WO2016115973A1

WO2016115973A1 - Application of a group of transmembrane transport related molecules in preventing and treating enterovirus 71 infection

Info

Publication number: WO2016115973A1
Application number: PCT/CN2016/000032
Authority: WO
Inventors: 朱勇喆; 戚中田; 徐庆强; 赵平; 陈生林
Original assignee: 中国人民解放军第二军医大学
Priority date: 2015-01-21
Filing date: 2016-01-19
Publication date: 2016-07-28

Abstract

A new target of anti-enterovirus 71 interference and application thereof are provided. Using human brain microvascular endothelial cells (HBMEC) as target cells, and using RNA interference technology for down-regulating expression of ADP ribosylation factor 6, protein tyrosine kinase FYN oncogene and embryonal FYN-associated substrate EFS in target cell hosts, can significantly inhibit enterovirus 71 infection. Application of ADP ribosylation factor 6, protein tyrosine kinase FYN oncogene, embryonal FYN-associated substrate EFS in preparation of medicine for preventing or treating enterovirus 71 infection is also provided.

Description

Application of a group of transmembrane transport related molecules in the prevention and treatment of enterovirus 71 infection

Technical field

The invention relates to the field of biomedical technology and is a new target and application for infection of enterovirus 71 type.

Background technique

Enterovirus 71 (EV71) belongs to the small enterovirus class A virus, which is one of the main pathogens causing hand-foot-mouth disease (HFMD). At present, hand, foot and mouth disease has been outbreaking and prevalent in many parts of the world, especially in the Asia-Pacific region. In China, since the outbreak of hand, foot and mouth disease in several major provinces and cities in 2008, the number of infections and mortality of this disease has been high, with more than 1 million cases reported each year and nearly 1,000 deaths. The main target population of hand, foot and mouth disease is infants under 5 years old. The clinical manifestations are fever, and herpes, such as hands, feet, buttocks and oral mucosa, appear. A small number of children can develop severe disease and central nervous system. , CNS) lesions, including aseptic meningitis, brainstem encephalitis, encephalomyelitis, and neurogenic pulmonary edema, are a serious threat to the health of infants and young children [Solomon T1, Lewthwaite P, Perera D, Cardosa MJ, McMinn P, Ooi MH. Virology, epidemiology, pathogenesis, and control of enterovirus 71. Lancet Infect Dis. 2010 Nov; 10(11): 778-90.]. Hand, foot and mouth disease, especially in severe cases, is mostly caused by enterovirus 71 (EV71) infection. However, at present, there is no specific and effective antiviral drug for the treatment of hand, foot and mouth disease caused by EV71. Clinically, symptomatic treatment is still the main treatment, and no effective vaccine is available in prevention.

EV71 infection is neurotropic and can cause serious CNS disease and its complications, which is also the main cause of the development of severe disease and even death in patients with hand, foot and mouth disease. Among them, the brainstem is the most susceptible to infection by EV71 [Tee, KK, et al. Evolutionary genetics of human enterovirus 71: origin, population dynamics, natural selection, and seasonal periodicity of the VP1gene. J Virol, 2010.84 (7): P.3339-50.], the study confirmed that the presence of EV71 gene and antigen in the brainstem neurons of patients with severe EV71 can prove that EV71 can enter the CNS. EV71 infection through the blood circulation of the CNS needs to cross the blood-brain barrier, but the mechanism by which the virus crosses the blood-brain barrier to invade the CNS is unclear. The Blood Brain Barrier (BBB) is a major barrier between the circulatory system and the central nervous system. It restricts the free transport of different substances between the two sites, maintains the homeostasis of the CNS and protects the CNS. It plays a crucial role in the invasion of pathogenic microorganisms [Dyrna F, Hanske S, Krueger M, Bechmann I. The blood-brain barrier. J Neuroyimune Pharmacol. 2013; 8(4): 763-73.]. The blood-brain barrier is a cell complex composed of a non-porous brain microvascular endothelial cell and a tight junction between them, astrocyte foot process, cell basement membrane and pericytes. In this cell complex, the most important material structure is based on Brain Microvascular Endothelial Cells (BMECs) and their tight junctions. The loss of stringency is considered to be an important cause of brain tissue damage caused by viral infection. Therefore, to explore the mechanism of EV71 infection of BMECs and to find new anti-viral targets is essential for protecting the blood-brain barrier and preventing central nervous system infection caused by EV71.

In order to effectively infect cells, the virus must use the membrane molecules of the host cell and its vesicle transport system to complete the host. Invasion of cells allows for replication within the cell and release of infectious progeny virus particles. Therefore, as the primary link of viral infection of host cells, cell invasion has become an important target for antiviral drug screening. Studies have shown that EV71 can invade different types of target cells using different host factors and infection pathways, such as EV71, which infects human rhabdomyosarcoma (RD) by clathrin-mediated endocytosis [Yamayoshi] [Yamayoshi] , S., et al., Scavenger receptor B2 is a cellular receptor for enterovirus 71. Nat Med, 2009. 15 (7): p. 798-801.]; while the infected Jurkat T lymphocyte line mainly utilizes nest-dependent endocytosis Cacaol-dependent endocytosis [Lin HY, Yang YT, Yu SL, et al. Caveolar endocytosis is required for human PSGL-1-mediated enterovirus 71 infection. J Virol. 2013, 87(16): 9064-76.] . At present, the pathways and mechanisms of EV71 infection of BMECs remain unclear.

The invasion of the target cells by the virus mainly relies on the key molecules involved in the transport of the host cells themselves. These host cell membrane transport molecules play an important role in the transport of transmembrane substances, vesicle formation, endocytosis and secretion. For example, metalloproteinase regulates cell adhesion and degradation of cell membrane molecules; clathrin is mainly responsible for receptor-mediated endocytosis; caveolin family molecules caveolin-1 (CAV1), caveolin-2 (CAV2) , caveolin-3 (CAV3) transports the substance to the Golgi apparatus; Flotillin molecules can interact with the lipid raft protein molecules and endocytose into the cells; ADP ribosylation factor 6 molecules are involved in mediating plasma membrane transport and intracellular actin Assembly; GTPase-activating protein molecule GRAF1 plays an important regulatory role in clathrin-independent vesicle trafficking; interleukin-2 receptor endocytosis regulates signaling pathways and affects cell proliferation (Jason Mercer, Mario Schelhaas, Et al. Virus Entry by Endocytosis. Annu Rev Biochem. 2010; 79: 803-833.). Among these molecules, caveolin-1 and clathrin were confirmed to be involved in the process of EV71 infection of Jurkat T lymphocytes and RD cells, respectively, and the role of other molecules in EV71 infection has not been reported.

ADP ribosylation factor 6 (ARF6) is a small molecule GTP-binding protein in the Ras superfamily. It belongs to the ARF subfamily and is located on the plasma membrane and endosomal membrane. It is mainly involved in the regulation of plasma membrane transport and cell. Internal actin assembly involves a variety of physiological functions (Gillingham AK1, Munro S. The small G proteins of the Arf family and their regulators. Annu Rev Cell Dev Biol. 2007; 23: 579-611.). In recent years, studies have also found that ARF6 molecules play an important role in the process of viral infection.

O et al. found that ARF6 molecules regulate Coxsackievirus A9-infected host cells (

O1, Susi P, Tevaluoto T,

H,

V,

T, Kiljunen S. Internalization of coxsackievirus A9 is mediated by {beta}2-microglobulin, dynamin, and Arf6 but not by caveolin-1 or clathrin. J Virol. 2010;84(7):3666-81.). Human rhabdomyosarcoma RD cells are sensitive cell lines of EV71. However, Khairunnisa et al. found that ARF6 molecules did not affect EV71 infection of RD cells by genomic library screening (Hussain KM1, Leong KL, Ng MM, Chu JJ. The essential role of clathrin- Medired endocytosis in the infectious entry of human enterovirus 71. J Biol Chem. 2011;286(1):309-21.).

A wide range of host cell signaling pathways are activated during viral infection of host cells. These signaling pathways can be used by viruses to achieve effective life processes such as invasion, replication, and release of the virus itself. As the research progresses, these signal kinase molecules utilized by viruses have become important targets for antiviral therapy. Studies have shown that EV71 infection requires the use of multiple signaling pathways and their regulatory systems, such as the activation of Rho family molecules to regulate the cytoskeletal system and promote viral invasion (Hussain KM1, Leong KL, Ng MM, after early infection and receptor action). Chu JJ.The Essential role of clathrin-mediated endocytosis in the infectious entry of human enterovirus 71.J Biol Chem.2011;286(1):309-21.); activation of PI3K/Akt and MAPK/ERK signaling pathways to promote further proliferation and initiation of the virus Inflammatory response; induces apoptosis by stimulating the cyclin dependent kinase 5 (Cdk5) pathway (Tung WH, Hsieh HL, Yang CM. Enterovirus 71 induces COX-2 expression via MAPKs, NF-kappaB , and AP-1 in SK-N-SH cells: Role of PGE (2) in viral replication. Cell Signal. 2010, 22(2): 234-46.). However, the current signaling pathways involved in EV71 infection with BMECs and the signaling regulators utilized are still unclear.

Protein tyrosine kinase (PTK) and its regulatory molecules are important cell signal transduction kinases that regulate a variety of cellular physiological functions and have also been shown to be involved in the regulation of infection by various viruses on host cells (Pelkmans). L, Fava E, Grabner H, Hannus M, et al. Genome-wide analysis of human kinases in clathrin-and caveolae/raft-mediated endocytosis. Nature. 2005, 436 (7047): 78-86.). For example, the receptor tyrosine kinase adaptor protein Grb2 mainly regulates the downstream signaling ERK pathway and the PI3K/Akt pathway, and is involved in the regulation of the infection process of murine leukemia virus MLV (Chen Z, Kolokoltsov AA, Wang J, et al. GRB2 interaction with the ecotropic Murine leukemia virus receptor, mCAT-1, controls virus entry and is stimulated by virus binding. J Virol. 2012, 86(3): 1421-32.). The adaptor-related protein complex (AP1) can couple tyrosine kinase signals and regulate endocytosis and Golgi transport functions. The mitogen-responsive phosphoprotein (DAB) regulates the Ras signaling pathway by interacting with the receptor tyrosine kinase adaptor protein Grb2. CBL ubiquitin ligase is capable of mediating ubiquitination degradation of proteins with a variety of tyrosine phosphorylation molecules. Ezrin protein regulates the cellular microtubule system through tyrosine kinase signaling, which in turn regulates physiological processes such as cell adhesion and migration; Ezrin protein has also been shown to be involved in the process of hepatitis C virus infection of hepatocytes (Bukong TN, Kodys K, Szabo G. Human ezrin-moesin-radixin proteins modulate hepatitis C virus infection. Hepatology. 2013, 58(5): 1569-79.).

The FYN proto-oncogene (Src family tyrosine kinase) belongs to the non-receptor type Src family tyrosine kinase molecule (GeneAccession: NM_153048) and is widely expressed in various tissue cells, especially in the brain. High expression in tissues. FYN is involved in the regulation of a variety of cellular physiological functions as well as cellular carcinogenesis. The study found that FYN is also involved in the infection of a variety of viruses, such as Coxsackie virus in the activation of host cells to activate FYN to complete effective invasion (Coyne CB, Bergelson JM. Virus-induced Abl and FYN kinase signals permit coxsackievirus entry through epithelial Tight junctions. Cell. 2006, 124(1): 119-31.).

The embryonic FYN-associated substrate EFS (Embryonal FYN-associated substrate) is a related adaptor protein of tyrosine kinase FYN (GeneAccession: NM_005864), which binds to the SH3 domain of the Src family tyrosine kinase and mediates a series of intracellular Signal transduction (Donlin LT, Roman CA, Adlam M, et al. Defective thymocyte maturation by transgenic expression of a truncated form of the T lymphocyte adapter molecule and FYN substrate, Sin. J Immunol. 2002, 169(12): 6900- 9.). The specific functional studies of this gene are relatively rare, and the role in the process of viral infection has not been reported.

At present, there is no report on the role of ARF6, FYN and EFS in HBVEC infection. The in-depth study of this molecule can not only improve the understanding of EV71 infection and pathogenesis, but also provide new ideas for the prevention and treatment of EV71 infection. With the target.

Summary of the invention

It is an object of the present invention to provide new targets for infection with enterovirus type 71.

Another object of the present invention is to provide ADP ribosylation factor 6 (ARF6), FYN proto-oncogene (Frc proto-oncogene, Src family tyrosine kinase), and embryonic FYN-related substrate EFS ( Embryonal FYN-associated substrate) The new use of molecules, especially in the treatment of enterovirus 71 infection.

A third object of the present invention is to provide an siRNA that interferes with the expression of ARF6, FYN, EFS.

The main technical solutions of the present invention are:

In the present invention, human brain microvascular endothelial cells (HBMEC) are used as target cells, and RNA interference technology is used to down-regulate the expression of target host protein to find a host factor which can effectively inhibit human brain microvascular endothelial cells (HBMEC) infected by EV71, thereby protecting blood. The function of the brain barrier. In this experiment, a group of host cell transmembrane transporters and transmembrane transport signaling regulators were selected for screening. These molecules are transported in the transmembrane of host cells, endocytosis and secretion of vesicles, and tyrosine kinase signal transduction pathways. Regulation plays an important role, and they are often molecules that are easily hijacked and utilized by viruses during viral infection. These include: ADAM metalloproteinase (ADAM10), ADP ribosylation factor 6 (ARF6), caveolin-1 (CAV1), caveolin-2 (CAV2), caveolin-3 (CAV3), clathrin light chain A (CLTA) ), clathrin light chain B (CLTB), clathrin heavy chain (CLTC), Flotillin protein 1 (FLOT1), Flotillin protein 2 (FLOT2), GTPase activator protein (GRAF1), interleukin 2 receptor ( IL2RB), synaptotagmin 1 (SYT1), synaptotagin 2 (SYT2), adaptor protein AP1 (AP1M2), type 2 DAB protein (DAB2), CBL ubiquitin ligase (CBL, CBLB, CBLC), casein Acid kinase FYN (FYN), Ezrin protein (VIL2), ERC1 (ELKS), embryonic FYN-related substrate EFS (EFS), tyrosine kinase adaptor protein Grb2 (GRB2). The complete sequence and mRNA sequences were obtained by searching NCBI GeneBank, and the genes were analyzed by using existing network resources and common software. The coding region was selected as the target sequence designed by siRNA, then siRNA was designed, and these molecules were down-regulated to observe the pair. The impact of EV71 infection.

We found ADP ribosylation factor 6, ARF6, FYN proto-oncogene, Src family tyrosine kinase, Embryon FYN-associated substrate It plays an important role in HBV infection of EV71. Down-regulation of ARF6, FYN or EFS expression can significantly inhibit EV71 infection.

In a first aspect of the invention, ADP ribosylation factor 6 (ARF6), a protein tyrosine kinase FYN oncogene (FYN), and an embryonic FYN-related substrate EFS are provided as novel targets for infection against enterovirus 71.

In a second aspect of the present invention, there is provided ADP ribosylation factor 6 (ARF6), a protein tyrosine kinase FYN oncogene (FYN), and an embryonic FYN-related substrate EFS for the preparation of a medicament for preventing or treating enterovirus 71 infection. Applications.

Further, the present invention also provides the use of ADP ribosylation factor 6 (ARF6), protein tyrosine kinase FYN oncogene (FYN), and embryonic FYN-related substrate EFS for the preparation of a medicament for preventing or treating hand, foot and mouth disease.

The use of ADP ribosylation factor 6 (ARF6), protein tyrosine kinase FYN oncogene (FYN), and embryonic FYN-related substrate EFS according to the present invention for preparing a medicament for preventing or treating enterovirus 71 infection The drug specifically refers to an agent capable of inhibiting or down-regulating the expression levels of ARF6, FYN, and EFS.

The reagent for inhibiting down-regulation of the expression levels of ARF6, FYN, and EFS may be siRNA, shRNA, a recombinant vector (such as a plasmid) containing siRNA, shRNA, or the like.

In a third aspect of the invention, the present invention provides the use of interfering RNA of ADP ribosylation factor 6 (ARF6) for the preparation of a medicament for preventing or treating enterovirus 71 infection, or ADP ribosylation factor 6 in the preparation of prophylaxis or For the treatment of hand, foot and mouth disease drugs, the drug is interfering RNA (siRNA), and its sequence is as follows:

GCUCACAUGGUUAACCUCUAA (SEQ ID NO: 4)

GUCAAGUUCAACGUAUGGGAU (SEQ ID NO: 5)

GCAUUAUCAAUGACCGGGAGA (SEQ ID NO: 6)

Among them, the expression of ARF6 was down-regulated by siRNA as shown in SEQ ID NO: 4, and the infection of HBMCC cells was most markedly reduced by EV71.

The present invention provides the use of an interfering RNA of a protein tyrosine kinase FYN oncogene (FYN) for the preparation of a medicament for preventing or treating enterovirus 71 infection, and the use thereof for preparing a medicament for preventing or treating hand, foot and mouth disease, The sequence of the interfering RNA (siRNA) is selected from one of the following:

GCUCUGAAAUUACCAAAUCUU (SEQ ID NO: 64),

AUGAAUUAUAUCCAUAGAGAU (SEQ ID NO: 65),

GCCUCUUUGUCUAAAACAAUA (SEQ ID NO: 66).

Among them, the expression of FYN was down-regulated by the siRNA as shown in SEQ ID NO: 64, and the infection of HBMCC cells was most markedly reduced by EV71.

The present invention provides an application of an interfering RNA of an embryonic FYN-related substrate EFS molecule in the preparation of a medicament for preventing or treating enterovirus 71 infection, and an application thereof for preparing a medicament for preventing or treating hand, foot and mouth disease, said interfering RNA ( The sequence of siRNA) is as follows:

AUGGUGCAGUGUGUAACAGAA (SEQ ID NO: 58),

GUAUGACUAUGUCCACCUGAA (SEQ ID NO: 59),

CUGUACUUCUAUGCUGGGCAA (SEQ ID NO: 60).

Among them, the expression of EFS was down-regulated by siRNA as shown in SEQ ID NO: 60, and the infection of HBMCC cells was most markedly reduced by EV71.

The present invention screens novel host cell molecules ARF6, FYN, EFS capable of inhibiting EV71 infection of HBMEC cells. After down-regulation of ARF6, FYN and EFS genes, the normal physiological functions of the cells were not affected, but the infection of HBMCC cells by EV71 was significantly inhibited.

Therefore, the present invention provides a new target and treatment plan for clinical prevention and treatment of the blood-brain barrier disability caused by EV71 infection.

DRAWINGS

Figure 1 shows the interference efficiency and cytotoxicity of transfected siRNAs transfected with effective host cells. The main axis indicates the interference efficiency and the secondary axis indicates the cytotoxicity.

CTRL: HBMEC cell group (empty cell group) that does not transfect any siRNA;

NT: HBMEC cell group transfected with non-targeting siRNA (negative control group);

siRNA: HBMEC cell group (experimental group) transfected with siRNA against each gene of interest.

Figure 2 shows the effect of immunofluorescence on the detection of EV71 infection after down-regulation of transmembrane transport molecules in each host cell. A is the fluorescence detection of virus infectivity after down-regulating each molecule, and B is the inhibition rate of virus infection after down-regulating each molecule. Figure

CTRL: HBMEC cell group (empty cell group) that does not transfect any siRNA;

Figure 3 shows the interference efficiency and cytotoxicity of transfected effective host cell transmembrane transport signaling regulator siRNA. The main axis shows the interference efficiency and the secondary axis indicates the cytotoxicity.

CTRL: HBMEC cell group (empty cell group) that does not transfect any siRNA;

Figure 4 shows the effect of immunofluorescence on the detection of EV71 infection after down-regulation of transmembrane transport signaling molecules in each host cell. A is the fluorescence observation of virus infectivity after down-regulating each molecule, and B is the virus infection after down-regulating each molecule. Inhibition rate map;

CTRL: HBMEC cell group (empty cell group) that does not transfect any siRNA;

Figure 5 shows the effect of ARF6 down-regulation on EV71 infection. A is the expression of ARF6 protein by Western Blot, B is the cytopathic effect of EV71, and C is the EV71 virus.

CTRL: HBMEC cell group (empty cell group) that does not transfect any siRNA;

NT-CTRL: HBMEC cell group transfected with non-targeting siRNA (negative control group);

ARF6: HBMEC cell group transfected with siRNA against the ARF6 gene (SEQ ID NO: 4).

Figure 6 is a graph showing the interference efficiency and the effect on the EV71 infectivity after transfecting different interference sequences of ARF6 molecule, A is the mRNA level detection map of ARF6 gene, and B is the EV71 virus quantity detection map;

CTRL: HBMEC cell group (empty cell group) that does not transfect any siRNA;

ARF6-4: HBMEC cell group transfected with siRNA against the ARF6 gene (SEQ ID NO: 4);

ARF6-5: HBMEC cell group transfected with siRNA against the ARF6 gene (SEQ ID NO: 5);

ARF6-6: HBMEC cell group transfected with siRNA against the ARF6 gene (SEQ ID NO: 6).

Figure 7 shows the effect of FYN down-regulation on EV71 infection, in which A is the expression of FYN protein by Western Blot, B is the cytopathic effect of EV71, and C is the EV71 virus.

CTRL: HBMEC cell group (empty cell group) that does not transfect any siRNA;

FYN: HBMEC cell group transfected with siRNA against the EFS gene (SEQ ID NO: 64).

Figure 8 is a graph showing the interference efficiency and the effect on the EV71 infectivity after transfecting different interference sequences of FYN molecules. A is the mRNA level detection map of FYN gene, and B is the EV71 virus quantity detection map;

CTRL: HBMEC cell group (empty cell group) that does not transfect any siRNA;

FYN-64: HBMEC cell group transfected with siRNA against the FYN gene (SEQ ID NO: 64);

FYN-65: HBMEC cell group transfected with siRNA against the FYN gene (SEQ ID NO: 65);

FYN-66: HBMEC cell group transfected with siRNA against the FYN gene (SEQ ID NO: 66).

Figure 9 shows the effect of EFS on EV71 infection after down-regulation. A is the expression of EFS protein by Western Blot, B is the cytopathic effect of EV71, and C is the EV71 virus.

CTRL: HBMEC cell group (empty cell group) that does not transfect any siRNA;

EFS: HBMEC cell group transfected with siRNA against the EFS gene (SEQ ID NO: 60).

Figure 10 is a graph showing the interference efficiency and the effect on the EV71 infectivity after transfecting different interference sequences of EFS molecules. A is the mRNA level detection map of EFS gene, and B is the EV71 virus quantity detection map;

CTRL: HBMEC cell group (empty cell group) that does not transfect any siRNA;

EFS-58: HBMEC cell group transfected with siRNA against the EFS gene (SEQ ID NO: 58);

EFS-59: HBMEC cell group transfected with siRNA against the EFS gene (SEQ ID NO: 59);

EFS-60: HBMEC cell group transfected with siRNA against the EFS gene (SEQ ID NO: 60).

detailed description

The present invention will now be described in detail in connection with the embodiments and drawings, but the invention is not limited thereto.

The reagents and starting materials used in the present invention are either commercially available or can be prepared by literature methods. The experimental methods in the following examples which do not specify the specific conditions are usually carried out according to the conditions described in the conventional conditions such as Sambrook et al., Molecular Cloning: A Laboratory Guide (New York: Cold Spring Harbor Laboratory Press, 1989), or conventionally. Conditions, or in accordance with the conditions recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated.

Example 1:

1 Design and synthesize specific siRNA sequences of each host cell molecule.

1.1 For each gene of interest, the NCBI GeneBank was searched to obtain the full sequence and mRNA sequence. The existing network resources and common software were used to conduct biological analysis of each target gene, and the coding region was selected as the target sequence designed by siRNA. Refer to the siRNA design principles and compare the blast function of the GeneBank database with the human genome sequence to ensure no homology; exclude potential siRNAs that are paired with other genes by 8 bases of the 5' end of the antisense strand; exclude any continuous 14 Potential siRNAs with bases paired with other genes. The pre-assessment and determination were carried out by using the design software. Three optimal kinetic parameter targets were selected and entered into the subsequent experimental procedure. Three interfering sequences were synthesized for each gene, as shown in Table 1.

1.2 Synthesis and purification of single-stranded siRNA was performed by Invitrogen.

Table 1. Design of siRNA targets

2 siRNA sequence screening and interference effect identification

2.1 RNA transfection

The transfection step is described in the Lipofectamine 2000 instructions.

1) HBMEC cells (purchased from Sciencell, accession number: 1000) were plated on 24-well cell culture plates 12-16 hours in advance so that the cell density during transfection was 80%-90%.

2) 2 μL of Lipofectamine 2000 was added to 50 μL of opti-MEM and gently mixed, incubated for 5 minutes at room temperature; another 5 μL of 5 μM of interfering RNA and 50 μL of opti-MEM were mixed. At the end of the incubation, the diluted Lipofectamine 2000 transfection reagent is added to the diluted RNA and gently pipetted. After incubation for 20 min at room temperature, Add to HBECC cells and add 400 μL of opti-MEM to a final RNA concentration of 50 nM.

3) Replace the fresh medium containing the double antibody 6-8 hours after transfection.

2.2 Real-time quantitative PCR (RT-PCR) detection of mRNA levels of each host molecule

1) TRIzol extracts total RNA from control and interference group cells, the specific steps are as follows:

After 48 hours of transfection, the supernatant was removed, 1 ml of TRIzol was added to the cells, and the cells were lysed by immersion at room temperature for 3-5 minutes. Add 1/5 volume of chloroform and mix vigorously for 15 seconds manually. Centrifuge at 12,000 rpm for 15 minutes at 4 °C. The upper aqueous phase was taken and transferred to a new EP tube, an equal volume of isopropanol was added, mixed well, and precipitated at room temperature for 10 minutes. Centrifuge at 12,000 rpm for 10 minutes at 4 °C. The supernatant was discarded and 1 ml of pre-cooled 75% ethanol was added. Centrifuge at 12,000 for 5 minutes at 4 °C. The supernatant was sufficiently discarded, and the RNA precipitate was air-dried at room temperature, and DEPC-treated water was added to dissolve the precipitate to obtain total RNA.

2) Use the takara reverse transcription kit to obtain the cDNA of the control and interference group cells. The specific steps are as follows:

Add the following reaction system to the PCR tube.

5×PrimeScript Buffer 2μL

PrimeScript RT Enzyme Mix 0.5μL

Random 6 mers0.5μL

Total RNA 500ng

Rnase Free dH ₂ O up to 10μL

The mixture was gently mixed, placed at 37 ° C for 15 minutes, and then placed at 85 ° C for 5 seconds to inactivate the reverse transcriptase.

3) Fluorescence quantitative RT-PCR detection

The reaction was carried out using takara's SYBR Premix Ex Taq kit, and the reaction system was as follows.

Two-step amplification was performed using a Rotor Gene 3000A instrument, pre-denaturation at 95 °C for 2 min, and 40 PCR cycles were performed, 95 ° C for 5 seconds, and 60 ° C for 30 seconds.

3 cytotoxicity experiment

The effect of transfection of siRNA on cell proliferation was detected by CCK-8 method. The specific steps are as follows:

Logarithmic growth phase cells were collected and seeded in 96-well plates at a density of 3000 per well. After the cells were attached to the cells overnight, the siRNAs were transfected, and the proliferation of the cells was examined after 48 hours of culture. The original medium was discarded, and 110 μL of fresh medium containing 10 μL of CCK-8 was added to each well. After 3 hours of culture, the absorbance of each well was measured at a wavelength of 450 nm using a multi-function microplate reader. The experiment was repeated 3 times independently and the average was calculated.

4 EV71 virus infects HBMEC cells

4.1 EV71 virus infection experiment of HBMEC cells

The EV71 virus infection experiment was performed 72 hours after HBMEC cells were transfected with RNA. The culture supernatant was aspirated and washed twice with pre-warmed PBS. The EV71 was inoculated with the virus amount of MOI=0.1, and the virus solution was discarded after incubating at 37 ° C for 2 hours, and washed with pre-warmed PBS three times, and the culture medium was added to continue the culture. .

4.2 Immunofluorescence staining for detection of EV71 antigen expression

HBMEC cells were cultured for 48 hours after infection with virus, and the expression of viral antigen was detected by immunofluorescence. The specific steps are as follows:

1) Cell fixation: The culture solution in the 96-well plate was removed, and the cells were washed twice with PBS, 100 μl of pre-cooled methanol was added to each well, and fixed at -20 ° C for 20 min, and the cells were washed 3 times with pre-cooled PBS.

2) Permeation: The fixed cells were added with 100 μl of 0.1% Triton X-100 per well, incubated for 15 min at room temperature, and washed 3 times with pre-cooled PBS.

3) Blocking: 100 μl of 3% BSA was added to each well and incubated for 1 h at room temperature.

4) Primary antibody incubation: 100 μl of EV71-specific murine monoclonal antibody 10F0 (1:2000 dilution) was added to each well, incubated for 1 h at room temperature, and washed 3 times with pre-cooled PBS.

5) Incubation of secondary antibody: 100 μl of AF 488 fluorescently labeled anti-mouse IgG (1:1000 dilution) was added to each well, and incubated at room temperature for 1 h in the dark, and washed twice with pre-cooled PBS in the dark.

6) Labeling nuclei: Add nuclear fluorescent dye DAPI (1:5000, diluted in PBS) to each well, incubate at room temperature for 15 min in the dark, and wash 3 times with pre-cooled PBS in the dark.

7) The number of green AF 488 positive cell clones was detected and calculated under a fluorescence microscope.

4.3 Western blotting.

(1) The total protein of the control group and the interference group HBMEC cells were separately extracted with the protein lysate.

(2) After protein quantification, 30 ug of protein was added to a 12.5% concentration polyacrylamide gel for electrophoresis, and the corresponding strips were intercepted and transferred to a PVDF membrane using an electrorotator.

(3) The non-specific site of the protein was blocked with 5% skim milk, then blocked with a specific antibody of the corresponding molecule, washed overnight at 4 ° C, washed three times with TBST buffer, and the primary antibody was washed away.

(4) The HRP-labeled secondary antibody was then incubated for 2 hours at room temperature and then washed three times with TBST buffer.

(5) Finally, use the color development solution to develop color and take a photo analysis.

4.4 RT-PCR detection of EV71 virus in cells

The HBMEC cells were cultured for 48 hours after infection with the virus. Total RNA was extracted from the control and interference groups by TRIzol, and cDNA was obtained by reverse transcription. The amount of EV71 virus was detected by RT-PCR. The specific steps are the same as 2.2.

5 experimental results:

5.1 Design, synthesize and screen for effective siRNA

For each gene sequence of interest, we designed multiple RNA interference target sequences, and used the design software to perform pre-evaluation and determination. Three optimal kinetic parameter targets were selected to enter the subsequent experimental process, and each gene was synthesized into three interferences. The sequence is shown in Table 1.

Interfering RNA of each gene was transfected into HBMEC cells by in vitro transfection. After 48 hours, the interference efficiency of each interfering RNA was detected by RT-PCR. Finally, the siRNA sequence with the best interference effect was screened for subsequent experiments. The interference efficiency is shown in Table 2 and Table 3.

Table 2 RT-PCR detection of siRNA interference sequences down-regulation efficiency of host transmembrane transporter genes

Note: CTRL: HBMEC cell group (empty cell group) that does not transfect any siRNA

NT: HBMEC cell group transfected with non-targeting siRNA (negative control group)

Table 3 RT-PCR detection of siRNA interference sequences for transmembrane transport signaling regulatory molecular gene down-regulation efficiency

5.2 Interference efficiency and cytotoxicity detection after siRNA interference

HBVEC cells were transfected with effective siRNAs for each host molecule. The interference efficiency of each interfering RNA was detected by RT-PCR 48 h after transfection, and the effect of transfection on HBMEC cytotoxicity was detected by CCK8.

The results are shown in Figure 1. Compared with the CTRL group, the siRNA group transfected with effective transmembrane transporter could significantly inhibit the expression of the corresponding gene after transfection of each siRNA (P<0.01).

The results are shown in Fig. 3. Compared with the CTRL group, the siRNA group transfected with the effective transmembrane transport signal regulation gene can significantly inhibit the expression of the corresponding gene after transfection of each siRNA (P<0.01).

Cytotoxicity experiments showed that each siRNA did not produce significant cytotoxicity after transfection (P>0.05), which had no effect on the normal physiological function of the cells and could be used in subsequent experiments.

5.3 Effect of siRNA interference on EV71 virus infection

After transfecting the effective siRNA of each host transmembrane transporter molecule to down-regulate the expression of host cell-related molecules, the same dose of EV71 virus was infected. After 48 hours of infection, the effect of each host molecule down-regulated on EV71 infection was detected by immunofluorescence. Compared to the control group, transfection of ARF6 siRNA (SEQ ID NO: 4) reduced the ARF6 gene and significantly reduced EV71 infection in HBMEC cells (Fig. 2A). By calculating the amount of virus, it was found that the ARF6 gene was down-regulated and the inhibition rate of the virus reached 87.65%, while the down-regulation of the other molecules did not significantly inhibit the infection of HBECC cells by EV71 (P>0.05) (Fig. 2B).

After transfecting the effective siRNA of each host transmembrane transport signaling regulator molecule to down-regulate the expression of host cell-related molecules, the same dose of EV71 virus was infected. After 48 hours of infection, the effect of each host molecule down-regulated on EV71 infection was detected by immunofluorescence. Compared with the control group, transfection of EFS siRNA (SEQ ID NO: 60) and transfection of FYN siRNA (SEQ ID NO: 64) reduced EFS and FYN genes, respectively, significantly reduced EV71 infection in HBMEC cells (Fig. 4A). By calculating the amount of virus, the inhibition rate of EFS gene was 77%, and the inhibition rate of FYN gene was 86%. The down-regulation of other molecules did not significantly inhibit EV71 infection in HBMEC cells (P>0.05). ) (Fig. 4B).

To confirm the inhibitory effect of ARF6 on EV71 infection, the expression of ARF6 protein was detected by immunoblotting after transfection of ARF6 siRNA, and the pathological changes were observed after infection with EV71, and the amount of EV71 virus was detected by RT-PCR. The results showed that transfection of the ARF6 molecule siRNA (SEQ ID NO: 4) significantly inhibited the expression of the ARF6 protein molecule (Fig. 5A). Compared with the control group, the down-regulation of ARF6 protein could inhibit cytopathic effects and the amount of virus in HBMEC cells was also significantly decreased (Fig. 5B, C), consistent with the results of immunofluorescence assay. This These results indicated that compared with the control cells, the ability of EV71 to infect HBMEC cells was significantly decreased and the amount of virus was decreased after down-regulation of ARF6 gene.

Further, siRNAs transfected with three ARF6 molecules, respectively, were observed to have an effect on viral infectivity. The results indicate that different siRNAs have different down-regulation efficiency for ARF6 molecules (Fig. 6A), wherein siRNA (SEQ ID NO: 4) has the highest interference efficiency, consistent with the previous results. The effect of siRNA on the infectivity of EV71 was detected. The inhibition rate of siRNA against EV71 was increased by more than 65%. High (Fig. 6B), suggesting that ARF6 molecules play an important role in EV71 infection of HBMEC. Therefore, ARF6 can be used as a new host target for inhibiting EV71 infection in HBMEC cells.

In order to clarify the inhibitory effect of FYN on EV71 infection, the expression of FYN protein was detected by immunoblotting after transfection of FYN siRNA, and the pathological changes were observed after infection with EV71, and the amount of EV71 virus was detected by RT-PCR. The results showed that transfection of the FYN molecule siRNA (SEQ ID NO: 64) significantly inhibited the expression of the FYN protein molecule (Fig. 7A). Compared with the control group, the down-regulation of FYN protein inhibited cytopathic effects and the amount of virus in HBMEC cells was also significantly decreased (Fig. 7B, C), consistent with the results of immunofluorescence assay. These results indicated that compared with the control cells, the ability of EV71 to infect HBECC cells was significantly decreased after the FYN gene was down-regulated, and the amount of virus was decreased.

Further, siRNAs transfected with three FYN molecules were observed to have an effect on viral infectivity. The results indicate that different siRNAs have different down-regulation efficiency for FYN molecules (Fig. 8A), wherein siRNA (SEQ ID NO: 64) has the highest interference efficiency, consistent with the previous results. The effect of detection of interference on the infectivity of EV71 found that the inhibition rate of siRNA against viral infection by siRNA of three FYN molecules could reach more than 60%, and the inhibition rate of EV71 infection was also increased with the increase of the efficiency of down-regulation of FYN molecules. High (Fig. 8B), suggesting an important role of FYN molecules in EV71 infection of HBMEC. Therefore, FYN can be used as a new host target for inhibiting EV71 infection in HBMEC cells.

To confirm the inhibitory effect of EFS on EV71 infection, the expression of EFS protein was detected by immunoblotting after transfection of EFS siRNA, and the pathological changes were observed after infection with EV71, and the amount of EV71 virus was detected by RT-PCR. The results showed that transfection of EFS molecule siRNA (SEQ ID NO: 60) significantly inhibited the expression of EFS protein molecules (Fig. 9A). Compared with the control group, the down-regulation of EFS protein expression inhibited cytopathic effects and the amount of virus in HBMEC cells was also significantly decreased (Fig. 9B, C), consistent with immunofluorescence assay results. These results indicated that compared with the control cells, the ability of EV71 to infect HBECC cells was significantly decreased and the amount of virus was decreased after down-regulating the EFS gene.

Further, siRNAs transfected with three EFS molecules, respectively, were observed to have an effect on viral infectivity. The results indicate that different siRNAs have different down-regulation efficiency for EES molecules (Fig. 10A), wherein siRNA (SEQ ID NO: 60) has the highest interference efficiency, consistent with the previous results. After detecting the effect of interference on the infectivity of EV71, it was found that the inhibition rate of siRNA against viral infection by EFS of three EFS molecules could reach more than 60%, and the inhibition rate of EV71 infection was also increased with the increase of the efficiency of down-regulation of EFS molecules. High (Fig. 10B), suggesting an important role of EFS molecules in EV71 infection of HBMEC. Therefore, EFS can serve as a new host target for inhibiting EV71 infection in HBMEC cells.

From the above experimental results, it was confirmed that the present invention screened novel host cell molecules ARF6, FYN and EFS capable of inhibiting EV71 infection of HBMEC cells. After the ARF6, FYN or EFS gene is down-regulated, it does not affect the normal cells. Physiological function, but significantly inhibited the infection of HBMCC cells by EV71. Therefore, the present invention provides a new target and treatment plan for clinical prevention and treatment of the blood-brain barrier disability caused by EV71 infection.

The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments, and those skilled in the art can make various equivalents without departing from the inventive spirit of the present invention. Variations or substitutions are intended to be included within the scope of the invention as defined by the appended claims.

Claims

A group of transmembrane transport-related molecules for the preparation or prevention of enterovirus 71 infection, the ADP-ribosylation factor 6, a protein tyrosine kinase FYN oncogene, or an embryonic FYN Related substrate EFS.
A group of transmembrane transport-related molecules for the preparation of a medicament for preventing or treating hand, foot and mouth disease, the ADP-ribosylation factor 6, a protein tyrosine kinase FYN oncogene, or an embryonic FYN-related EFS.
The use of a group of transmembrane transport-related molecules according to claim 1 for the preparation of a medicament for preventing or treating enterovirus 71 infection, characterized in that said medicament is capable of inhibiting or down-regulating ADP-ribosylating factor 6 An agent for the expression level of the protein tyrosine kinase FYN oncogene, or the embryonic FYN-related substrate EFS.
The use of a group of transmembrane transport-related molecules according to claim 3 for the preparation of a medicament for preventing or treating enterovirus 71 infection, which is characterized in that it inhibits or down-regulates ADP ribosylation factor 6, protein cheese The reagent for the expression of the FYN oncogene FYN oncogene, or the expression of the embryonic FYN-related substrate EFS is ADP ribosylation factor 6, protein tyrosine kinase FYN oncogene, or embryonic FYN-related substrate EFS siRNA, shRNA or siRNA-containing , a recombinant vector of shRNA.
The use of a group of transmembrane transport-related molecules according to claim 1 for the preparation of a medicament for preventing or treating enterovirus 71 infection, characterized in that the medicament is an interfering RNA of ADP ribosylation factor 6, The sequence of the interfering RNA is selected from any one of the following:

GCUCACAUGGUUAACCUCUAA (SEQ ID NO: 4),

GUCAAGUUCAACGUAUGGGAU (SEQ ID NO: 5),

GCAUUAUCAAUGACCGGGAGA (SEQ ID NO: 6).
The use of a group of transmembrane transport-related molecules according to claim 1 for the preparation of a medicament for preventing or treating enterovirus 71 infection, characterized in that the medicament is an interfering RNA of FYN, the sequence of the interfering RNA Choose one of the following:

GCUCUGAAAUUACCAAAUCUU (SEQ ID NO: 64),

AUGAAUUAUAUCCAUAGAGAU (SEQ ID NO: 65),

GCCUCUUUGUCUAAAACAAUA (SEQ ID NO: 66).
The use of a group of transmembrane transport-related molecules according to claim 1 for the preparation of a medicament for preventing or treating enterovirus 71 infection, characterized in that said medicament is an interfering RNA of EFS, said interfering RNA The sequence is selected from one of the following:

AUGGUGCAGUGUGUAACAGAA (SEQ ID NO: 58),

GUAUGACUAUGUCCACCUGAA (SEQ ID NO: 59),

CUGUACUUCUAUGCUGGGCAA (SEQ ID NO: 60).
The use of a group of transmembrane transport-related molecules according to claim 2 for the preparation of a medicament for preventing or treating hand, foot and mouth disease, characterized in that said medicament is capable of inhibiting or downregulating ADP ribosylation factor 6, protein cheese An agent for the expression level of the FCN oncogene, or the FYN-related substrate EFS.
The use of a group of transmembrane transport-related molecules according to claim 8 for the preparation of a medicament for preventing or treating hand, foot and mouth disease, which is capable of inhibiting or downregulating ADP ribosylation factor 6, protein tyrosine kinase The FYN oncogene, or the expression level of the embryonic FYN-related substrate EFS is ADP ribosylation factor 6, protein tyrosine kinase FYN oncogene, or siRNA, shRNA of embryonic FYN-related substrate EFS or siRNA, shRNA-containing Recombinant vector.
The use of a group of transmembrane transport-related molecules according to claim 2 for the preparation of a medicament for preventing or treating hand, foot and mouth disease, characterized in that the medicament is an interfering RNA of ADP ribosylation factor 6, said interference The sequence of the RNA is selected from one of the following:

GCUCACAUGGUUAACCUCUAA (SEQ ID NO: 4),

GUCAAGUUCAACGUAUGGGAU (SEQ ID NO: 5),

GCAUUAUCAAUGACCGGGAGA (SEQ ID NO: 6).
The use of a group of transmembrane transport-related molecules according to claim 2 for the preparation of a medicament for preventing or treating hand, foot and mouth disease, characterized in that the drug is an interfering RNA of FYN, and the sequence of the interfering RNA is selected from the following Either:

GCUCUGAAAUUACCAAAUCUU (SEQ ID NO: 64),

AUGAAUUAUAUCCAUAGAGAU (SEQ ID NO: 65),

GCCUCUUUGUCUAAAACAAUA (SEQ ID NO: 66).
The use of a group of transmembrane transport-related molecules according to claim 2 for the preparation of a medicament for preventing or treating hand, foot and mouth disease, characterized in that the medicament is an interfering RNA of EFS, and the sequence of the interfering RNA is selected from the group consisting of Any of the following:

AUGGUGCAGUGUGUAACAGAA (SEQ ID NO: 58),

GUAUGACUAUGUCCACCUGAA (SEQ ID NO: 59),

CUGUACUUCUAUGCUGGGCAA (SEQ ID NO: 60).