows: 2 XTaq Mix 5ul, Forward Primer (10uM/ul) 1ul, Reverprimer (10uM/ul) 1ul, gDNA 1ul, ddH2O 2ul, Total 10 ul.

And (3) PCR reaction conditions: 94 ℃ for 3 min; 30s at 94 ℃; 58 ℃, 30s, 72 ℃, 45 s; 35 cycles; 72 ℃ for 10 min; 4 ℃ and kill use.

The size of the BnSHP1-A9-R2 fragment obtained by respective amplification is 270bp, while the size of the BnSHP1-A9-R1 fragment is 237bp, and the band difference can be distinguished by agarose electrophoresis detection, thereby displaying the InDel result.

As can be seen in fig. 4, medium oil 821, medium double No. 4, medium double No. 9, zhe oil 50, Skipton, wan oil No. 12, OC3237 are 7 inbred lines with R1Indel designation; huyou No. 21, Huashuang No. 5, P10, Trigold, AV-SAP, GSL2, Zheshuang No. 6, Westar, Ningyou No. 7, Matador, Nilla, Cibrabra, Apomix are 13 inbred lines with R2Indel mark: therefore, the molecular marker provided by the invention has universality in the existing rape line and is suitable for screening the anti-crack rape.

SEQUENCE LISTING

<110> institute of oil crop of academy of agricultural sciences of China

<120> rape pod shattering related gene, molecular marker and application

<130> rape pod shattering related gene, molecular marker and application

<160>5

<170>PatentIn version 3.1

<210>1

<211>2737

<212>DNA

<213> Brassica napus

<400>1

atggatgaag gtgggagtag tcactatgca gagagtagca agaagatagg tagagggaag 60

atagagataa agaggataga gaacacaaca aatcgtcaag taaccttctg caaacgacgc 120

aatggtcttc tcaagaaagc ttatgagctc tctgtcttgt gtgatgcgga agttgccctc 180

gttatctttt ccactcgtgg ccgtctttat gagtacgcca gcaacaggta tgcttctcct 240

acctacacct tgatctagct ttcttgatta atttactact acaatcctag ttaaaatgag 300

ccaagattag ggttttgttt agattacaat ccttgatttt ctatttttat ataaaaatta 360

gatctcaata gagctaccat tgtctctcta gatctgtgta tatccaaata atgaagacgg 420

gagaaagctg tcttgtcttc tcaacttctc gttagtctga tcttagttag tttcactctt 480

tttctgcaga tcattagaac ctgtttcatg tcatgtcagc ttctataaaa tacttttatc 540

tcgacgaccc atactatgtc tttctttaaa tattattagg gtttcgtcag taaaaaaaaa 600

ctgggtactt cttgacacgc aatagcatgc atatatgtaa atatgcaaga catatgtaac 660

cctcctgtct tgtgaaactt gggacataac ctaatgatgg ttgtcactat ggatcccttt 720

aatttttttc ctaacccaag aaaacaaatg cccaccgata aaactttagt tatatattat 780

atctatctat ctggagttcg tatgttgaga atatatatat gtgactattt aaaaatctag 840

gcccttaaaa tatgtgtatc cattaatata ttaatgagag ggagataact cagagagaag 900

tgtctgaaat caaagtggta cgagccaatg ggaatctata gcactctgag ctccatttat 960

atgtgctgtt gtatttgaaa aaaaaacagt taatcatcct taaagcatac tttgatgaca 1020

ttaaaccata taatatgcat ggaccttgtt ctgtattcct cctcaaaccg taagtaatta 1080

ccagtttgaa tccatatatt aattaattgc tgcatcagcc atttttaaat atgtacattg 1140

aaaaagtaat ttactcgagc acaatgtgtg tcattgaagt ttctcctcgt actggtcaaa 1200

aaactggtcc aaacctcaaa gccatcacat tcctttcttg tcgattttaa ggttttgccc 1260

ccaaaataaa cattccaaaa ccttaatcaa gaaatgtcgt cccaattatc tctgttttaa 1320

gagtatatta attaaattaa atataatggt ttctttaact ttctagtgtg aagggtacaa 1380

ttgaaaggta caagaaagct tgttccgatg ccgttaaccc tcctactgtc actgaagcta 1440

ataccaaggt accattcttg tatagttttt tttttttact agccctctct tttttcttat 1500

ttttatgatc aattattaac gtttagaaag tgaaatcttt ttaaaatgtg tatatatata 1560

tgtggtttct tgtttctatg atgatcaatt atgtattcgt gtcaaaagaa cgttactaac 1620

aaaattctta acatttacac ccaaaagtaa aaacattatt aacaaaaaga gtggattcct 1680

gaaatgcatt gagacggttg tatttgtatg catggaaccc ttcagtacta tcagcaagaa 1740

gcctctaagc ttcggaggca gattcgggac attcagaatt cgaacaggta agtaactata 1800

gctcttcatg aggtttcttg ttttgatcac tactttccta ttatatagct gatcttttcg 1860

attagtttaa ctgaaaaaat tacagaacct gagtcaagta agttataatt cattcaaaat 1920

cgttcattcc aaataatttt ttttcttttt tggtaggatt gttaggttgg ttaacttact 1980

tggaattgct tgaatctctg cttggtttgg tgatatatgg tatatggaac cataaataaa 2040

aacttgggtt taattttcgt gtttttttgc caaatagttt acttttagtt acgtttgaac 2100

gagtgcaaat gtttattaat gttcatgttt atgaatcgaa ggcatattgt tggggaatca 2160

cttggttcct tgaacttcaa ggaactcaaa aacctagaag gacggcttga aaaaggaatc 2220

agccgcgtcc gatccaagaa ggtacgtact gataaaccta tacgtctatg tctctctata 2280

gtttatatat agtttcatcg ctcttatatg aatcttttcc agagtgaact tttagtggca 2340

gagatagagt atatgcagaa gagggtaagt aacgtttctt cccaatcttt catcgttctt 2400

ttacatgggt tttgagtttt gccataaacc atgtaggaaa tggagttgca gcacgataac 2460

atgtacctaa gagctaaggt tagtcacgtc ttcatcctct aaccgagata atgaacgtgt 2520

atcacaacca aactttgatg ttcggtttgt gcagatagaa caaggcgcga gattgaatcc 2580

ggaacagcat ggatccggtg taatacaagg gacggcggtt tatgagtccg gtctgtcttc 2640

ttctcatgat cagtcgcagc attatattcc ggttaacctt cttgaaccga atcaacaatt 2700

ctccggtcaa gaccaacctc ctcttcaact tgtttaa 2737

<210>2

<211>2757

<212>DNA

<213> Brassica napus

<400>2

atggatgaag gtgggagtag tcacgatgca gagagtagca agaagatagg tagagggaag 60

atagagataa agaggataga gaacacaaca aatcgtcaag taaccttctg caaacgacgc 120

aatggtcttc tcaagaaagc ttatgagctc tctgtcttgt gtgatgctga agttgccctc 180

gttatcttct ccactcgtgg ccttctttat gagtacgcca gcaacaggta tgcttctcct 240

acccacacct tgatctagct ttcttgatta atttactact acaatcctag ttaatatgag 300

ccaagattag ggttttgttt aaattacaat cctgaatttt ctatttttta tataaaaatt 360

agatctcaat agggctacca ttgtctctct agatctgtgt atatccaaat aatgaagacg 420

gaagaaatct gtcttgtctt ctcaacttct cgttagtctg atctttgtta gtttcactct 480

ttttctgcag atcactagaa cctgtttcat gtcatgtcag cttctataaa atgcttttat 540

cttgacgacc catactatgt ctttctttaa atattattag ggtttcgtca gtaaaaaaaa 600

actgggtagt acgcaatagc atgcatatat gtaaatatgc aagacttatg taaccctcct 660

gtcttgtgaa acttgggaca tagcctaatg atggttgtca ctatgacact atggatcccc 720

tttaattttt ttcctaaccc aagaaaacaa atgccgaccg ataaaacttt agttatatat 780

aaaatatata acatctatct ggagttcgta tgttgagaat atatatatgt gactatttaa 840

aatctaggcc ctttaaggat gtaaaatatg tgtattccat taatatatta atgagaggga 900

gataactcag agagaagtgt ctgaaatcaa agtggtacga gccaatggga atctatagca 960

ctctgagctc catttatatg tgctgttgta tttgaaaaaa aacagttaat catccttaaa 1020

gcatactttg atgacattaa accatataat atgcatggac cttgttctgt attcctcctc 1080

aaaccgtaag taattaccag tttgaatcca tatattaatt aattgctgca tcagccattt 1140

ttaaatatgt acattgaaaa agtagtttac tcgagcacaa tgtgtgtcat tgaagtttct 1200

cctcgtagtg gtcaaaaaac tggtccaaac ctcaaagcca tcacattcct tgtcgatttt 1260

aaggttttgc ccccaaaata aacattccaa aaccttaatc aagaaatgtc gtcccaatta 1320

tctctgtttt aagagtatat taattaaatt aaatataatg gtttctttaa ctttctagtg 1380

tgaagggtac aattgaaagg tacaagaaag cttgttccga tgccgttaac cctcctactg 1440

tcactgaagc taataccaag gtaccattct tgtatagttt tttttttact agccctctct 1500

tttttcttat ttttatgatc aattattaac gtttagaaag tgaaatcttt ttaaaatgtg 1560

tatatatatg tggtttcttg tttctatgat gatcaattat gtattcgtgt caaaagaaca 1620

ttactaacaa aattcttaac atttacaccc aaaagtaaaa acattattaa caaaaagagt 1680

ggattcctga aatgcattga gacggttgta tttgtatgca tggaaccctt cagcactatc 1740

agcaagaagc ctctaagctt cggaggcaga ttcgggacat tcagaattcg aacaggtaag 1800

taactatagc tcttcatgag gtttcttgtt ttgatcacta ctttcctatt atatagctga 1860

tcatttcgat tagtttaact gaaaaaatta cagaacctga gtcacgtaag ttataattca 1920

ttcaaaatcg ttcattccaa ataatttttt ttcttttttg gtaggattgt taggttggtt 1980

aacttacttg gaattgcttg aatctctgct tggttttgtg atatatggta tatggaacca 2040

taaataaaaa cttgggttta attttcgtgt ttttttgcca aatagtttac ttttagttac 2100

gtttgaacga gtgcaaatgt ttattaatgt tcatgtttat gaattgaagg catattgttg 2160

gagaatcact tggttcattg aacttcaagg aactcaaaaa cctagaagga cggcttgaaa 2220

aaggaatcag ccgcgtccga tccaagaagg tacgtactga taaacctata cgtctatgtc 2280

tctctatagt ttatatatag tttcctcgct cttatatgaa tcttttccag agtgaacttt 2340

tagtggcaga gatagagtat atgcagaaga gggtaagtaa cgtttcttcc caatctttca 2400

tcgttctttt acatgggttt tgagttttgc cataaaccat gtaggaaatg gagttgcagc 2460

acgttaacat gtacctaaga gctaaggtta gtcacgtctt catcctctaa ccgagataat 2520

gaacgtgtat cacaaccaaa ctttgatgtt cggtttgtgc agatagaaca aggcgcgaga 2580

ttgaatccgg aacaacatgg atccggtgta atacaaggga cggcggttta tgagtccggt 2640

ctgtcttctt ctcatgatca gtcgcagcat tataaccgga attatattcc ggttaacctt 2700

cttgaaccga atcaacaatt ctccggtcaa gaccaacctc ctcttcaact tgtttaa 2757

<210>3

<211>270

<212>DNA

<213> Artificial sequence

<400>3

acttgggaca tagcctaatg atggttgtca ctatgacact atggatcccc tttaattttt 60

ttcctaaccc aagaaaacaa atgccgaccg ataaaacttt agttatatat aaaatatata 120

acatctatct ggagttcgta tgttgagaat atatatatgt gactatttaa aatctaggcc 180

ctttaaggat gtaaaatatg tgtattccat taatatatta atgagaggga gataactcag 240

agagaagtgt ctgaaatcaa agtggtacga 270

<210>4

<211>23

<212>DNA

<213> Artificial sequence

<400>4

acttgggaca tagcctaatg atg 23

<210>5

<211>23

<212>DNA

<213> Artificial sequence

<400>5

tcgtaccact ttgatttcag aca 23

Claims (6)

1. The nucleotide sequence of the rape pod shattering related gene is shown in SEQ ID NO. 2.

2. The allele of the gene of claim 1, having the nucleotide sequence shown in SEQ ID No. 1.

3. Use of a product inhibiting the expression of the gene of claim 2in the preparation of anti-oilseed rape.

4. The sequence of rape pod shattering related gene Indel is shown in SEQ ID NO. 3.

5. The primer designed according to the gene of claim 2:

IF4：ACTTG GGACA TAGCC TAATG ATG

IR4：TCGTA CCACT TTGAT TTCAG ACA。

6. use of the primer of claim 5 in genetic breeding of anti-oilseed rape.

Images