CN105311645A - Application of embryo FYN related substrate EFS in prevention and treatment of enterovirus 71 type infection - Google Patents
Application of embryo FYN related substrate EFS in prevention and treatment of enterovirus 71 type infection Download PDFInfo
- Publication number
- CN105311645A CN105311645A CN201510033902.XA CN201510033902A CN105311645A CN 105311645 A CN105311645 A CN 105311645A CN 201510033902 A CN201510033902 A CN 201510033902A CN 105311645 A CN105311645 A CN 105311645A
- Authority
- CN
- China
- Prior art keywords
- efs
- hbmec
- sirna
- fyn
- infection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention relates to the technical field of biomedicine, and provides a new target spot for resisting enterovirus 71 type infection and application. Human brain microvescular endothelia cells (HBMEC) serve as target cells, expression of target cell host protein is reduced by an RNA (ribonucleic acid) jamming technology so as to look for host factors capable of effectively inhibiting EV71 infected human brain microvescular endothelia cells (HBMEC), a function of protecting blood brain barrier is fulfilled, and the circumstance that viruses penetrate in the blood brain barrier and infect a central nervous system is prevented. Experiments show that embryo FYN related substrate EFS (Embryonal FYN-associated substrate) molecules play an important role in the EV71 infected HBMEC, and infection of EV71 can be inhibited obviously by reduction of expression of EFS. The invention provides application of EFS in preparation of drugs for preventing or treating enterovirus 71 type infection.
Description
Technical field
The present invention relates to field of biomedicine technology, be specifically related to novel targets and the application of the infection of anti-enterovirns type 71.
Background technology
Enterovirns type 71 (enterovirus71, EV71) belongs to Picornaviridae enterovirus genus people intestinal category-A virus, is one of main pathogens causing hand-foot-mouth disease (Hand-foot-mouthdisease, HFMD).At present, hand-foot-mouth disease to be broken out and popular in multiple area in the world, the especially Asian-Pacific area.In China, since 2008 Nian Ji great provinces and cities break out hand-foot-mouth disease epidemic situation, number of the infected and the mortality rate of this disease remain high always, and every annual report morbidity number is more than 1,000,000 examples, and death toll nearly 1000 is routine.Hand-foot-mouth disease principal pathogenetic crowd is 5 years old Infants Below, and clinical manifestation is heating, and the symptoms such as herpes appear in the positions such as hands, foot, buttocks and oral mucosa; Minority infant can develop into patient with severe symptoms, there is central nervous system (centralnervoussystem, CNS) pathological changes, comprise aseptic meningitis, brain stem encephalitis, encephalomyelitis and neurogenic pulmonary edema etc., life and health [the SolomonT of infant in serious threat, LewthwaiteP, PereraD, CardosaMJ, McMinnP, OoiMH.Virology, epidemiology, pathogenesis, andcontrolofenterovirus71.LancetInfectDis.2010Nov; 10 (11): 778-90.].Hand-foot-mouth disease particularly severe cases is many caused by enterovirns type 71 (EV71) infects.But, cause the treatment of hand-foot-mouth disease to there is no the antiviral drugs of differential high efficient about EV71 at present, clinically still based on symptomatic treatment, also come out without effective vaccine in prevention.
EV71 infects and has Neural invasion, easily causes serious CNS disease and complication thereof, and this is also cause hand-foot-mouth disease patient evolution for serious symptom even main causes of death.Wherein, brain stem is the most easily by position [Tee that EV71 infects, K.K., etal.Evolutionarygeneticsofhumanenterovirus71:origin, populationdynamics, naturalselection, andseasonalperiodicityoftheVP1gene.JVirol, 2010.84 (7): p.3339-50.], the position such as brain stem neuron that research confirms EV71 patient with severe symptoms all can detect the existence of EV71 gene and antigen, proves that EV71 can enter CNS.EV71 needs to pass through blood brain barrier through blood infection cycle CNS, but how not clear through the mechanism of blood brain barrier intrusion CNS virus is.Blood brain barrier (BloodBrainBarrier, BBB) be barrier main together between blood circulation and central nervous system, it limits different material freely transporting between two positions, vital effect [DyrnaF is played to maintaining in the homoiostasis of CNS and the invasion and attack of protection CNS from extraneous pathogenic microorganism, HanskeS, KruegerM, BechmannI.Theblood-brainbarrier.JNeuroimmunePharmacol.20 13; 8 (4): 763-73.].Blood brain barrier is by the cell conjugate jointly formed without the brain microvessel endothelial cells in vitro of fenestra and compact siro spinning technology therebetween, astroglial foot processes, cell basement membrane and pericyte.In this cell conjugate, topmost structure of matter basis is brain microvessel endothelial cells in vitro (BrainMicrovascularEndothelialCells, BMECs) and compact siro spinning technology, the loss of its property in neat formation is considered to the major reason that viral infection causes brain tissue impairment.Therefore, verify EV71 and infect the mechanism of BMECs and find new antiviral target spot with this, for the function of protection blood brain barrier, and the central nervous system infection that control EV71 causes is most important.
In the process of viruses infect host cells, a series of signal path of host cell widely can be activated.These signal paths can be utilized by virus, thus realize viral self effectively invading, copy, the life process such as release.Along with going deep into of research, these have been become the important target of antiviral therapy by the signal kinase molecule that virus utilizes.Research shows, EV71 infects need utilize many signal paths and regulator control system thereof, after and receptor acting early stage in infection, cytoskeleton system is regulated by activating Rho family molecule, promote Virus entry (HussainKM1, LeongKL, NgMM, ChuJJ.Theessentialroleofclathrin-mediatedendocytosisinth einfectiousentryofhumanenterovirus71.JBiolChem.2011; 286 (1): 309-21.); Activate PI3K/Akt and MAPK/ERK signal path, promote that virus is bred and causes inflammatory reaction further; By irritation cell cyclin-dependent kinase 5 (cyclindependentkinase5, Cdk5) approach carrys out the (TungWH such as cell death inducing, HsiehHL, YangCM.Enterovirus71inducesCOX-2expressionviaMAPKs, NF-kappaB, andAP-1inSK-N-SHcells:RoleofPGE (2) inviralreplication.CellSignal.2010,22 (2): 234-46.).But, infect the signal path that causes of BMECs about EV71 at present and the Signal Regulation molecule that utilizes still unclear.
Protein tyrosine kinase (proteintyrosinekinase, PTK) and Molecular regulator be important cell signalling kinases, various kinds of cell physiological function can be regulated, also be proved simultaneously and participate in regulating multiple virus to the course of infection (PelkmansL of host cell, FavaE, GrabnerH, HannusM, etal.Genome-wideanalysisofhumankinasesinclathrin-andcave olae/raft-mediatedendocytosis.Nature.2005,436 (7047): 78-86.).As receptor tyrosine kinase adaptin Grb2 mainly regulates downstream signal ERK path and PI3K/Akt path, participate in the course of infection (ChenZ that have adjusted murine leukemia virus MLV, KolokoltsovAA, WangJ, etal.GRB2interactionwiththeecotropicmurineleukemiavirusr eceptor, mCAT-1, controlsvirusentryandisstimulatedbyvirusbinding.JVirol.2 012,86 (3): 1421-32.).Being connected associated protein complex AP1 (adaptor-relatedproteincomplex1) can coupling tyrosine kinase signal, regulates endocytosis and Golgi transport function.Mitogen phosphorylated protein DAB (mitogen-responsivephosphoprotein) can regulate Ras signal path with receptor tyrosine kinase adaptin Grb2 effect is rear.The ubiquitination that CBL ubiquitin ligase can mediate albumen with multiple tyrosine phosphorylation molecular action is degraded.Ezrin albumen regulates cellular microtubules system by tyrosine kinase signal, then have adjusted cell adhesion and the physiological process such as to migrate; Ezrin albumen is also proved and take part in the hepatocellular process (BukongTN of infection with hepatitis C virus, KodysK, SzaboG.Humanezrin-moesin-radixinproteinsmodulatehepatiti sCvirusinfection.Hepatology.2013,58 (5): 1569-79.).
Tyrosine kinase FYN (FYNproto-oncogene, Srcfamilytyrosinekinase) non-receptor type Src family tyrosine kinase molecule (GeneAccession:NM_153048) is belonged to, wide expression in various histiocyte, especially high expressed in cerebral tissue.FYN participates in the process regulating various kinds of cell physiological function and cell carcinogenesis.Research finds that FYN also take part in the course of infection of multiple virus, as Coxsackie virus need activate FYN to complete effective invasion (CoyneCB when host cells infected, BergelsonJM.Virus-inducedAblandFYNkinasesignalspermitcox sackievirusentrythroughepithelialtightjunctions.Cell.200 6,124 (1): 119-31.).
The relevant adaptin (GeneAccession:NM_005864) that embryo FYN related substrates EFS (EmbryonalFYN-associatedsubstrate) is tyrosine kinase FYN it can mediate a series of intracellular signal transduction (DonlinLT in conjunction with the SH3 domain of Src family tyrosine kinase, RomanCA, AdlamM, etal.Defectivethymocytematurationbytransgenicexpressiono fatruncatedformoftheTlymphocyteadaptermoleculeandFYNsubs trate, Sin.JImmunol.2002, 169 (12): 6900-9.).The concrete functional study of this gene is relatively less, and the effect in virus infection has no report.
At present also without any infecting the research report acted in HBMEC at EV71 about FYN and EFS molecule, FYN and EFS molecule is carried out furtheing investigate the understanding that can not only promote EV71 infection and mechanism of causing a disease, also can infect for prevention and treatment EV71 the thinking and target spot that provide new.
Summary of the invention
The object of the present invention is to provide the novel targets that a kind of anti-enterovirns type 71 infects.
Another object of the present invention is to the novelty teabag that EFS molecule is provided, the application particularly in anti-enterovirns type 71 infects.
The third object of the present invention is to provide the interference EFS siRNA of developed by molecule.
Main technical schemes of the present invention is:
The present invention; using Human Brain Microvascular Endothelial (HBMEC) as target cell; RNA perturbation technique is adopted to lower the expression of target cell host protein; find the host factor that can effectively suppress EV71 to infect Human Brain Microvascular Endothelial (HBMEC), thus the function of protection blood brain barrier.This experimental selection one group of host cell tyrosine kinase and Molecular regulator thereof screen, these molecules host cell tyrosine kinase signal Signal Transduction Pathways regulate in play an important role, they be also often in virus infection easily by virus " abductions " and utilization molecule.These molecules comprise: adaptin AP1 (AP1M2), 2 type DAB albumen (DAB2), CBL ubiquitin ligase (CBL, CBLB, CBLC), tyrosine kinase FYN (FYN), Ezrin albumen (VIL2), ERC1 (ELKS), embryo FYN related substrates EFS (EFS), tyrosine kinase adaptin Grb2 (GRB2).Complete sequence and mRNA sequence is obtained by retrieval NCBIGeneBank, existing Internet resources and popular software is utilized to carry out biological analysis to these genes, select the target sequence that coding region is designed as siRNA, then siRNA is designed, by lowering these molecules, observe the impact that EV71 is infected.
We find that FYN and EFS molecule infects in HBMEC at EV71 and play an important role, and lower the expression of FYN or EFS molecule, obviously can suppress the infection of EV71.
A first aspect of the present invention, provides embryo FYN related substrates EFS (EmbryonalFYN-associatedsubstrate, EFS), i.e. the novel targets that infects as a kind of anti-enterovirns type 71 of the relevant adaptin EFS of protein tyrosine kinase FYN
A second aspect of the present invention, provides the application of embryo FYN related substrates EFS in preparation prevention or treatment enterovirns type 71 infection medicine.
Further, the present invention also provides the application of embryo FYN related substrates EFS in preparation prevention or treatment hand-foot-mouth disease medicine.
The application of embryo FYN related substrates EFS of the present invention in preparation prevention or treatment enterovirns type 71 infection medicine, and the application of embryo FYN related substrates EFS in preparation prevention or treatment hand-foot-mouth disease medicine, this medicine specifically refers to the reagent that can suppress or lower the expression of EFS molecule.
The reagent of the expression of described suppression or downward EFS molecule can be siRNA, shRNA, comprise the recombinant vector of siRNA, shRNA (as plasmid) etc.
A third aspect of the present invention, the invention provides the application of RNA interfering in preparation prevention or treatment enterovirns type 71 infection medicine of embryo FYN related substrates EFS molecule, and the application in preparation prevention or treatment hand-foot-mouth disease medicine, the sequence of described RNA interfering (siRNA) as following arbitrary shown in:
AUGGUGCAGUGUGUAACAGAA(SEQIDNO:16)、
GUAUGACUAUGUCCACCUGAA(SEQIDNO:17)、
CUGUACUUCUAUGCUGGGCAA(SEQIDNO:18)。
Wherein, lower the expression best results of EFS with the siRNA such as shown in SEQIDNO:18, and it is the most obvious to the infection of HBMEC cell to reduce EV71.
The present invention screens new host cell molecule FYN and the EFS molecule that EV71 can be suppressed to infect HBMEC cell.FYN or EFS molecular gene does not affect the normal physiological function of cell, but obviously inhibits EV71 to the infection of HBMEC cell after lowering.Therefore the anergy that the present invention infects because of EV71 the blood brain barrier caused for clinical prevention and treatment provides new target spot and therapeutic scheme.
Accompanying drawing explanation
Fig. 1 is that jamming effectiveness after the effective siRNA of transfection and cytotoxicity detect, and in figure, primary axis represents jamming effectiveness, and secondary axis represents Cytotoxic impact;
The HBMEC groups of cells (ghost group) of CTRL: any siRNA of not transfection;
The HBMEC groups of cells (negative control group) of NT: transfection non-targetingsiRNA;
SiRNA: transfection is for the HBMEC groups of cells (experimental group) of the siRNA of each genes of interest.
Fig. 2 is the impact infected EV71 after each host molecule of immuno-fluorescence assay is lowered, and wherein A lowers the fluorescence observation figure to viral infection after each molecule, and B lowers the suppression ratio figure to viral infection after each molecule.
The HBMEC groups of cells (ghost group) of CTRL: any siRNA of not transfection
The HBMEC groups of cells (negative control group) of NT: transfection non-targetingsiRNA
SiRNA: transfection is for the HBMEC groups of cells (experimental group) of the siRNA of each genes of interest
Fig. 3 is the impact infected EV71 after EFS lowers, and wherein A is the expression figure that WesternBlot detects EFS albumen, B is that the cytopathic effect figure observing EV71, C are for detecting EV71 virus spirogram.
The HBMEC groups of cells (ghost group) of CTRL: any siRNA of not transfection
The HBMEC groups of cells (negative control group) of NT-CTRL: transfection non-targetingsiRNA
EFS: transfection is for the HBMEC groups of cells of the siRNA (SEQIDNO:18) of EFS gene
Fig. 4 is the impact infected EV71 after FYN lowers, and wherein A is the expression figure that WesternBlot detects FYN albumen, B is that the cytopathic effect figure observing EV71, C are for detecting EV71 virus spirogram.
The HBMEC groups of cells (ghost group) of CTRL: any siRNA of not transfection
The HBMEC groups of cells (negative control group) of NT-CTRL: transfection non-targetingsiRNA
FYN: transfection is for the HBMEC groups of cells of the siRNA (SEQIDNO:22) of EFS gene
Fig. 5 is jamming effectiveness after the disturbance sequence of transfection EFS molecule and to the infective effect diagram of EV71, and A is the mRNA level in-site detection figure of EFS gene, B is EV71 virus quantity detection figure.
The HBMEC groups of cells (ghost group) of CTRL: any siRNA of not transfection
The HBMEC groups of cells (negative control group) of NT-CTRL: transfection non-targetingsiRNA
EFS-16: transfection is for the HBMEC groups of cells of the siRNA (SEQIDNO:16) of EFS gene
EFS-17: transfection is for the HBMEC groups of cells of the siRNA (SEQIDNO:17) of EFS gene
EFS-18: transfection is for the HBMEC groups of cells of the siRNA (SEQIDNO:18) of EFS gene
Fig. 6 is jamming effectiveness after the disturbance sequence of transfection FYN molecule and to the infective effect diagram of EV71, and A is the mRNA level in-site detection figure of FYN gene, B is EV71 virus quantity detection figure.
The HBMEC groups of cells (ghost group) of CTRL: any siRNA of not transfection
The HBMEC groups of cells (negative control group) of NT-CTRL: transfection non-targetingsiRNA
FYN-22: transfection is for the HBMEC groups of cells of the siRNA (SEQIDNO:22) of FYN gene
FYN-23: transfection is for the HBMEC groups of cells of the siRNA (SEQIDNO:23) of FYN gene
FYN-24: transfection is for the HBMEC groups of cells of the siRNA (SEQIDNO:24) of FYN gene
Detailed description of the invention
Now in conjunction with the embodiments and accompanying drawing, the present invention is described in detail, but enforcement of the present invention is not limited only to this.
Agents useful for same of the present invention and raw material all commercially maybe can be prepared by literature method.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as the people such as Sambrook " molecular cloning: lab guide " (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or conveniently condition, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise percentage ratio and number calculate by weight.
Embodiment 1:
1 design, synthesize the specific siRNA sequence of each host cellular molecules.
1.1 for each genes of interest, and retrieval NCBIGeneBank obtains complete sequence and mRNA sequence, utilizes existing Internet resources and popular software to carry out biological analysis to each genes of interest, selects the target sequence that coding region is designed as siRNA.With reference to siRNA design principle, and contrasted by the blast function of GeneBank data base and human genomic sequence, guarantee without homology; Get rid of 5 ' the potential siRNA holding continuous 8 bases and other gene to match of aitisense chain; Get rid of the potential siRNA that any one section continuous 14 bases and other gene match.And utilize design software to carry out Pre-Evaluation mensuration, select 3 best kinetic parameter target spots to enter subsequent experimental flow process, each gene synthesizes 3 interference sequences altogether, in table 1.
Synthesis and the purification of 1.2 strand siRNA are completed by Invitrogen company.
The design of table 1.siRNA target spot
2siRNA sequence screening and interference effect are identified
2.1RNA transfection
Transfection procedure is with reference to Lipofectamine2000 description
1) within 12-16 hour in advance, by HBMEC cell, (purchased from Sciencell, preserving number: 1000) be layered on 24 porocyte culture plates and cultivate, when making transfection, cell density is 80%-90%.
2) get 2 μ LLipofectamine2000 and add also soft mixing in 50 μ Lopti-MEM, incubated at room 5 minutes; Separately getting 5 μ L concentration is that the RNA interfering of 5 μMs and 50 μ Lopti-MEM mix.After hatching end, the Lipofectamine2000 transfection reagent of dilution is added in the RNA of dilution, and soft pressure-vaccum mixing.After incubated at room 20min, add in HBMEC cell, add 400 μ Lopti-MEM, make RNA final concentration be 50nM.
3) within after transfection 6-8 hour, change containing dual anti-fresh culture.
2.2 real-time fluorescence quantitative PCRs (RT-PCR) detect the mRNA level in-site of each host molecule
1) TRIzol extracts the total serum IgE of matched group and interference group cell, and concrete steps are as follows:
Transfection, after 48 hours, goes culture supernatant, in cell, add 1mlTRIzol, abundant mixed room temperature cell lysis 3-5 minute.Add the chloroform of 1/5 volume, manually violent mixing 15 seconds.In 4 DEG C, 12,000 leaves the heart 15 minutes.Get upper strata aqueous phase and transfer in new EP pipe, adding equal-volume isopropyl alcohol, fully mix, precipitation at room temperature 10 minutes.In 4 DEG C, 12,000 leaves the heart 10 minutes.Abandon supernatant, add 75% ethanol of 1ml pre-cooling.In 4 DEG C, 12,000 centrifugal 5 minutes.Fully abandon supernatant, room temperature dries RNA precipitation, adds DEPC process water dissolution precipitation, obtains total serum IgE.
2) utilize takara Reverse Transcription box to obtain the cDNA of matched group and interference group cell, concrete steps are as follows:
Following reaction system is added in PCR pipe,
5×PrimeScriptBuffer2μL
PrimeScriptRTEnzymeMix0.5μL
Random6mers0.5μL
TotalRNA500ng
RnaseFreedH
2Oupto10μL
Soft mixing mixing, is placed in 37 DEG C of reactions 15 minutes, is then placed in 85 DEG C of heating deactivation in 5 seconds reverse transcriptases.
3) fluorescence quantitative RT-RCR detects
Utilize the SYBRPremixExTaq test kit of takara to react, reaction system is as follows,
SYBRPremixExTaq10μL
Utilize RotorGene3000A instrument to carry out two-step method amplification, 95 DEG C of denaturation 2min, carry out 40 PCR circulation, 95 DEG C 5 seconds, 60 DEG C 30 seconds.
3 cytotoxicity experiments
The impact of on cell proliferation after employing CCK-8 method detection transfection siRNA, concrete steps are as follows:
Collect exponential phase cell, be inoculated in 96 orifice plates with the density in 3000, every hole.After cell pellet overnight is adherent, each siRNA of transfection, cultivates and detects cell proliferative conditions after 48 hours.Discard original culture medium, every hole adds the fresh culture 110 μ L containing 10 μ LCCK-8, to cultivate after 3h by multi-functional microplate reader at 450nm wavelength detecting each hole absorbance.Experiment is independent to be repeated 3 times, calculating mean value.
4EV71 viral infection HBMEC cell
The EV71 viral infection experiment of 4.1HBMEC cell
After HBMEC cell transfecting RNA 72 hours, carry out the experiment of EV71 viral infection.By culture supernatant sucking-off, with pre-temperature PBS rinse 2 times, with the virus quantity of MOI=0.1 inoculation EV71,37 DEG C hatch 2h after discard virus liquid, and with pre-temperature PBS rinse 3 times, add fresh culture and continue to cultivate.
4.2 immunofluorescence dyeings detect EV71 antigen presentation
Continue after HBMEC cell infection virus to cultivate 48h, adopt the expression of immuno-fluorescence assay virus antigen, concrete steps are as follows:
1) cell is fixed: removed by the culture fluid in 96 orifice plates, and add PBS and clean cell 2 times, every hole adds the pre-cold methanol of 100 μ l, under-20 DEG C of conditions, fix 20min, cleans cell 3 times with the PBS of pre-cooling.
2) permeable membrane: the cell per well after fixing adds 100 μ l0.1%TritonX-100, incubated at room 15min, washs 3 times with pre-cooling PBS.
3) close: every hole adds 100 μ l3%BSA, in incubated at room temperature 1h.
4) primary antibodie is hatched: every hole adds EV71 specific murine source monoclonal antibody 10F0 (1:2000 dilution) 100 μ l, incubated at room 1h, washs 3 times with the PBS of pre-cooling.
5) two anti-to hatch: every hole adds AF488 fluorescent labeling against murine IgG (1:1000 dilution) 100 μ l, and room temperature lucifuge hatches 1h, washs 2 times by the PBS lucifuge of pre-cooling.
6) labeled cell core: every hole adds nucleus fluorescent dye DAPI (1:5000, PBS dilute), and room temperature lucifuge hatches 15min, washs 3 times by the PBS lucifuge of pre-cooling.
7) detect under fluorescence microscope and calculate green AF488 positive cell clone number.
4.3 protein immunoblot.
(1) total protein of matched group and ARF6 interference group HBMEC cell is extracted respectively with protein lysate.
(2) respectively 30ug albumen is added to electrophoresis in the polyacrylamide gel of 12.5% concentration after quantification of protein, and intercepts respective strap electroporation and forward on pvdf membrane.
(3) non-specific sites of albumen is closed with the skim milk of 5%, and then close by specificity primary antibodie, 4 DEG C are spent the night, and wash three times, wash away primary antibodie with TBST buffer.
(4) then use two of HRP labelling anti-incubated at room 2 hours, then wash three times with TBST buffer.
(5) last, utilize nitrite ion to develop the color and photographic analysis.
4.4RT-PCR detects EV71 virus quantity in cell
Continue after HBMEC cell infection virus to cultivate 48h, adopt TRIzol to extract the total serum IgE of matched group and interference group cell, and reverse transcription obtains cDNA, detect EV71 virus quantity by RT-PCR.Concrete steps are with shown in 2.2.
Experimental result:
1 design, synthesize and screen effective siRNA
For each genes of interest sequence, we devise multiple RNA interfered target sequence, and utilize design software to carry out Pre-Evaluation mensuration, select 3 best kinetic parameter target spots to enter subsequent experimental flow process, each gene synthesizes 3 interference sequences altogether, as shown in table 1.
Adopt the method for in-vitro transfection, the RNA interfering of each gene is transfected in HBMEC cell and goes, detected the jamming effectiveness of each RNA interfering after 48h by RT-PCR method, the siRNA sequence that finishing screen chooses interference effect the best carries out subsequent experimental, and its jamming effectiveness is as shown in table 2.
Table 2RT-PCR method detects siRNA interference sequence to the downward efficiency of relevant host gene
Note: CTRL: the HBMEC groups of cells (ghost group) of any siRNA of not transfection
The HBMEC groups of cells (negative control group) of NT: transfection non-targetingsiRNA
SiRNA: transfection is for the HBMEC groups of cells (experimental group) of the siRNA of each genes of interest.
Jamming effectiveness after 2siRNA interference and cytotoxicity detect
The effective siRNA transfection HBMEC cell for each host molecule picked out, after transfection, 48h detects the jamming effectiveness of each RNA interfering by RT-PCR method, on the Cytotoxic impact of HBMEC after employing CCK8 detection transfection simultaneously.
As shown in Figure 1, the effective siRNA group of transfection, compared with CTRL group, obviously can suppress the expression (P < 0.01) of corresponding gene to result after each siRNA of transfection.Cytotoxicity experiment shows, does not produce obvious cytotoxicity (P > 0.05), do not have an impact, can be used for subsequent experimental to the normal physiological function of cell after each siRNA transfection.
Impact on EV71 viral infection after 3siRNA interference
After effective siRNA of each host molecule of transfection lowers the expression of host cell correlation molecule, infect the EV71 virus of same dose, after infecting 48h, the impact after adopting each host molecule of immuno-fluorescence assay to lower, EV71 infected, find compared with matched group, after transfection EFSsiRNA (SEQIDNO:18) and transfection FYNsiRNA (SEQIDNO:22) makes EFS and FYN gene deregulation respectively, significantly reduce the infection (Fig. 2 A) of EV71 to HBMEC cell.Find by calculating virus quantity, after 77%, FYN gene deregulation being reached to the suppression ratio of virus after EFS gene deregulation, 86% and the downward of all the other molecules does not obviously suppress EV71 to infection (P > 0.05) (Fig. 2 B) of HBMEC cell is reached to the suppression ratio of virus.
For the inhibitory action that clear and definite EFS infects EV71, after transfection EFS molecule siRNA, detected the expression of EFS protein molecular by immunoblotting, and after infection EV71 observation of cell pathological changes situation, and detect EV71 virus quantity by RT-PCR.Result shows, and after transfection EFS molecule siRNA (SEQIDNO:18), obviously can suppress the expression (Fig. 3 A) finding EFS protein molecular.Compared with matched group, after EFS protein expression is lowered, can T suppression cell pathological changes and virus quantity in HBMEC cell also significantly decline (Fig. 3 B, C), consistent with immuno-fluorescence assay result.These results show, compared with compared with control cells, after lowering EFS gene, the infection ability of EV71 to HBMEC cell obviously declines, and virus quantity reduces.
Further, the siRNA of transfection three EFS molecules observes the impact on viral infection respectively.Result shows the downward efficiency difference (Fig. 4 A) of different siRNA to EFS molecule, and wherein the jamming effectiveness of siRNA (SEQIDNO:18) is the highest, consistent with result above.After detecting interference, the infective impact of EV71 is found, article three, the siRNA of EFS molecule all can reach more than 60% to the suppression ratio of viral infection, and increasing along with the downward efficiency to EFS molecule, also raising (Fig. 4 B) to the suppression ratio that EV71 infects, prompting EFS molecule infects the important function in HBMEC at EV71.Therefore, EFS can be used as and suppresses EV71 to new host's target spot of HBMEC cell infection.
For the inhibitory action that clear and definite FYN infects EV71, after transfection FYN molecule siRNA, detected the expression of FYN protein molecular by immunoblotting, and after infection EV71 observation of cell pathological changes situation, and detect EV71 virus quantity by RT-PCR.Result shows, and after transfection FYN molecule siRNA (SEQIDNO:22), obviously can suppress the expression (Fig. 5 A) finding FYN protein molecular.Compared with matched group, after FYN protein expression is lowered, can T suppression cell pathological changes and virus quantity in HBMEC cell also significantly decline (Fig. 5 B), consistent with immuno-fluorescence assay result.These results show, compared with compared with control cells, after lowering FYN gene, the infection ability of EV71 to HBMEC cell obviously declines, and virus quantity reduces.
Further, the siRNA of transfection three FYN molecules observes the impact on viral infection respectively.Result shows the downward efficiency difference (Fig. 6 A) of different siRNA to FYN molecule, and wherein the jamming effectiveness of siRNA (SEQIDNO:22) is the highest, consistent with result above.After detecting interference, the infective impact of EV71 is found, article three, the siRNA of FYN molecule all can reach more than 60% to the suppression ratio of viral infection, and increasing along with the downward efficiency to FYN molecule, also raising (Fig. 6 B) to the suppression ratio that EV71 infects, prompting FYN molecule infects the important function in HBMEC at EV71.Therefore, FYN can be used as and suppresses EV71 to new host's target spot of HBMEC cell infection.
By above the results show: the present invention screens new host cellular molecules FYN and EFS that EV71 can be suppressed to infect HBMEC cell.After FYN or EFS gene deregulation, do not affect the normal physiological function of cell, but obviously inhibit EV71 to the infection of HBMEC cell.Therefore the anergy that the present invention infects because of EV71 the blood brain barrier caused for clinical prevention and treatment provides new target spot and therapeutic scheme.
Below the preferred embodiment of the invention is illustrated, but the invention is not limited to described embodiment, those of ordinary skill in the art also can make all equivalent modification or replacement under the prerequisite without prejudice to the invention spirit, and these equivalent modification or replacement are all included in the application's claim limited range.
Claims (8)
1. the application of embryo FYN related substrates EFS in preparation prevention or treatment enterovirns type 71 infection medicine.
2. the application of embryo FYN related substrates EFS in preparation prevention or treatment hand-foot-mouth disease medicine.
3. the application of embryo FYN related substrates EFS according to claim 1 in preparation prevention or treatment enterovirns type 71 infection medicine, it is characterized in that, described medicine refers to the reagent that can suppress or lower EFS expression.
4. the application of embryo FYN related substrates EFS according to claim 3 in preparation prevention or treatment enterovirns type 71 infection medicine, it is characterized in that, the described reagent that can suppress or lower EFS expression is siRNA, shRNA of EFS or comprises the recombinant vector of siRNA, shRNA.
5. the application of embryo FYN related substrates EFS according to claim 1 in preparation prevention or treatment enterovirns type 71 infection medicine, it is characterized in that, described medicine is the RNA interfering of EFS, and the sequence of described RNA interfering is selected from following arbitrary:
AUGGUGCAGUGUGUAACAGAA(SEQIDNO:16)、
GUAUGACUAUGUCCACCUGAA(SEQIDNO:17)、
CUGUACUUCUAUGCUGGGCAA(SEQIDNO:18)。
6. the application of embryo FYN related substrates EFS according to claim 2 in preparation prevention or treatment hand-foot-mouth disease medicine, it is characterized in that, described medicine refers to the reagent that can suppress or lower EFS expression.
7. the application of embryo FYN related substrates EFS according to claim 6 in preparation prevention or treatment hand-foot-mouth disease medicine, it is characterized in that, the described reagent that can suppress or lower EFS expression is siRNA, shRNA of EFS or comprises the recombinant vector of siRNA, shRNA.
8. the application of embryo FYN related substrates EFS according to claim 2 in preparation prevention or treatment hand-foot-mouth disease medicine, it is characterized in that, described medicine is the RNA interfering of EFS, and the sequence of described RNA interfering is selected from following arbitrary:
AUGGUGCAGUGUGUAACAGAA(SEQIDNO:16)、
GUAUGACUAUGUCCACCUGAA(SEQIDNO:17)、
CUGUACUUCUAUGCUGGGCAA(SEQIDNO:18)。
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510033902.XA CN105311645B (en) | 2015-01-23 | 2015-01-23 | Application of the embryo FYN related substrates EFS in prevention and treatment enterovirns type 71 infection |
| PCT/CN2016/000032 WO2016115973A1 (en) | 2015-01-21 | 2016-01-19 | Application of a group of transmembrane transport related molecules in preventing and treating enterovirus 71 infection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510033902.XA CN105311645B (en) | 2015-01-23 | 2015-01-23 | Application of the embryo FYN related substrates EFS in prevention and treatment enterovirns type 71 infection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105311645A true CN105311645A (en) | 2016-02-10 |
| CN105311645B CN105311645B (en) | 2018-11-30 |
Family
ID=55240598
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510033902.XA Active CN105311645B (en) | 2015-01-21 | 2015-01-23 | Application of the embryo FYN related substrates EFS in prevention and treatment enterovirns type 71 infection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105311645B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001045751A1 (en) * | 1999-12-22 | 2001-06-28 | The Scripps Research Institute | Angiogenesis and vascular permeability modulators and inhibitors |
| CN101402944A (en) * | 2008-11-17 | 2009-04-08 | 中国医学科学院医学生物学研究所 | EV-71 virus seed, inactivated vaccine for human and method of producing the same |
-
2015
- 2015-01-23 CN CN201510033902.XA patent/CN105311645B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001045751A1 (en) * | 1999-12-22 | 2001-06-28 | The Scripps Research Institute | Angiogenesis and vascular permeability modulators and inhibitors |
| CN101402944A (en) * | 2008-11-17 | 2009-04-08 | 中国医学科学院医学生物学研究所 | EV-71 virus seed, inactivated vaccine for human and method of producing the same |
Non-Patent Citations (3)
| Title |
|---|
| CAROLYN B.COYNE等: "Virus-Induced Abl and Fyn Kinase Signals Permit Coxsackievirus Entry through Epithelial Tight Junctions", 《CELL》 * |
| LAURA T.DONLIN等: ""Defective Thymocyte Maturation by Transgenic Expression of a Truncated Form of the T Lymphocyte Adapter Molecule and Fyn Substrate,Sin", 《THE JOURNAL OF IMMUNOLOGY》 * |
| 罗文英等: "肠道病毒71型感染人脑微血管内皮细胞的初步研究", 《第二军医大学学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105311645B (en) | 2018-11-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Burdette et al. | Hepatitis C virus activates interleukin-1β via caspase-1-inflammasome complex | |
| TWI609690B (en) | Use of alphavirus for preparing anti-cancer drug | |
| Hsieh et al. | Rosmarinic acid exhibits broad anti-enterovirus A71 activity by inhibiting the interaction between the five-fold axis of capsid VP1 and cognate sulfated receptors | |
| WO2018033126A1 (en) | Use of vcp inhibitor and oncolytic virus in the preparation of an anti-tumor drug | |
| CN114025785B (en) | Diagnosis and treatment of chronic inflammation and viral infection | |
| Krishnan et al. | NLRC3 attenuates antiviral immunity and activates inflammasome responses in primary grouper brain cells following nervous necrosis virus infection | |
| CN105535975A (en) | Applications of vesicle-associated membrane protein 1 in prevention and treatment of enterovirus 71 infection | |
| CN105267948B (en) | Application of the tyrosine kinase substrate that hepatocyte growth factor is adjusted in preparation prevention and treatment enterovirns type 71 infection medicine | |
| CN105435246B (en) | Application of the autophagy correlated protein 12 in prevention and treatment enterovirns type 71 infection | |
| CN105311647A (en) | Application of Cofilin in preventing and treating Japanese encephalitis virus infection | |
| CN105288654A (en) | Application of protein tyrosine kinase FYN proto-oncogene in controlling enterovirus 71 infections | |
| CN105288655B (en) | Application of the vacuole sorting protein 4A in preparation prevention and treatment enterovirns type 71 infection medicine | |
| CN105267984B (en) | Application of the ADP ribosylation factor 6 in prevention and treatment enterovirns type 71 infection | |
| CN105687197B (en) | Epidermal growth factor receptor inhibitor is preparing the application in treating encephalitis B drug | |
| CN105311645A (en) | Application of embryo FYN related substrate EFS in prevention and treatment of enterovirus 71 type infection | |
| CN105435245B (en) | Application of the calcium integrin Binding Protein 1 in prevention and treatment enterovirns type 71 infection | |
| CN105497918A (en) | Application of dynamin 1 in prevention and treatment on enterovirus type 71 infection | |
| CN105267985B (en) | Application of the n-ethylmaleimide sensitive factor in prevention japanese encephalitis virus infection | |
| CN103520703A (en) | Application of eIF6 in detection, prevention or treatment of exercise-induced fatigue or memory loss | |
| CN105311646B (en) | Application of the ezrin in prevention and treatment japanese encephalitis virus infection | |
| CN105497874A (en) | Application of sorting nexin 1 in prevention and treatment on enterovirus type 71 infection | |
| Yu et al. | Regulation of host factor γ-H2AX level and location by enterovirus A71 for viral replication | |
| WO2016115973A1 (en) | Application of a group of transmembrane transport related molecules in preventing and treating enterovirus 71 infection | |
| CN116042614A (en) | Application of RhoD inhibitor in preventing and treating Zika virus infection | |
| Zhou et al. | The in vitro and in vivo antiviral effects of aloperine against Zika virus infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |