CN110760525A

CN110760525A - Nucleotide sequence related to pod shattering resistance of rape and application thereof

Info

Publication number: CN110760525A
Application number: CN201911023460.5A
Authority: CN
Inventors: 刘佳; 胡琼; 周日金; 汪文祥; 李超; 梅德圣; 王会; 成洪涛
Original assignee: Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Current assignee: Oil Crops Research Institute of Chinese Academy of Agriculture Sciences
Priority date: 2019-10-25
Filing date: 2019-10-25
Publication date: 2020-02-07
Anticipated expiration: 2039-10-25
Also published as: CN110760525B

Abstract

The invention relates to the field of rape breeding, and discloses a nucleotide sequence related to rape pod shatter resistance and application thereof. The applicant generates a DH separation group by hybridizing cabbage type rape strains R1 and R2, genotype data of the DH group and multi-year dehiscence shape data are input into WinQTLcut 2.5 software to carry out QTL positioning, genome resequencing and permission are carried out on parents of the group, sequence difference in a target interval is mined, gene nucleotide sequence is found to generate great variation of activity such as transcription, and finally, a nucleotide sequence related to the dehiscence of the cabbage type rape is obtained, wherein the sequence is shown in SEQ ID NO.1 or SEQ ID NO. 2. And designing a primer aiming at the difference of the two sequences, and being used for screening the rape anti-cracking angles.

Description

Nucleotide sequence related to pod shattering resistance of rape and application thereof

Technical Field

The invention relates to the field of rape breeding, in particular to a nucleotide sequence related to rape pod shatter resistance and application thereof.

Background

Rape is one of three oil crops in the world and is also the first oil crop in China, and the total rape production in China accounts for about 20 percent of the world. The rape can not only provide healthy rape oil, but also provide functional bolting, honey, feeding, fertilizer, leisure sightseeing and other multi-aspect values. The rape yield of China realizes three leaps, and what restricts the further development of the rape industry of China at present is that the mechanization degree is not high, and the anti-crack rape variety suitable for mechanized harvesting is lacked.

Dehiscence of siliques is of great importance for the propagation and evolution of plant progeny, but dehiscence of siliques causes losses in agricultural production for crop seed harvesting. Plant evolution and crop domestication is a counter selection on the trait of dehiscence of the silique (Dong et al, 2015). Because the cabbage type rape varieties used in the current production are particularly easy to crack corners when mature, the yield loss of about 10 percent is generally caused by manual harvesting, and the loss is more serious by mechanical harvesting. Yield losses can be as high as 50% or more when exposed to inclement weather (Kadkol et al, 1984; Wang et al, 2007). And the seeds with lost cracked corners germinate to form self-growing seedlings, which not only influences the growth of the next-stubble crops, but also increases the cost of applying herbicide to remove the regenerated seedlings (

Etc., 2006). At present, a method of harvesting in advance is adopted in production to avoid yield loss caused by corner cracking and adverse effect on next-stubble crops, but the measure can cause the chlorophyll content in rapeseeds to be increased, the oil content to be reduced and the quality to be reduced. Therefore, the effort to improve the resistance to pod shattering of the rape cultivar is an urgent task to realize mechanized production, stabilize harvest yield and ensure the quality of rapeseeds.

Suppression of dehiscence in oilseed rape pods using genes cloned from Arabidopsis thaliana that are involved in the development and dehiscence of the podBetter progress was achieved (Mummenhoff et al, 2009). Dinneny et al (2005) and Ferrandiz et al (2000) utilize RNAi technology to inhibit the SHP, IND and ALC gene expression of rape pod lobe edge, control rape pod dehiscence;

aard et al (2006) Agrobacterium-mediated transformation of 35S: FUL gene is transferred into black mustard (B.nigra), and is found to be abnormally expressed in a fruit flap, so that the identification and development of a fruit flap edge layer are inhibited, and the fruit flap edge layer is developed as a fruit flap cell, so that the horn fruit is not cracked. Salentijn et al (2007) introduced the dehiscence resistant gene in Arabidopsis into Brassica napus to obtain dehiscence resistant Brassica napus germplasm. Braatz et al (2017 and 2018) obtained resistant resource material for ALC, IND and FUL by gene editing and screening mutant pools.

In recent years, with the rapid development of rape molecular biology, a plurality of QTL for controlling rape pod shattering have been located, but no report is available for utilizing key genes and functional molecular markers under corresponding anti-pod shattering QTL sites, aiming at the problems, the invention provides a nucleotide sequence related to rape pod shattering resistance, and a primer designed according to the sequence can be used for efficiently screening the rape pod shattering resistance and accelerating the rape breeding process.

Disclosure of Invention

The invention provides a nucleotide sequence related to pod shattering resistance of Brassica napus, which is shown as SEQ ID NO.1 or SEQ ID NO. 2.

The invention also aims to provide a primer group designed aiming at the difference of the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, wherein the primer group comprises the following components: PF4-F: TATCCAGGATCCACACGGGA, PF4-R: ACCTGTAGCTGCGGAAAGTG, PF5-F: GTCACACTACGGGGCGTTTA and PF5-R: TTTGATCTGAGAGCATCATCCG.

The last purpose of the invention is to provide the application of a primer group designed aiming at the difference of the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, and the primer group can be used for the breeding of the brassica napus, in particular to the screening breeding related to the dehiscence shape.

In order to achieve the purpose, the invention adopts the following technical measures:

obtaining a nucleotide sequence related to pod shatter resistance of Brassica napus:

(1) using the crossing of Brassica napus lines R1 and R2, the hybrid F1 generation produced DH segregating population by microspore culture.

(2) And (3) carrying out molecular marker analysis on the DH separation population by using the polymorphic primers to obtain genotype data.

(3) Inputting the genotype data of the DH separation population into Joinmap4.0 software to construct a genetic linkage map;

(4) genotype data (only limited to markers located on genetic maps) of the DH population and the anti-fissure character data of a plurality of years are input into WinQTLctart 2.5 software for QTL location, wherein one QTL can be repeatedly detected in the DH population for a plurality of years, and the effect value and the contribution rate are stable.

(5) Genome re-sequencing and permission are carried out on the group parents, sequence difference in a target interval is excavated, and gene nucleotide sequences are found to generate great variation of activities such as transcription, so that the target gene nucleotide sequences are further analyzed.

(6) The gene (SEQ ID NO.2) and the nearby sequence are enhanced and expressed into the rape pod cracking resistance parent material, which can lead to the improvement of the cracking degree of rape pod and the reduction of the cracking resistance of rape, and the inhibition or interruption of the expression of the gene can improve the cracking resistance of rape; the nucleotide sequence related to the pod shatter resistance of the brassica napus R1 is shown as SEQ ID NO. 1; the nucleotide sequence related to the pod shatter resistance of the brassica napus R2 is shown as SEQ ID NO. 2.

The primer group designed aiming at the difference of the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 is as follows:

PF4-F: TATCCAGGATCCACACGGGA, PF4-R: ACCTGTAGCTGCGGAAAGTG, PF5-F: GTCACACTACGGGGCGTTTA and PF5-R: TTTGATCTGAGAGCATCATCCG.

The application of a primer group designed according to the difference of sequences shown in SEQ ID NO.1 and SEQ ID NO.2 is characterized in that the primer group is utilized to detect a plant to be detected, and if a single 700bp strip is obtained, the plant is considered to be an anti-crack variety; if a single 871bp band is obtained, the rape is considered to be a dehiscent horn variety, so the primer group can be used for breeding the cabbage type rape, particularly screening and breeding related to dehiscent horn resistance.

Compared with the prior art, the invention has the following advantages:

the invention provides a nucleotide sequence related to pod shattering resistance of Brassica napus, 135 parts of natural rape population materials are utilized to perform typing by utilizing a molecular marker designed aiming at the sequence in a two-year natural environment in 2012 and 2013, and the result shows that the pod shattering resistance index of the rape line is obviously different when the rape line is homozygous and heterozygous. In the conventional breeding method, the identification of silique dehiscence resistance is performed indoors after harvest in the mature period, which is time-consuming and labor-consuming and has low selection efficiency (dehiscence resistance is influenced by the mature period to some extent). The genetic variation of different crack angles of the silique is detected by the gene function markers, so that the silique can be eliminated in the seedling stage, the production cost is saved, and the selection efficiency is greatly improved. The functional genes of the anti-crack angle have clear difference, and the detection method is convenient and quick and is not influenced by the environment. The pod shatter resistance of the breeding material can be predicted by detecting the functional molecular marker of the pod shatter resistance gene, and then the pod shatter resistance rape strain can be accurately and rapidly screened.

Drawings

FIG. 1 the nucleotide sequence of the target gene was labeled with PF4 and the results were detected in the natural population.

FIG. 2 uses PF4 and PF5 markers to identify the genotype and the two-year crack angle coefficient phenotype of the natural population material for group statistics.

Example 1:

obtaining a nucleotide sequence related to the pod shatter resistance of rape:

(1) using the crosses of rape lines R1 and R2, the hybrid F1 generation produced DH isolate population by microspore culture.

Example 2:

obtaining molecular marker primers:

aiming at the difference of two sequences of SEQ ID NO.1 and SEQ ID NO.2, two dominant markers PF4 and PF5 are designed and developed and respectively correspond to sequences for detecting R1 and R2 genotypes, and a PF4 primer pair comprises 1 forward primer PF4-F: TATCCAGGATCCACACGGGA and a reverse primer PF4-R: ACCTGTAGCTGCGGAAAGTG; the PF5 primer pair comprises 1 forward primer PF5-F: GTCACACTACGGGGCGTTTA and a reverse primer PF5-R: TTTGATCTGAGAGCATCATCCG.

The two pairs of primer-specific molecular markers can amplify 700bp and 871bp bands in R1 and R2 respectively. And (3) PCR reaction system: 0.2uM each of the primers, 1ul of DNA template, 5ul of 2 XGreen Taq Mix (Novozan, P131), and 10ul of double distilled water. PCR reaction procedure: 3min at 95 ℃; 30s at 95 ℃ and 30s at 60 ℃ (each cycle is reduced by 1 ℃ in turn), 1min at 72 ℃, and 10 cycles; circulating for 25 times at 95 deg.C for 30s, 50 deg.C for 30s, and 72 deg.C for 1 min; 5min at 72 ℃. After the reaction, 5ul of PCR product was run on agarose gel for detection.

Example 3:

the application of the primers designed aiming at the sequence difference of SEQ ID NO.1 and SEQ ID NO.2 in the rape anti-cracking angle breeding:

the embodiment totally comprises 135 parts of natural population materials including R1 and R2, and the 135 parts of materials can be referred to published research papersLiu,(2016)Multigenic control of pod shattering resistance in Chineseoilseed rape germplasm revealed by genome-wide association and linkage analyses.Front.Plant Sci.7(1058),1-14.

(1) Planting rape lines in a field, sampling before final singling, extracting total DNA of leaves by using a CTAB method, wherein the used reagents (extracting solution, chloroform, isoamylol and absolute ethyl alcohol) are as described above; then, 135 parts of rape varieties (lines) are typed and confirmed according to the primers and the method described in the example 2;

(2) the materials are classified into three types (table 1) of R1, H (hybrid) and R2 according to genotype difference, and the materials are planted in 2012 and 2013 for two years to identify the anti-pod-cracking index of the materials (Pengpo Fei, et al. improvement and test of the rape pod anti-pod-cracking identification method. agricultural engineering report, 2013, 29(21): 19-25). The materials with the R1 genotype and rape strains with the R2 genotype are found to have obvious difference in anti-pod-cracking types in the 2012 environment. The numbers of dehiscence resistance indexes of the rape lines with the R1 genotype and the hybrid rape line and the rape line with the R2 genotype in the 2013 environment were very significantly different (fig. 2).

TABLE 1135 part materials marker genotype test and 2013 years crack resistance factor

Note: x, undetected genotype (meaning that a band is amplified but not in either R1 or R2); h, heterozygous genotype; NA, undetected phenotype.

In conclusion, the molecular marker provided by the invention is used for identifying and obtaining the rate of the angular crack resistance exceeding R2 by 95%. The molecular marker can be used for predicting the pod shatter resistance of rape and improving the selection efficiency of the pod shatter resistance of the rape, thereby accelerating the breeding process of the pod shatter resistance of the rape.

SEQUENCE LISTING

<110> institute of oil crop of academy of agricultural sciences of China

<120> nucleotide sequence related to rape pod shatter resistance and application

<160>6

<170>PatentIn version 3.1

<210>1

<211>700

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>1

tatccaggatccacacgggatcgttagtcttaccacttagacgatttccgtctgagtttg 60

ctttcggtgggtttaagagtttcaccaatgtttgccactgagcatcagagaaacctgtta 120

aaccctgtctgtcggcgtcggttaaggtgagattggcgccaatgccagttgttgatccaa 180

ttatctgagaagagtttgcacgtggagcagagttgtgtccagaagattgtgtatttgctt 240

gtccttcttgataattgttgcggtttcgaggtctcgttccccaccactccggaaacccaa 300

tcacacgaaaacatgaactagctcgatgtcctagcctgccacaactagtacatgtaacgt 360

ttgcgtctggatttggaggtcgtgggcggtagttgtcggtttgtcgagttgtcgaagaat 420

gtcgagagtgctccgagttgtgttgttgtgttggtgcttgagcagcaaaactcaacacgg 480

cgggagtctcagtttttgcattgagttgcacggtttcgttttgcactattgtctgatatg 540

ctgagtcgagatctggtagaggtatttgtgcacagatttgtgatcgtacggagctatgta 600

cttcatcaagaccaaacagaaaatcatgaacacgaatggtttcacgttcagtatcatgag 660

cgttgaccaaatcgcattcacactttccgcagctacaggt 700

<210>2

<211>871

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>2

gtcacactacggggcgtttaaagatttaaggaaagagattagctatctcgactctgcaat 60

tcttctttatttttatattttggtattgaaattttagtttatgttcttattattctttac 120

aaatatcagttgtcctatggtagtaaaataaggttcctacatcttactattacgaaaatt 180

gtgtttccgaacgtgtctaaaaagttaatactacatttaattttgctatcattaaaagat 240

tattcaagacgttcaaatcgattttgaccgctatgctcaaaaactttgaattatgagcga 300

tgtctagattctcaggatttaacatatatttcatatcagagtgactgcgaaccgagtccc 360

acgcaaaatagagaagacttaatgatcttcttcgtctggagttttcagtagagcatgtaa 420

ttacgggggtgcaagagtagatatctaagaagttagggcgaccaaatcaaagaaagaaaa 480

agataaaggatgataagtaaataacttgtaatgatcccctgaagcacagatagaacattt 540

gttgtcccctatctcccataaaggattcaggtactaggagaagttgataccagtttaaca 600

tgcacgtctcttttatcgcatatccatattttatcgcacctatatatctctatttgtata 660

tcctggccatctactctctcatgaatacttaaaattttcgtttcctactatttttgcaat 720

tttcctttatttatttacaaatattaattttagtttgatctatatatgtcccaagtttta 780

attatataataaatatgcatgtcactatgtcaaatatggctataaatcatcttcattttt 840

ttcatttttcggatgatgctctcagatcaa a 871

<210>3

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>3

tatccaggatccacacggga 20

<210>4

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

acctgtagctgcggaaagtg 20

<210>5

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>5

gtcacactacggggcgttta 20

<210>6

<211>22

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>6

tttgatctgagagcatcatc cg 22

Claims

1. A nucleotide sequence related to the pod shatter resistance of Brassica napus is shown as SEQ ID NO.1 or SEQ ID NO. 2.

2. The primer group designed aiming at the difference of the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 is as follows: PF4-F: TATCCAGGATCCACACGGGA, PF4-R: ACCTGTAGCTGCGGAAAGTG, PF5-F: GTCACACTACGGGGCGTTTA and PF5-R: TTTGATCTGAGAGCATCATCCG.

3. Use of the primer set of claim 2 in cabbage type rape breeding.

4. The use of the primer set of claim 2 in pod shatter resistance screening of brassica napus.